A metallothionein-based electrochemical detection method for total homocysteine
Through the electrochemical detection method based on metallothionein, the existing homocysteine detection method has solved the complex and high cost of reagents, and small-scale intelligence and fast and simple bedside detection are achieved, with the advantages of low cost and high sensitivity.
Patent Information
- Application Number
- CN202510368576.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-27
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-03-27
AI Technical Summary
The existing homocysteine detection methods have insufficient complex reagent components, high cost, and the need for large-scale testing equipment, making it difficult to achieve small-scale intelligence and quick and easy bedside testing.
Using the total homocysteine electrochemical detection method based on metallothrein, metallothrein protein is prepared by preparing metallothrein combining metal ions, and electrochemical analysis technology is used to detect the electrochemical signal of metal ions, and a standard curve of Hcy concentration and metal ion electrochemical response signal is produced to achieve fast and accurate detection.
This method is cheap, has a short detection time and high sensitivity, and does not require large-scale testing equipment. It is expected to achieve small-scale intelligence and fast and simple detection on the bedside, and is adaptable to samples from different sources.
Smart Images

Figure CN119881038B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of electrochemical detection, and in particular to a total homocysteine electrochemical detection method based on metallothionein. Background Art
[0002] Elevated levels of homocysteine (Hcy) in the blood (>12-15 μmol / L) are associated with an increased risk of myocardial infarction, stroke, and venous thromboembolism. Hcy is also associated with Alzheimer's disease, neural tube defects, pregnancy complications, inflammatory bowel disease, and osteoporosis.
[0003] Only a small amount of homocysteine (about 1-2%) exists in plasma or serum as free homocysteine (reduced form). Most homocysteine is bound to proteins, dimerized (homocysteine) via disulfide bonds, or forms mixed disulfides with cysteine. In the reported method, various forms of homocysteine are reduced and converted to free homocysteine during sample preparation.
[0004] Commonly used clinical methods for detecting homocysteine:
[0005] (1) Cyclic enzyme method
[0006] Under the action of tri(2-carboxyethyl)phosphine hydrochloride (TCEP), oxidized Hcy is converted into free Hcy, which reacts with the covalent substrate S-adenosylmethionine to generate methionine and S-adenosyl Hcy (SAH). SAH is hydrolyzed into adenosine and Hcy by SAH hydrolase. Hcy amplifies the signal through a cyclic reaction and produces adenosine at the same time. Adenosine is immediately hydrolyzed into ammonia and hypoxanthine. Ammonia converts NADH into NAD under the action of glutamate dehydrogenase. + The Hcy content in the sample is proportional to the NADH conversion rate. The cyclic enzyme method can be analyzed by an automatic biochemical analyzer, which has the advantages of being fast, accurate, and convenient, but it requires the preparation of S-adenosyl homocysteine methyltransferase, S-adenosyl homocysteine hydrolase, adenosine deaminase, and glutamate dehydrogenase, and the addition of β-nicotinamide adenine dinucleotide reduced NADH, which has complex components and high reagent costs.
[0007] (2) Fluorescence polarization immunoassay (FPIA):
[0008] The fluorescence polarization intensities of free Hcy in the sample and Hcy bound to anti-monoclonal antibodies are different. The sample, standard substance and standard antibody are competitively bound, and a standard curve of Hcy concentration and fluorescence polarization intensity is prepared using the principle of competitive binding. The concentration of Hcy can be found on the standard curve, which is a better method for clinical determination of Hcy levels. This method is fully automated instrument analysis, with the advantages of rapidity, accuracy and convenience, but requires specialized instruments, and the preparation of monoclonal or polyclonal antibodies, and the reagents are expensive.
