A primer for rapidly identifying the Gossypium mustelinum species in diploid and tetraploid cotton and its application
By providing specific primers 515-32, a specific 310 bp sequence can be amplified in PCR, solving the difficulties in identifying tan cotton cotton seeds in the prior art, and achieving rapid identification in diploid and tetraploid cotton, which has important practical value.
Patent Information
- Application Number
- CN202510368074.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-26
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2045-03-26
AI Technical Summary
The prior art lacks a method for rapid identification of tan cotton cotton seeds, especially in diploid and tetraploid cotton, which is prone to difficulty in identification due to DNA confusion.
A specific primer 515-32 is provided for amplifying a specific 310 bp nucleotide sequence in PCR, which can be amplified in PCR with genomic DNA templates of tan cotton seeds, while there is no product in PCR with other cotton seeds DNA templates.
It has achieved rapid identification of yellow-brown cotton seeds in diploid and tetraploid cotton, solved the problem of DNA confusion, and has important practical value.
Smart Images

Figure CN119876481B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology, in particular to primers for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton and applications thereof. Background Art
[0002] Polymerase Chain Reaction (PCR) is a molecular biology technique that relies on specific primers to recognize complementary sites, catalyzed by DNA polymerase, and based on the principles of DNA replication to amplify specific DNA fragments. It is a specialized, controllable DNA replication process outside of a living organism. PCR is used to multiply small amounts of DNA thousands of times. The basic principles of PCR technology are similar to the natural DNA replication process, and its specificity relies on oligonucleotide primers that are complementary to the target sequence at both ends.
[0003] PCR consists of three basic reaction steps: denaturation, annealing, and extension: ① Denaturation of template DNA: After the template DNA is heated to about 95°C for a certain period of time, the double-stranded template DNA or the double-stranded DNA formed by PCR amplification is dissociated, making it a single strand so that it can bind to the primer and prepare for the next round of reaction; ② Annealing (renaturation) of template DNA and primer: After the template DNA is denatured into a single strand by heating, the temperature is reduced to about 55°C, and the primers pair and bind to the complementary sequence of the single-stranded template DNA; ③ Extension of primers: At 72°C and under the action of DNA polymerase (such as TaqDNA polymerase), the DNA template-primer complex uses dNTP as the reaction raw material and the target sequence as the template. According to the principle of base complementary pairing and semiconservative replication, a new semiconservative replication chain complementary to the template DNA chain is synthesized. Repeating the three processes of denaturation, annealing, and extension can obtain more "semiconservative replication chains", and this new chain can become the template for the next cycle. It takes 2 to 4 minutes to complete one cycle, and the target gene can be amplified millions of times in 2 to 3 hours.
[0004] Cotton is a major economic crop worldwide. The genus Gossypium comprises 52 species, including five tetraploids and 47 diploids. Yellow-brown cotton, a species of allotetraploid cotton and the earliest evolutionary lineage of tetraploid cotton, exhibits exceptional environmental adaptability and possesses numerous stress-resistance genes. It is the most salt-tolerant of all cotton species and a popular research target for researchers. However, in practical experiments, we often encounter situations where tissue or DNA from two or more genomic cotton species may be mixed or there may be other reasons for the rapid identification of these species. Currently, there are no rapid identification methods for yellow-brown cotton species. Summary of the Invention
[0005] The purpose of the present invention is to provide a primer for quickly identifying yellow-brown cotton species in diploid and tetraploid cotton and its application.
[0006] In order to achieve the above object, the technical solution of the present invention is:
[0007] In a first aspect, the present invention provides a primer for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton.
[0008] In a second aspect, the present invention also provides the use of the above primers for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton in the preparation of yellow-brown cotton species identification products.
[0009] In a third aspect, the present invention also provides a kit for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton, comprising the above-mentioned primers for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton.
[0010] Compared with the prior art, the technical effects of the present invention are:
[0011] The primers provided by the present invention are used for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton. The primers can amplify a specific 310bp nucleotide sequence in a PCR using genomic DNA of the yellow-brown cotton species as a template, while no product is produced in a PCR using genomic DNA of other diploid or tetraploid cotton species as templates. The primers have good specificity and can therefore rapidly identify yellow-brown cotton species, thereby solving the problem of accidentally confusing yellow-brown cotton species DNA with other cotton species DNA during experimental work. The primers have important practical value. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments described in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.
[0013] Figure 1 The results are from PCR experiments using the specific primer "515-32" on the DNA of various cotton species.
