An SSR core primer combination, kit and application for identifying the tea tree variety "Danxia No. 8"
By developing the SSR core primer combination and kit for the tea tree variety ‘Danxia No. 8’, the SSR fluorescent labeling detection technology is used to solve the problem of inaccurate traditional identification methods, and the rapid and accurate identification of ‘Danxia No. 8’ is achieved, and the reliability and detection efficiency of the identification results are improved.
Patent Information
- Application Number
- CN202510292916.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-13
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2045-03-13
AI Technical Summary
Traditional methods have inaccurate identification of tea tree variety ‘Danxia No. 8’, which is affected by factors such as growth period, cultivation measures, and environmental conditions.
A SSR core primer combination and kit for identification of tea tree variety ‘Danxia No. 8’ was developed. Using SSR fluorescent labeling detection technology, characteristic bands were identified through PCR amplification and capillary electrophoresis typing to identify varieties.
The rapid and accurate identification of "Danxia No. 8" was achieved, and the uncertainty of identification based on external morphological characteristics was overcome. The results were reliable, the detection efficiency was high, and suitable for the promotion, utilization and protection of varieties.
Smart Images

Figure CN119876475B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of identification of variety resources and germplasm innovation, and particularly relates to an SSR core primer combination, a kit and an application for identifying the tea tree variety "Danxia No. 8". Background Art
[0002] "Danxia No. 8" is an excellent tea tree variety selected from natural mutant strains of the wild Renhua white hair tea wild population. Its characteristics are as follows: the tree posture is semi-spreading, the leaves are obliquely arranged upwards, lanceolate, the leaf color is green, the leaf surface is flat, the leaf body is folded inwards, the leaf margin is wavy, the leaf tip is acuminate, the leaf teeth are sharp-medium, and the leaf texture is hard. The flower is solitary, the flower shape is single-petal, the petals are milky white and there are 5 petals, compound pistil, located in the center of the stamen group, and the style is 3-lobed shallowly. It is suitable for making high-quality red and white teas. When making black tea, the tea strips are tight, thin, uniform and have tips, fully covered with golden hairs, with a complex rose fragrance and a strong and lasting medicinal fragrance, the taste is strong, fresh and brisk, and the soup color is dark red and bright; when making white tea, the bud tips are straight and slender, fully covered with white and clean hairs, the soup color is apricot yellow and bright, and the taste is sweet, mellow, fresh and brisk, rich and fragrant with magnolia flower fragrance.
[0003] The traditional method for identifying "Danxia No. 8" is that the identifier makes a judgment based on its external morphological characteristics and years of work experience. This is easily affected by factors such as the growth years, cultivation measures, development stage, cultivation measures and environmental conditions of "Danxia No. 8", and the identification results have great inaccuracy. Therefore, in order to better identify the variety of "Danxia No. 8", developing an accurate and rapid method suitable for identifying the "Danxia No. 8" variety has become a technical problem that needs to be solved urgently by those skilled in the art.
[0004] Molecular marker technology can quickly, accurately and efficiently identify varieties, and has good application prospects in the evaluation and protection of variety specificity by using molecular marker methods. Summary of the Invention
[0005] To overcome the above-mentioned defects and deficiencies in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea tree variety "Danxia No. 8".
[0006] The first object of the present invention is to provide an SSR core primer combination for identifying the tea tree variety "Danxia No. 8".
[0007] The second object of the present invention is to provide the application of the above SSR core primer combination in the preparation of an identification product for the tea tree variety "Danxia No. 8".
[0008] The third object of the present invention is to provide the application of a product containing the above SSR core primer combination in identifying the tea tree variety "Danxia No. 8".
[0009] The fourth object of the present invention is to provide a kit for identifying the tea tree variety "Danxia No. 8".
[0010] The fifth object of the present invention is to provide a method for identifying the tea tree variety "Danxia No. 8".
[0011] To achieve the above object, the present invention provides an SSR core primer combination for identifying the tea tree variety "Danxia No. 8", and the SSR core primer combination comprises SSR core primers shown by nucleotide sequences of DX8.SSR-1-F, DX8.SSR-1-R, DX8.SSR-2-F, DX8.SSR-2-R, DX8.SSR-3-F and DX8.SSR-3-R.