[0009] (3) Enzyme-linked immunosorbent assay (ELISA):
[0010] First, use enzymes to convert all forms of Hcy in the blood sample into S-adenosine-L-Hcy, then add enzyme-labeled anti-S-adenosine-L-Hcy monoclonal or polyclonal antibodies, and use the principle of competitive binding to allow different levels of standard products to compete with enzyme-labeled antibodies for binding, and then use color developing reagents and stop reagents to develop and stop, respectively, to produce a standard curve of Hcy concentration and color intensity. The sample is also processed in the same steps, and its Hcy concentration can be found on the standard curve. It is a common method for clinical determination of Hcy levels. Its characteristics are relatively convenient and fast operation, good repeatability, stable and reliable method, and its disadvantages are that it needs to prepare monoclonal or polyclonal antibodies, and most of the operations are manual, which is time-consuming. Summary of the invention
[0011] The purpose of the present invention is to propose a method for electrochemical detection of total homocysteine based on metallothionein in view of the above-mentioned deficiencies in the prior art, which has the advantages of lower cost, short detection time and high sensitivity, does not require large-scale detection equipment, and is expected to achieve small-scale intelligent and rapid and simple bedside detection.
[0012] The present invention provides a method for electrochemical detection of total homocysteine based on metallothionein, comprising the following steps:
[0013] S1. preparing metallothionein bound to metal ions;
[0014] S2. Add a certain concentration of metallothionein bound to metal ions to the assay buffer, and then sequentially add free Hcy standard solutions with different concentration gradients, use a three-electrode system and electrochemical analysis technology to detect the electrochemical signal of metal ions, and prepare a standard curve of Hcy concentration and metal ion electrochemical response signal;
[0015] S3, reacting the sample to be tested with a sample treatment solution containing a disulfide bond reducing agent, precipitating the protein in the sample with an organic reagent, and centrifuging to obtain a supernatant to obtain a treated sample solution;
[0016] A certain concentration of metallothionein bound to metal ions is added to the assay buffer, and then the treated sample solution is added. The electrochemical signal of the metal ions is detected using a three-electrode system and electrochemical analysis technology. The total homocysteine content in the sample to be tested is obtained based on the standard curve obtained by S2.
[0017] Furthermore, the specific steps of step S1 are as follows: preparing metallothionein by using protein heterologous expression technology and protein purification technology, incubating the metallothionein solution with a disulfide bond reducing agent solution to reduce the cysteine of the metallothionein, adding metal ions to incubate for a certain period of time, and then dialyzing or ultrafiltration to remove unbound metal ions.
[0018] Furthermore, in step S1, during the incubation reaction between the metallothionein solution and the disulfide bond reducing agent solution, the molar ratio of the metallothionein to the disulfide bond reducing agent is 1:10-50.
[0019] Furthermore, in S1, the temperature for incubating the metallothionein solution and the disulfide bond reducing agent solution is 4°C to 37°C, and the time is 20 min to 60 min.
[0020] Furthermore, in the incubation reaction of the metallothionein solution and the metal ions in S1, the molar ratio of the metallothionein to the metal ions is 1:5-20.
[0021] Furthermore, the temperature for incubating the metallothionein solution with the metal ions in S1 is 4° C. to 37° C., and the incubation time is 20 min to 60 min.
[0022] Furthermore, metal ions include Zn 2+ , Cu 2+ , Pb 2+ 、Cd 2+ , Hg 2+ , Mn 2+ 、Co 2+ 、Mo 2+ and Fe 2+ .
[0023] Furthermore, in step S2 and step S3, the final concentration of metallothionein bound to metal ions added to the assay buffer is 1 μM to 10 μM.
[0024] Furthermore, in step S3, the sample treatment solution containing a disulfide bond reducing agent is added to a final concentration of 0.3 mM to 1.0 mM.
[0025] Furthermore, in step S3, the organic reagent is one or more of ethyl acetate, methanol, acetonitrile, chloroform, and acetone.
[0026] Furthermore, in step S3, the volume ratio of the organic reagent for precipitating sample protein to the sample is 1:1-5.
[0027] Furthermore, the disulfide bond reducing agent is selected from one or more of dithiothreitol (DTT), tris(2-carboxyethyl)phosphine hydrochloride (TCEP), and β-mercaptoethanol (β-ME).
[0028] Furthermore, the electrodes in the three-electrode system include the types of electrodes commonly used in the art for making electrochemical sensors, such as glassy carbon electrodes, gold electrodes, screen-printed electrodes, laser-induced graphene (LIG) electrodes, conductive paper-based electrodes, graphite electrodes, ITO electrodes or FTO electrodes.