[0014] Figure 2 The figures are the test results of PCR on the DNA of various cotton species using β-Actin as the internal reference primer in the examples of the present invention. DETAILED DESCRIPTION
[0015] In order to make those skilled in the art better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and Examples. Obviously, the embodiments described are only some embodiments of the present invention, rather than all embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent companies.
[0016] Example 1
[0017] The primers for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton (referred to as specific primers 515-32) of the present invention were used to perform PCR verification using DNA of 34 cotton species as templates.
[0018] 1 Materials and Methods
[0019] 1.1 Experimental Materials
[0020] The experimental material was nuclear genomic DNA of each cotton species shown in Table 1, with a concentration of 40 ng / μL; the primers were specific primers 515-32: forward primer F: CCTCGTTCTGGTTTTTAGGAGTACTC (as shown in SEQ ID No. 1); reverse primer R1: ACTCGGATCTTGACCCAGGGAATTA (as shown in SEQ ID No. 2).
[0021] Specific primer 515-32 was synthesized by Jilin Kumei Co., Ltd. and purified by PAGE. Taq Mix was 2× Taq Master Mix for PAGE from Vazyme. DNA loading buffer was also produced by Vazyme.
[0022] 50 μL PCR tube; PCR instrument from Techne; agarose gel made of TAE containing 1% agarose, electrophoresis solution is TAE; electrophoresis instrument produced by Junyi Company; gel imager also produced by Junyi Company.
[0023] 1.2 Experimental methods
[0024] 1) Add DNA, specific primer 515-32, and Taq Mix according to the above system proportions to a 50 μL sterilized PCR tube;
[0025] 2) Centrifuge the PCR tube, shake it, and place it in a PCR instrument after centrifugation. Run the PCR process described above: The PCR reaction system is as follows:
[0026]
[0027] The PCR reaction process is as follows:
[0028] ①Preheat denaturation at 94℃ for 10 min,
[0029] ② Denature at 94℃ for 45 seconds,
[0030] ③ Anneal at 58℃ for 45 seconds,
[0031] ④ Extension at 72°C for 1 min;
[0032] ⑤Go to step 2), 30cycles;
[0033] ⑥ Extension at 72°C for 10 min;
[0034] ⑦Save at 4℃.
[0035] 30 cycles, 95 minutes.
[0036] 3) Take out the product, mix it with DNA loading buffer according to the proportion, and apply it on the gel;
[0037] 4) Voltage: 110 V, current: 200 mA, electrophoresis time: 30 min;
[0038] 5) Take the glue and read the tape.
[0039] 2 Experimental results
[0040] The gel reading results showed that the specific primer 515-32 could produce the target band (310 bp) in yellow-brown cotton, but no product was detected in the other 33 cotton species (such as Figure 1 shown). Figure 1 The names of cotton species corresponding to each genome are shown in Table 1.
[0041] Table 1 Information on 34 cotton varieties
[0042]
[0043] Control Example
[0044] The following uses the universal primer β-Actin (actin, an important cytoskeletal protein of cells) as the internal reference primer for PCR to detect the availability of DNA from various cotton species. Except for the different primers, other experimental materials and methods are the same as those in Example 1.
[0045] The gel reading results showed that β-Actin could amplify a band of about 600 bp in length in 34 cotton species DNA (such as Figure 2 The test showed that DNA from all 34 cotton species was usable and that there was no problem with the PCR system. Figure 2 The names of cotton species corresponding to each genome are shown in Table 1.
[0046] In summary, the specific primer 515-32 of the present invention can amplify a specific 310bp nucleotide sequence in PCR using yellow-brown cotton species as a template, but no product is produced in PCR using other diploid or tetraploid cotton species as templates. It has good specificity and can therefore quickly identify yellow-brown cotton species, solving the problem of accidentally confusing yellow-brown cotton DNA with DNA from other cotton species in experimental work, and has important practical value.
[0047] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the foregoing drawings and description are illustrative in nature and should not be construed as limiting the scope of the claims.
Claims
1. A primer for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton, characterized in that: The forward primer nucleotide sequence of the primer is shown as SEQ ID No.1, and the reverse primer nucleotide sequence of the primer is shown as SEQ ID No.
2.
2. Use of the primers for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton according to claim 1 in the preparation of yellow-brown cotton species identification products.
3. A kit for rapid identification of yellow-brown cotton species in diploid and tetraploid cotton, characterized in that: The invention comprises the primers for rapidly identifying yellow-brown cotton species in diploid and tetraploid cotton as described in claim 1.
Citation Information
Patent Citations
Primer for identifying diploid A genome gossypiumand / ortetraploid gossypiumand PCR identification method with primer
CN106967833A
Cotton fiber length-related quantitative trait locus (QTL) and application thereof
CN107201403A