[0012] The 5' end of the SSR core primer shown by the nucleotide sequence DX8.SSR-1-F, the 5' end of the SSR core primer shown by the nucleotide sequence DX8.SSR-2-F and / or the 5' end of the SSR core primer shown by the nucleotide sequence DX8.SSR-3-F are labeled with a fluorescent reporter group.
[0013] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.
[0014] Use of any of the above SSR core primer combinations in the preparation of an identification product for the tea tree variety "Danxia No. 8".
[0015] Use of a product containing any of the above SSR core primer combinations in identifying the tea tree variety "Danxia No. 8".
[0016] A kit for identifying the tea tree variety "Danxia No. 8", comprising any of the above SSR core primer combinations.
[0017] The kit further comprises HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference, a negative control reference and ultrapure water.
[0018] A method for identifying the tea tree variety "Danxia No. 8", which uses any of the above SSR core primer combinations or kits for identification.
[0019] The method comprises the following steps:
[0020] S1. Extract the genomic DNA of the tea tree sample to be tested;
[0021] S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification using any of the above SSR core primer combinations;
[0022] S3. Type the PCR amplification product obtained in step S2, and perform band discrimination on the typing result:
[0023] The SSR core primers with nucleotide sequences shown as DX8.SSR-1-F and DX8.SSR-1-R amplify two characteristic bands of 260 bp and 264 bp. The SSR core primers with nucleotide sequences shown as DX8.SSR-2-F and DX8.SSR-2-R amplify two characteristic bands of 420 bp and 423 bp. The SSR core primers with nucleotide sequences shown as DX8.SSR-3-F and DX8.SSR-3-R amplify two characteristic bands of 272 bp and 287 bp. Then it indicates that the tested tea tree sample is "Danxia No. 8"; the appearance of other bands indicates that the tested tea tree sample is not "Danxia No. 8".
[0024] The method for typing described in step S3 is to perform capillary electrophoresis on the PCR amplification product; for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O is added to make up 10 μL; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; finally, extension at 60°C for 30 min.
[0025] Advantages and effects of the present invention:
[0026] The present invention discloses an SSR core primer combination, kit and application for identifying the tea tree variety "Danxia No. 8". The present invention uses SSR fluorescence labeling detection technology to screen out 3 pairs of SSR core primers, and these 3 pairs of SSR core primers can quickly identify and detect "Danxia No. 8" from other tea tree varieties. The SSR core primer combination disclosed by the present invention can identify the variety of "Danxia No. 8", overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the variety of "Danxia No. 8". Description of the Drawings
[0027] Figure 1 Capillary electrophoresis bands of 21 tea tree varieties / lines amplified by the specific SSR core primers DX8.SSR-1-F and DX8.SSR-1-R in Example 1.
[0028] Figure 2 Capillary electrophoresis bands of 21 tea tree varieties / lines amplified by the specific SSR core primers DX8.SSR-2-F and DX8.SSR-2-R in Example 1.
[0029] Figure 3 Capillary electrophoresis bands of 21 tea tree varieties / lines amplified by the specific SSR core primers DX8.SSR-3-F and DX8.SSR-3-R in Example 1.
[0030] Figure 4 Capillary electrophoresis bands of 31 tea tree varieties / lines amplified by the specific SSR core primers DX8.SSR-1-F and DX8.SSR-1-R in Example 2.
[0031] Figure 5 Capillary electrophoresis bands of 31 tea tree varieties / lines amplified by the specific SSR core primers DX8.SSR-2-F and DX8.SSR-2-R in Example 2.
[0032] Figure 6 Capillary electrophoresis bands of 31 tea tree varieties / lines amplified by the specific SSR core primers DX8.SSR-3-F and DX8.SSR-3-R in Example 2. Detailed implementation manners
[0033] The present invention will be further described below in conjunction with specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.
[0034] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0035] Example 1 Obtaining of the specific primer sequence of "Danxia No. 8"
[0036] I. Experimental method
[0037] 1. SSR primer design
[0038] The MISA software was used to retrieve the genomic sequences in the tea tree genome database (http: / / tpia.teaplants.cn / ), and the SSR loci in the genomic sequences were retrieved. 200 pairs of SSR primers were designed in batches using Primer 5.0, and the primers were synthesized by Beijing Yuewei Gene Technology Co., Ltd.