[0029] Furthermore, electrochemical analysis techniques include commonly used analysis and detection techniques in the art, such as conductivity, resistance, potential, current and potentiometry.
[0030] The detection method disclosed in the present invention is adaptable to samples from different sources, and the samples to be tested can come from urine, tissue fluid, blood, blood serum or blood plasma, etc.
[0031] Metallothionein (MT) is a low molecular weight metal ion binding protein with a high affinity for a variety of heavy metals. It is a protein with low molecular weight, extremely high cysteine residues and metal content. The metals bound to it are mainly cadmium, copper and zinc. It is widely present in various organisms from microorganisms to humans, and its structure is highly conserved. Cysteine residues account for 35% of the amino acids in metallothionein (MT). L-homocysteine specifically targets metallothionein and binds to the cysteine residues of metallothionein, causing metallothionein to lose its metal ion binding function and release metal ions.
[0032] The present invention first prepares metallothionein bound to metal ions (metallothionein includes metallothionein of all species), and based on homocysteine specifically targeting the cysteine residue of metallothionein, the metallothionein bound to metal ions releases the metal ions, that is, free Hcy reacts with the metallothionein bound to metal ions, and the metal ions are released into the solution. Then, the electrochemical response signal of the metal ions is detected by electrochemical analysis technology, and the Hcy content is proportional to the electrochemical response signal of the metal ions. A standard curve of the Hcy concentration and the electrochemical response signal of the metal ions is prepared, and the above operation is repeated for the sample to be tested to obtain the electrochemical response signal, and then the concentration of Hcy in the sample is calculated according to the standard curve.
[0033] The present invention only needs to prepare metallothionein, which has a small molecular weight, stable structure, easy preparation and low cost. At the same time, the electrochemical analysis technology detects the metal ion concentration, has the advantages of short detection time and high sensitivity, and realizes the rapid, accurate, highly sensitive, simple and inexpensive detection of total homocysteine in clinical samples, without the need for large-scale detection equipment, and is expected to realize small-scale intelligent and rapid and simple bedside detection.
[0034] The present invention is compared with the enzyme cycle method currently used in clinical practice. The correlation coefficient R of the actual test samples of 20 patients with homocysteine levels ranging from 5.6 μmol / L to 40.6 μmol / L is 2 It is 0.988, which proves that the detection method has good practical application ability.
[0035] The invention overcomes the problem that the enzyme cycle method needs to prepare S-adenosine homocysteine methyltransferase, S-adenosine homocysteine hydrolase, adenosine deaminase and glutamate dehydrogenase, and needs to add β-nicotinamide adenine dinucleotide reduced NADH. The reagent components used in the enzyme cycle method are complex and the reagent cost is high. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 :SDS-PAGE analysis of MT-induced expression and purification of metallothionein;
[0037] Figure 2 :Preparation of laser-induced graphene LIG three-electrode system;
[0038] Figure 3A :Detection of Zn release from metallothionein by anodic stripping differential pulse voltammetry (AS-DPV) using different concentrations of standard Hcy 2+ The oxidation current
[0039] Figure 3B : Figure 3A The figure is obtained by performing baseline subtraction on the data;
[0040] Figure 3C :Metal ion Zn 2+ The relationship between the oxidation peak current and Hcy;
[0041] Figure 4 :Precipitate proteins in serum samples with different reagents and release Zn 2+ The oxidation peak current value at −1.2 V;
[0042] Figure 5 : The Zn released by TCEP precipitation of serum proteins 2+ The oxidation peak current value at −1.2 V;
[0043] Figure 6 :Detection of Zn release from Hcy-targeted metallothionein in serum samples by anodic stripping differential pulse voltammetry (AS-DPV) 2+ Oxidation current of: a. 10 mmol / L pH 7.5 Tris-HCl buffer; b. 10 mmol / L pH 7.5 Tris-HCl buffer + serum treatment solution; c. 10 mmol / L pH 7.5 Tris-HCl buffer + serum treatment solution + 3 μmol / L bound Zn 2+ Metallothionein MT;
[0044] Figure 7 :The interference of adding 0.5 mmol / L interfering substances dithiothreitol DTT, cysteine CYS, glutathione GSH and methionine Met on the detection of homocysteine Hcy content in serum samples;
[0045] Figure 8 : For 20 patient serum samples with homocysteine levels ranging from 5.6 to 40.6 μmol / L, the relationship between the homocysteine content detected by the method of the present invention and the homocysteine content detected by the alternative method (enzyme cycling method) is shown. DETAILED DESCRIPTION
[0046] The following are specific embodiments of the present invention and the accompanying drawings to further describe the technical solution of the present invention, but the present invention is not limited to these embodiments.
[0047] The combined metal ion Zn of the present invention 2+ Preparation of Metallothioneins
[0048] The Arabidopsis thaliana metallothionein AtMT4b gene was obtained through gene synthesis by the company. AtMT4 b gene fragment enzyme was ligated into the vector pET32a (+) to construct the prokaryotic expression plasmid pET32a- MT . The positive transformant pET32a- MT The transformed Escherichia coli BL21 (DE3) was inoculated with a single colony in LB liquid medium containing 100 μg / mL ampicillin and cultured at 37°C for 8 h.
[0049] The culture solution was transferred to LB medium at a volume ratio of 1:100, and cultured at 37℃ for about 2 h until OD600 reached 0.6. 0.5 mmol / L isopropyl β-D-thiogalactoside (IPTG) was added, and expression was induced at 150 rpm and 28℃ for 12 h. The bacteria were collected by centrifugation at 3200 × g for 15 min, and lysozyme, TCEP and Tris-HCl buffer were added to resuspend the bacteria. Incubate on ice for 30 min to melt the bacterial cell wall, ultrasonically disrupt in an ultrasonic ice water bath for 6 min, centrifuge at 10000 × g for 20 min, collect the supernatant of the disrupted liquid, filter with a 0.45 μm filter membrane, and purify on a nickel column. The column was washed with different concentrations of imidazole for purification, and the salt ions in the protein were removed by dialysis. The protein concentration was quantified by the BCA method.
[0050] The dialyzed protein was incubated with an equal volume of 25 mmol / L DTT at 37°C for 30 min, and then 10 times the molar number of metallothionein was added to the metal ion Zn 2+ Incubate at room temperature for 30 minutes. Dialyze against 10 mmol / L Tris-HCl, pH 8.0, at 4°C for eight hours, changing the dialysate every two hours to remove unbound metal ions.
[0051] Figure 1 SDS-PAGE analysis of MT-induced expression and purification of metallothionein;
[0052] Wherein, M: Marker; 1-6: pET32a empty load transformed E. coli samples: 1. Mix; 2: supernatant; 3: precipitate; 4: column effluent; 5: 40 mM imidazole elution collection solution; 6: concentrated protein TRX; 7-12: pET32a-MT transformed E. coli samples: 7. Mix; 8: supernatant; 9: precipitate; 10: column effluent; 11: 40 mM imidazole elution collection solution; 12: concentrated protein TRX-MT;
[0053] like Figure 1 Shown: The MT protein fused with the thioredoxin TRX tag has a size of 27 KD.
[0054] Wherein, the gene sequence of the metallothionein AtMT4b is:
[0055] ATGGCTGACACCGGTAAAGGTTCTGCTTCTGCTTCTTGCAACGACCGTTGCGGTTGCCCGTCTCCGTGCCCGGGTGGTGAATCTTGCCGTTGCAAAATGATGTCTGAAGCTAGTGGTGGTGACCAGGAA CACAACACCTGCCCGTGCGGTGAACACTGCGGTTGCAACCCGTGCAACTGCCCGAAAACCCAGACCCAGACCTCTGCTAAAGGTTGCACCTGCGGTGAAGGTTGCACCTGCGCTACCTGCGCTGCTTAA.
[0056] Here, the metallothionein binding to metal ions includes metallothionein of all species. The preparation of metallothionein is already a prior art, and the present invention only provides an implementable method.