[0039] 2. Extraction of DNA of tea tree varieties
[0040] Twenty-one tea tree varieties / lines with similar genetic relationships and phenotypes such as "Danxia No. 8", "Huangkeng White Hair No. 5", "Luokeng-2", "Danxia No. 9", and the hybrid offspring of Danxia No. 8 and Qingshan No. 1 (numbers A16 - A21) were preliminarily screened. The specific tea tree varieties / lines used for the preliminary screening are shown in Table 1 (obtained from the Tea Germplasm Resource Bank of Guangdong Province).
[0041] Table 1. 21 tea tree varieties / lines used for preliminary screening
[0042]
[0043] Extract the DNA of 21 tea tree varieties / lines (Table 1) used for preliminary screening. The specific steps for DNA extraction are as follows:
[0044] a) Add liquid nitrogen to tea tree leaves and grind them thoroughly. Weigh about 100 mg of the ground powder.
[0045] b) Quickly add 400 μL of buffer GPS and 10 μL of RNase A to the ground powder. After quickly vortexing and mixing, place the centrifuge tube in a 65 °C water bath for 15 min. During the water bath, invert the centrifuge tube several times to mix the sample.
[0046] c) Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.
[0047] d) Add an equal volume of absolute ethanol and mix well. At this time, flocculent precipitates may appear.
[0048] e) Transfer both the solution and the flocculent precipitate obtained in the previous step to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, pour out the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.
[0049] f) Add 550 μL of deproteinization solution RD to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, pour out the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.
[0050] g) Add 700 μL of washing solution PW to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, pour out the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.
[0051] h) Repeat step g.
[0052] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12000 rpm for 2 min, discard the collection tube, then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube, and air-dry at room temperature for 5 - 10 min.
[0053] j) Add 50 - 100 μL of elution buffer TB to the RNase-Free adsorption column CR2, let it stand at room temperature for 3 - 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into a centrifuge tube to obtain the genomic DNA of tea tree.
[0054] 3. PCR Amplification
[0055] Using the genomic DNA of tea tree extracted in step 2 above as a template, perform PCR amplification using SSR fluorescence labeling detection technology. The primers include an upstream primer labeled with a fluorescent reporter group at the 5' end (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and FAM fluorescence labeling is used in this invention) and a downstream primer. The PCR amplification guided by the upstream primer labeled with a fluorescent reporter group at the 5' end produces a fluorescent PCR product.
[0056] Among them, for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O to make up 10 μL.
[0057] The PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.
[0058] 4. Genotyping Detection
[0059] Capillary electrophoresis detection: Add 9 μL of the mixture of molecular weight internal standard and formamide (volume ratio 0.5:8.5) and 1.0 μL of PCR product to each well of the 96-well plate; denature at 95°C for 3 min, and perform genotyping detection using a 3730XL DNA analyzer.
[0060] 5. Data Analysis
[0061] Import the original data file obtained by the 3730XL DNA analyzer into the analysis software genemapper ID 3.2 for band discrimination analysis.
[0062] II. Experimental Results
[0063] Three pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely DX8.SSR-1-F, DX8.SSR-1-R, DX8.SSR-2-F, DX8.SSR-2-R, DX8.SSR-3-F, and DX8.SSR-3-R. The primer sequences are shown in Table 2.
[0064] Table 2 Specific SSR Core Primer Sequences
[0065]
[0066] The capillary electrophoresis band statistical results of these 3 pairs of specific SSR core primers amplifying 21 tea tree varieties / lines (Table 1) are shown in Table 3 and Figures 1 to 3 as follows. The results show that characteristic bands appeared in "Danxia No. 8", specifically:
[0067] (1) The specific SSR core primers DX8.SSR-1-F and DX8.SSR-1-R amplified two characteristic bands of 260 bp and 264 bp;
[0068] (2) The specific SSR core primers DX8.SSR-2-F and DX8.SSR-2-R amplified two characteristic bands of 420 bp and 423 bp;
[0069] (3) The specific SSR core primers DX8.SSR-3-F and DX8.SSR-3-R amplified two characteristic bands of 272 bp and 287 bp.
[0070] The above results indicate that the 3 pairs of specific SSR core primers can amplify characteristic bands for the tea tree variety "Danxia No. 8". Therefore, "Danxia No. 8" can be distinguished from the other 20 tea tree varieties / lines with similar genetic relationships and phenotypes.