[0057] Preparation of laser-induced graphene LIG electrodes
[0058] Polyimide (PI) tape (thickness 0.055 mm) was washed with acetone, ethanol and ultrapure water in turn, and attached to a polyethylene terephthalate (PET, thickness 0.2 mm) sheet, which was fixed to a high-temperature resistant marble plate. Electrodes were printed at 80% power (12 W), 35% speed (36 mm / s) and 24.5 mm focus height. After printing, the electrodes were sealed with screen printing ink and placed in a 60 °C oven. After 40 min of complete drying, silver chloride paste was applied to the corresponding position of the reference electrode, placed in a 60 °C oven, and cut after 30 min for use ( Figure 2 The three electrodes were activated by differential pulse voltammetry (DPV) scanning in a pH 7.5 10 mM Tris-HCl solution. After activation, the electrodes were stored at room temperature within 24 hours for future use.
[0059] Determination of Hcy standard curve
[0060] Prepare LIG electrode, total system: 120 μL combined with metal ion Zn 2+Metallothionein (final concentration 3 μM), sample treatment solution (80 μL acetonitrile, 12.5 μL 3 mmol / L TCEP, 0.8 μL 0.4 mol / L sodium hydroxide solution). 50 μL, 40 μL, 25 μL, 16.7 μL, 12.5 μL, 10 μL of Hcy stock solution with concentrations of 4 μmol / L, 20 μmol / L, 40 μmol / L, 60 μmol / L, 80 μmol / L, and 100 μmol / L were added to the detection cell in sequence, and the rest was filled up to 2 mL with Tris-HCl, enriched at a potential of -1.5 V for 120 S, and after resting for 10 S, the anodic stripping differential pulse voltammetry (AS-DPV) method was used for detection in the voltage range of -1.8 V to 0 V ( Figure 3A ),Will Figure 3A The data was subjected to baseline subtraction to obtain Figure 3B , the metal ion Zn was determined three times in parallel. 2+ The relationship between the oxidation peak current and Hcy ( Figure 3C ), we get the linear relationship: y = 0.009 x + 0.29 R 2 = 0.98, linear range 5 μM - 60 μM, and calculated minimum detection limit LOD = 3.3 μmol / L.
[0061] Since the protein impurities in the sample cause electrode passivation, the present invention provides a method for removing protein from the sample. Ethyl acetate, methanol, acetonitrile, chloroform, and acetone are used as protein precipitation reagents in the sample, and the best precipitation reagent is optimized. The steps are as follows: 50 μL of sample is dispensed into a sterilized 1.5 mL centrifuge tube, 12.5 μL of 3 mmol / L TCEP and 80 μL of precipitation reagent are added to the sample, centrifuged at 12000 × g for 10 min, the supernatant is taken, and 0.8 μL of 0.4 M sodium hydroxide solution is added to neutralize the pH value to 7.5. The prepared electrode is inserted into a detection cell containing 1.9 mL 10 mmol / L Tris-HCl. In the first step, DPV scanning is performed in the voltage range of -1.8 V to 0 V. In the second step, 100 μL of sample supernatant treatment solution is added to the detection cell, enriched at a potential of -1.5 V for 120 S, and after 10 S of rest, the DPV method is used to scan in the voltage range of -1.8 V to 0 V. In the third step, the metal ion Zn was added to the detection pool at a final concentration of 3 μM. 2+The metallothionein was enriched at -1.5 V for 120 s. After 10 s of rest, the metallothionein was detected by anodic stripping differential pulse voltammetry (AS-DPV) in the voltage range of -1.8 V to 0 V. Each precipitation reagent was measured in parallel three times to obtain the metal ion Zn released from the sample with each precipitation reagent. 2+ Oxidation peak current bar graph ( Figure 4 ). The optimization results showed that acetonitrile was the best precipitation reagent.
[0062] Optimization of protein concentration in TCEP precipitation samples
[0063] The sample contains oxidized homocysteine and free homocysteine. We used different concentrations of TCEP to reduce the oxidized homocysteine in the sample to free homocysteine. Take 50 μL of sample and place it in 5 sterilized centrifuge tubes, add 2.5 μL, 5 μL, 10 μL, 12.5 μL, and 15 μL of 3 mmol / L TCEP sample treatment solution, respectively. After standing at room temperature for 5 minutes, add 80 μL of acetonitrile to precipitate the protein in the sample. After centrifugation at 12000 × g for 10 minutes, take 100 μL of supernatant for detection. Total system: 120 μL combined with metal ion Zn 2+ The total volume was 2 mL with 10 mmol / L Tris-HCl (pH 7.5) and 100 μL of the treated sample supernatant. Anodic stripping differential pulse voltammetry (AS-DPV) was used to detect the metal ion Zn. 2+ The oxidation current was measured three times in parallel to obtain the metal ion Zn released in the sample at each TCEP concentration. 2+ Oxidation peak current bar graph ( Figure 5 ). The optimization results showed that the optimal TCEP concentration was 0.625 mmol / L.