[0071] Table 3 Statistical Results of Capillary Electrophoresis Bands of 3 Pairs of Specific SSR Core Primers for 21 Tea Tree Varieties / Lines
[0072]
[0073] Example 2
[0074] Further Verification of 3 Pairs of Specific SSR Core Primers
[0075] I. Experimental Method
[0076] The 3 pairs of specific SSR core primers DX8.SSR-1-F and DX8.SSR-1-R, DX8.SSR-2-F and DX8.SSR-2-R, DX8.SSR-3-F and DX8.SSR-3-R screened for identifying "Danxia No. 8" were further verified. Thirty tea tree varieties currently promoted and applied in production were selected for amplification detection simultaneously with "Danxia No. 8". The 31 tea tree varieties are shown in Table 4 specifically.
[0077] Table 4 31 Tea Tree Varieties Currently Promoted and Applied in Production
[0078]
[0079] The methods for extracting DNA of tea tree varieties, PCR amplification, genotyping detection, and data analysis were carried out according to Example 1.
[0080] II. Experimental Results
[0081] The statistical results of capillary electrophoresis bands amplified by 3 pairs of specific SSR core primers for 31 tea tree varieties (Table 4) are shown in Table 5 and Figures 4 to 6 as follows. The results show that only "Danxia No. 8" showed characteristic bands, specifically:
[0082] (1) Two characteristic bands of 260 bp and 264 bp were amplified by specific SSR core primers DX8.SSR-1-F and DX8.SSR-1-R;
[0083] (2) Two characteristic bands of 420 bp and 423 bp were amplified by specific SSR core primers DX8.SSR-2-F and DX8.SSR-2-R;
[0084] (3) Two characteristic bands of 272 bp and 287 bp were amplified by specific SSR core primers DX8.SSR-3-F and DX8.SSR-3-R.
[0085] The above results indicate that 3 pairs of specific SSR core primers can amplify specific allelic loci for the tea tree variety "Danxia No. 8", so "Danxia No. 8" can be distinguished from the other 30 tea tree varieties currently promoted and applied in production.
[0086] Table 5 Statistical results of capillary electrophoresis bands of 31 promoted tea tree varieties
[0087]
[0088] Example 3
[0089] A method for identifying "Danxia No. 8" using a specific SSR core primer combination
[0090] 1. Extract the DNA of the tea tree variety "Danxia No. 8" according to the method of Example 1;
[0091] 2. Using the DNA extracted in step 1 as a template, PCR amplification was performed using 3 pairs of specific SSR core primers, DX8.SSR-1-F and DX8.SSR-1-R, DX8.SSR-2-F and DX8.SSR-2-R, DX8.SSR-3-F and DX8.SSR-3-R. The sequences of the 3 pairs of specific SSR core primers are as follows. The 5' ends of the upstream primers are all labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX. In this invention, HEX fluorescence labeling is used):
[0092] DX8.SSR-1-F: GTAGACTACGCTTGGTTGCCAT;
[0093] DX8.SSR-1-R: CTTGTGCGAATCTTGAGACTCTAG;
[0094] DX8.SSR-2-F: TCCACAACGACAACACCAACA;
[0095] DX8.SSR-2-R: GCAGATACAGAAACGACCAGGTC;
[0096] DX8.SSR-3-F: TCATGAATATCACAAACCTGGTAACT;
[0097] DX8.SSR-3-R: CCTCAGATTGACCTGCATGAGTT;
[0098] 3. The PCR amplification method was carried out in accordance with Example 1:
[0099] The PCR products obtained in step 2 were subjected to genotyping detection and data analysis. Both the genotyping detection and data analysis methods were carried out in accordance with Example 1.
[0100] 4. Result interpretation:
[0101] If the amplification products of the 3 pairs of specific SSR core primers respectively show the following characteristic bands, it indicates that the tea tree variety to be tested is "Danxia No. 8"; if the following characteristic bands do not appear respectively, it indicates that the tea tree variety to be tested is not "Danxia No. 8":
[0102] (1) The specific SSR core primers DX8.SSR-1-F and DX8.SSR-1-R amplified two characteristic bands of 260 bp and 264 bp;
[0103] (2) The specific SSR core primers DX8.SSR-2-F and DX8.SSR-2-R amplified two characteristic bands of 420 bp and 423 bp;
[0104] (3)The specific SSR core primers DX8.SSR-3-F and DX8.SSR-3-R amplified two characteristic bands of 272bp and 287bp.