[0064] Sample measurement steps
[0065] Prepare the LIG electrode and perform cyclic voltammetry (CV) scans in the voltage range of -1.8 V to 0 V in a 10 mM Tris-HCl solution at pH 7.5 for ten cycles to activate the electrode. Aliquot 50 μL of the sample into a sterilized 1.5 mL centrifuge tube, add 12.5 μL of 3 mmol / L TCEP and 80 μL of acetonitrile to the sample, centrifuge at 12000 × g for 10 min, take the supernatant, and add 0.8 μL of 0.4 M sodium hydroxide solution to neutralize the pH to 7.5. Insert the prepared electrode into the detection cell containing 1.9 mL of 10 mmol / L Tris-HCl. In the first step, perform a DPV scan in the voltage range of -1.8 V to 0 V ( Figure 6In the second step, 100 μL of sample treatment solution was added to the detection cell, and the sample was enriched at a potential of -1.5 V for 120 s. After 10 s of rest, the DPV method was used to scan the sample in the voltage range of -1.8 V to 0 V ( Figure 6 b). In the third step, a final concentration of 3 μmol / L of Zn bound to the metal ion was added to the detection cell. 2+ The metallothionein was enriched at -1.5 V for 120 s. After 10 s of rest, the metal ion Zn was detected by anodic stripping differential pulse voltammetry (AS-DPV) in the voltage range of -1.8 V to 0 V. 2+ The oxidation current ( Figure 6 c), the determination was performed three times in parallel, and the total homocysteine content in the sample to be tested was obtained based on the obtained Hcy standard curve.
[0066] Determination of interfering substances
[0067] Dithiothreitol DTT, cysteine Cys and glutathione GSH present in the sample contain sulfhydryl groups, and methionine Met has a similar structure to homocysteine Hcy. Dithiothreitol, cysteine, glutathione and methionine were selected as interfering substances to investigate the selectivity of the method of the present invention. The determination steps are as follows: 50 μL of the serum sample to be determined for Hcy concentration is divided into five tubes, numbered 1-5, no interfering substances are added to tube 1, and 0.5 mmol / L dithiothreitol DTT, glutathione GSH, methionine Met and cysteine CYS are added to the samples in tubes 2-5, respectively, and then 3 mmol / L TCEP 12.5 μL and 80 μL acetonitrile are added to tubes 1-5, respectively, and centrifuged at 12000 × g for 10 min, the supernatant is taken, and 0.8 μL 0.4 M sodium hydroxide solution is added. First, the Hcy content of tube 1 was measured, and then the Hcy content of tubes 2-5 was measured in sequence. The Hcy content values of tubes 2-5 were compared with the Hcy content value of tube 1. The determination was repeated three times in parallel to investigate the specificity of the method of the present invention in detecting homocysteine. Figure 7 The calculation formula of cross-reaction percentage is as follows: [Hcy (sample with added interference - sample without added interference) / Hcy (sample without added interference)] × 100 = cross-reaction%, the cross-reaction percentages of DTT, Cys, GSH and Met were 0.27%, 0%, 7.03% and 5.97% respectively, all less than 10%, indicating that the method of the present invention has excellent specificity in detecting homocysteine.