[0105] Example 4
[0106] A kit for identifying the tea cultivar "Danxia No. 8"
[0107] I. Composition
[0108] (1)Three pairs of specific SSR core primers, with the 5' ends of the upstream primers labeled with fluorescent reporter groups (the fluorescent reporter groups can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):
[0109] DX8.SSR-1-F: GTAGACTACGCTTGGTTGCCAT;
[0110] DX8.SSR-1-R: CTTGTGCGAATCTTGAGACTCTAG;
[0111] DX8.SSR-2-F: TCCACAACGACAACACCAACA;
[0112] DX8.SSR-2-R: GCAGATACAGAAACGACCAGGTC;
[0113] DX8.SSR-3-F: TCATGAATATCACAAACCTGGTAACT;
[0114] DX8.SSR-3-R: CCTCAGATTGACCTGCATGAGTT;
[0115] (2)HSTaq DNA polymerase, dNTPs, 10× Buffer, positive control reference, negative control reference, ultrapure water.
[0116] II. Usage method
[0117] Perform detection and result interpretation according to the method of Example 3.
[0118] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. An SSR core primer combination for identifying the tea variety "Danxia No. 8", characterized in that: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences of DX8.SSR-1-F, DX8.SSR-1-R, DX8.SSR-2-F, DX8.SSR-2-R, DX8.SSR-3-F and DX8.SSR-3-R; wherein the primer sequence of DX8.SSR-1-F is GTAGACTACGCTTGGTTGCCAT; the primer sequence of DX8.SSR-1-R is CTTGTGCGAATCTTGAGACTCTAG; the primer sequence of DX8.SSR-2-F is TCCACAACGACAACACCAACA; the primer sequence of DX8.SSR-2-R is GCAGATACAGAAACGACCAGGTC; the primer sequence of DX8.SSR-3-F is TCATGAATATCACAAACCTGGTAACT; the primer sequence of DX8.SSR-3-R is CCTCAGATTGACCTGCATGAGTT.
2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence DX8.SSR-1-F, the 5' end of the SSR core primer shown in the nucleotide sequence DX8.SSR-2-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence DX8.SSR-3-F is labeled with a fluorescent reporter group.
3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.
4. Use of the SSR core primer combination described in any one of claims 1 to 3 in preparing an identification product of the tea variety "Danxia No. 8".
5. Use of a product comprising the SSR core primer combination according to any one of claims 1 to 3 in identifying the tea variety "Danxia No. 8", characterized in that: When the SSR core primers shown by the nucleotide sequences DX8.SSR-1-F and DX8.SSR-1-R amplify two characteristic bands of 260bp and 264bp, the SSR core primers shown by the nucleotide sequences DX8.SSR-2-F and DX8.SSR-2-R amplify two characteristic bands of 420bp and 423bp, and the SSR core primers shown by the nucleotide sequences DX8.SSR-3-F and DX8.SSR-3-R amplify two characteristic bands of 272bp and 287bp, it indicates that the tea tree sample to be tested is "Danxia No. 8"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 8".
6. A kit for identifying the tea variety "Danxia No. 8", characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.
7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance and ultrapure water.
8. A method for identifying the tea variety "Danxia No. 8", characterized in that: Identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7. When the SSR core primers shown by the nucleotide sequences DX8.SSR-1-F and DX8.SSR-1-R amplify two characteristic bands of 260 bp and 264 bp, the SSR core primers shown by the nucleotide sequences DX8.SSR-2-F and DX8.SSR-2-R amplify two characteristic bands of 420 bp and 423 bp, and the SSR core primers shown by the nucleotide sequences DX8.SSR-3-F and DX8.SSR-3-R amplify two characteristic bands of 272 bp and 287 bp, it indicates that the tea tree sample to be tested is "Danxia No. 8"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 8".
9. The method according to claim 8, characterized in that The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using the SSR core primer combination described in any one of claims 1 to 3; S3. Typing the PCR amplification product obtained in step S2, and performing band identification on the typing results.
Citation Information
Patent Citations
SSR (Simple Sequence Repeat) core primer combination and kit for identifying tea tree variety 'Yinghong No.9' and application of SSR core primer combination and kit
CN118186143A
SSR (Simple Sequence Repeat) primer combination for rapidly identifying tea tree varieties and application of SSR primer combination
CN118600094A