[0068] Dilution recovery determination steps
[0069] Serum samples containing 32.4 μM Hcy were diluted 1, 2, and 4 times, and 50 μL of the diluted samples were dispensed into sterilized centrifuge tubes. 12.5 μL of 3 mmol / L TCEP and 80 μL of acetonitrile were added to each tube in turn. After centrifugation at 12000× g for 10 min, the supernatant was taken and 0.8 μL of 0.4 M sodium hydroxide solution was added. The prepared electrode was inserted into a detection cell containing 1.9 mL of 10 mM Tris-HCl for anodic stripping differential pulse voltammetry (AS-DPV) detection. In the first step, DPV was scanned with an initial voltage of -1.8 V - 0 V. In the second step, 100 μL of the treated sample was added to the detection cell, enriched at a potential of -1.5 V for 120 S, and after 10 S of rest, the AS-DPV method was used for detection in the voltage range of -1.8 V - 0 V. In the third step, a final concentration of 3 μmol / L of Zn bound to the metal ion was added to the detection pool. 2+ The metallothionein was enriched at a potential of -1.5 V for 120 S. After resting for 10 S, the sample was detected by AS-DPV method in the voltage range of -1.8 V to 0 V. The determination was carried out in parallel three times. The content of total homocysteine in the sample to be tested was obtained according to the obtained Hcy standard curve. The dilution recovery rate was calculated. As shown in Table 1, the recovery rate ranged from 91% to 102%, and the average recovery rate was 98%, indicating that the determination accuracy of the method of the present invention was high.
[0070] Steps for determining spike recovery
[0071] Serum samples containing Hcy concentration of 11.3 μM were added with standard Hcy with final concentrations of 6.7 μM, 21.7 μM, 32 μM and 45 μM, respectively, and 50 μL of diluted samples were dispensed into sterilized centrifuge tubes. 3 mmol / LTCEP 12.5 μL and 80 μL of acetonitrile were added to each tube in turn. After centrifugation at 12000 × g for 10 min, the supernatant was taken and 0.8 μL of 0.4 M sodium hydroxide solution was added. The prepared electrode was inserted into the detection cell containing 1.9 mL of 10 mM Tris-HCl for anodic stripping differential pulse voltammetry (AS-DPV) detection. In the first step, DPV was scanned with an initial voltage of -1.8 V - 0 V. In the second step, 100 μL of the treated sample was added to the detection cell, enriched at a potential of -1.5 V for 120 S, and after 10 S of rest, the AS-DPV method was used for detection in the voltage range of -1.8 V - 0V. In the third step, a final concentration of 3 μmol / L of Zn bound to the metal ion was added to the detection pool. 2+The metallothionein was enriched at a potential of -1.5 V for 120 S. After resting for 10 S, the sample was detected by AS-DPV method in the voltage range of -1.8 V to 0 V. The determination was carried out in parallel three times. The content of total homocysteine in the sample to be tested was obtained according to the obtained Hcy standard curve. The spiked recovery was calculated. As shown in Table 2, the recovery range was between 95.1% and 103.9%, and the average recovery was 98.9%, indicating that the determination method of the present invention has high accuracy.
[0072] Determination of precision
[0073] Precision is determined by the coefficient of variation CV [CV(%) = SD / Average ×100]. SD is the standard deviation between different tests of a sample. Precision increases as CV decreases. The precision of the method for detecting Hcy was evaluated based on the intra-assay variation and inter-assay variation. Three serum samples containing low (6.6 μmol / L), medium (16.5 μmol / L) and high (28.2 μmol / L) Hcy contents were measured 10 times in parallel on the same day, and the intra-assay variation was determined based on the results of 10 parallel analyses of the three samples; within 10 days, three serum samples containing low (6.6 μmol / L), medium (16.5 μmol / L) and high (28.2 μmol / L) Hcy contents were measured once a day, and the inter-assay variation was determined based on the analysis results of the three samples for 10 days. As shown in Table 3, the coefficients of variation between and within the three samples were less than 15%, indicating that the precision of the homocysteine detection method of the present invention meets clinical requirements.
[0074] Methodological comparison
[0075] For 20 patient serum samples with homocysteine levels ranging from 5.6 to 40.6 μmol / L, the homocysteine content detected by the method of the present invention and the homocysteine content detected by the alternative method (enzyme cycle method) are shown in Table 4. The relationship between the homocysteine content detected by the method of the present invention and the homocysteine content detected by the alternative method (enzyme cycle method) is shown in Table 4. Figure 8 is shown and described by the following equation:
[0076] Homocysteine determination by the method of the present invention = -0.81 (alternative method) + 1.03 μmol / L, correlation coefficient (R 2 ) = 0.988.
[0077] Table 1. Dilution recovery test results
[0078]
[0079] Table 2. Results of spike recovery determination
[0080]
[0081] Table 3. Precision determination results
[0082]
[0083] Table 4. Methodological comparison results
[0084]
[0085] For matters not mentioned above, the prior art applies.
[0086] Although some specific embodiments of the present invention have been described in detail through examples, those skilled in the art should understand that the above examples are for illustration only and are not intended to limit the scope of the present invention. Those skilled in the art to which the present invention belongs may make various modifications or supplements to the specific embodiments described or replace them in a similar manner, but they will not deviate from the direction of the present invention or exceed the scope defined by the attached claims. Those skilled in the art should understand that any modifications, equivalent substitutions, improvements, etc. made to the above embodiments based on the technical essence of the present invention should be included in the protection scope of the present invention.
Claims
1. A method for electrochemical detection of total homocysteine based on metallothionein, characterized in that: The steps include: S1. preparing metallothionein bound to metal ions; S2. Add a certain concentration of metallothionein bound to metal ions to the assay buffer, and then sequentially add free Hcy standard solutions with different concentration gradients, use a three-electrode system and electrochemical analysis technology to detect the electrochemical signal of metal ions, and prepare a standard curve of Hcy concentration and metal ion electrochemical response signal; S3, reacting the sample to be tested with a sample treatment solution containing a disulfide bond reducing agent, precipitating the protein in the sample with an organic reagent, and centrifuging to obtain a supernatant to obtain a treated sample solution; A certain concentration of metallothionein bound to metal ions is added to the assay buffer, and then the treated sample solution is added. The electrochemical signal of the metal ions is detected using a three-electrode system and electrochemical analysis technology. The total homocysteine content in the sample to be tested is obtained based on the standard curve obtained by S2.
2. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 1, characterized in that: The specific steps of step S1 are as follows: metallothionein is prepared by using protein heterologous expression technology and protein purification technology, the metallothionein solution is incubated with a disulfide bond reducing agent solution to reduce the cysteine of the metallothionein, metal ions are added to incubate for a certain period of time, and then dialyzed or ultrafiltered to remove unbound metal ions.
3. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 2, characterized in that: In step S1, during the incubation reaction between the metallothionein solution and the disulfide bond reducing agent solution, the molar ratio of the metallothionein to the disulfide bond reducing agent is 1:10-50.
4. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 2, characterized in that: In the S1, the temperature of the incubation reaction of the metallothionein solution and the disulfide bond reducing agent solution is 4°C to 37°C, and the time is 20 min to 60 min.
5. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 2, characterized in that: In S1, in the incubation reaction between the metallothionein solution and the metal ions, the molar ratio of the metallothionein to the metal ions is 1:5 to 20.
6. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 2, characterized in that: In the S1, the temperature for incubating the metallothionein solution with the metal ions is 4° C. to 37° C., and the incubation time is 20 min to 60 min.
7. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 1, characterized in that: Metal ions include Zn 2+ , Cu 2+ , Pb 2+ 、Cd 2+ , Hg 2+ , Mn 2+ 、Co 2+ 、Mo 2+ and Fe 2+ .
8. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 1, characterized in that: In step S2 and step S3, the metal ion-bound metallothionein is added to the assay buffer to a final concentration of 1 μM to 10 μM.
9. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 1, characterized in that: In step S3, the sample treatment solution containing a disulfide bond reducing agent is added to a final concentration of 0.3 mM to 1.0 mM; In step S3, the organic reagent is one or more of ethyl acetate, methanol, acetonitrile, chloroform, and acetone; In step S3, the volume ratio of the organic reagent for precipitating sample protein to the sample is 1:1-5.
10. The method for electrochemical detection of total homocysteine based on metallothionein according to claim 1, characterized in that: The disulfide bond reducing agent is selected from one or more of dithiothreitol, tris(2-carboxyethyl)phosphine hydrochloride, and β-mercaptoethanol.
Citation Information
Patent Citations
Modified metallothioneins and methods for screening and treatment of diseases associated with oxidative stress
CN101454336A
Metallothionein transgenic yeast construction and heavy metal adsorbing material preparation method by utilizing metallothionein transgenic yeast
CN103205454A