Particles comprising double-stained RNA and their

Abstract

The present invention relates to antifungal compositions comprising a plurality of particles comprising: at least one dsRNA molecule comprising a nucleic acid sequence complementary to at least one transcript of at least one essential gene of a fungus, and methods of use thereof.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 353,662, filed on June 20, 2022, entitled “POSTHARVEST APPLICATION OF DSRNA INLAYERED DOUBLE HYDROXIDE (LDH)”, the contents of which are incorporated herein by reference in their entirety. Electronic Sequence Listing Reference

[0002] The contents of the electronic sequence listing (YEDA-VOL-P-028-PCT ST26.xml; size: 32,692 bytes; and creation date: June 11, 2023) are incorporated herein by reference in its entirety. Technical Field

[0003] The present invention is in the field of agricultural compositions and particularly relates to formulations for delivering antifungal active agents such as gene silencing polynucleotides. Background Art

[0004] The long journey of fruits and vegetables from field to plate results in high cumulative losses at every step of the agricultural product supply chain. Fungal pathogens are one of the main causes of postharvest diseases and fruit and vegetable losses. Most fruit contamination occurs in the field, but these latent fungal infections remain dormant until ripening. Fruit becomes more susceptible to fungal pathogens during ripening due to the accompanying softening of cell walls and a decrease in natural defenses. The latent fungal pathogens then switch to an aggressive necrotrophic stage, at which point postharvest disease symptoms appear.

[0005] Currently, fungicides are considered the most common and effective means to control the development of fungal pathogens and decay. However, fungicides have inherent disadvantages. The main hazards are environmental and human health due to non-specificity and the risk of developing resistance fungi. Therefore, there is a global need to find safer, environmentally friendly and cost-effective alternatives to control the development of fungal pathogens and postharvest diseases.

[0006] The RNA interference (RNAi) system is a natural post-transcriptional gene silencing process in eukaryotic cells. RNAi is based on the recognition of double-stranded RNA (dsRNA) molecules, which leads to the degradation of the target messenger RNA (mRNA). Since small dsRNA molecules can be transferred from host plant cells to fungal cells and vice versa, new possibilities for controlling fungal pathogens have emerged. Two emerging technologies take advantage of the RNAi system. One approach employs transgenic plants in which host-initiated gene silencing exists. This route is constrained by regulatory restrictions on transgenic plants. In addition, it is hampered by the need to adjust the transgene to the changing environment of potential pathogens. Another approach is spray-induced gene silencing (SIGS), in which dsRNA is applied externally to plant parts such as leaves, branches or fruits. However, the SIGS approach is disadvantaged by its relatively expensive production cost and the inherent instability of dsRNA. In fact, the relatively short environmental lifetime poses a major challenge to the development of commercial topical dsRNA products.

[0007] The availability and effectiveness of dsRNA depends on environmental factors such as UV radiation, humidity and biodegradation (RNase enzymes and microbial degradation). To improve the stability of dsRNA, it is necessary to develop a delivery formulation that will protect the dsRNA but allow it to be slowly released and absorbed by fungi. One solution is to integrate dsRNA into layered double hydroxide (LDH) clay sheets. LDH is an inorganic layered material that occurs naturally as a result of salt precipitation. LDH is considered safe and is used for drug delivery. LDH is characterized by brucite-like compounds that form positively charged layers that allow negatively charged dsRNA to enter between the layers and be protected from washing, RNase degradation and UV exposure. Moisture and atmospheric CO2 slowly decompose the LDH and release the loaded dsRNA. In fact, dsRNA delivery formulations using LDH have been found to be simple and cost-effective to protect plants from viruses.

[0008] Botrytis cinerea is one of the most important and common necrotic fungal pathogens that causes postharvest rot in fresh fruits and vegetables. Botrytis cinerea has a wide host range and can infect more than 200 plant species, causing gray mold. Botrytis cinerea is a pathogenic fungus that can naturally take up dsRNA from the environment. Several studies have demonstrated how direct application of dsRNA can provide short-term control of the pathogenic fungus Botrytis cinerea. These studies used SIGS to target Botrytis cinerea virulence genes and were able to reduce rot development. Therefore, the ability to control Botrytis cinerea and gray mold is a major goal in the development of new postharvest treatments.

[0009] Although incorporation effectively limits viral and insect transmission, little is known about its involvement in plant-fungal pathogen interactions.

[0010] There remains a great need for new technological methods to deliver polynucleotides (eg, gene silencing polynucleotides) in an agriculturally acceptable form to treat or prevent fungal infections. Summary of the invention

[0011] The present invention, in some embodiments, is based at least in part on the discovery that direct dsRNA targeting of three essential genes in the ergosterol biosynthetic pathway can provide protection against Botrytis cinerea.

[0012] The present invention, in some embodiments, is further based, at least in part, on the discovery that incorporation of dsRNA into layered double hydroxides (LDHs) negatively impacts fungal growth and decay development during long-term storage and greatly enhances the protective and therapeutic efficacy of the dsRNA.

[0013] According to a first aspect, a method for treating or preventing a fungal infection in a plant or part thereof in need thereof is provided, the method comprising applying to at least a part of the plant an effective amount of at least one double-stranded RNA (dsRNA) molecule comprising a nucleic acid sequence complementary to at least two transcripts transcribed from at least two essential genes of a fungus that causes the fungal infection, thereby treating or preventing the fungal infection in the plant or part thereof.

[0014] According to another aspect, a method for treating or preventing a fungal infection in a plant or part thereof in need thereof is provided, the method comprising applying to at least a portion of the plant an effective amount of particles comprising: (i) at least one dsRNA molecule comprising a nucleic acid sequence complementary to at least two transcripts transcribed from at least two essential genes of a fungus that causes the fungal infection; and (ii) a layered double hydroxide (LDH), thereby treating or preventing the fungal infection in the plant or part thereof.

[0015] According to another aspect, an antifungal composition is provided, comprising a plurality of particles, the plurality of particles comprising: (a) at least one dsRNA molecule comprising a nucleic acid sequence complementary to at least one transcript of at least one essential gene of the fungus; and (b) LDH.

[0016] In some embodiments, the particle comprises the at least one dsRNA molecule and the LDH in a mole / mole (m:m) ratio of 1:20 to 1:80.

[0017] In some embodiments, the at least two essential genes are of the same pathway.

[0018] In some embodiments, the pathway is an ergosterol production pathway.

[0019] In some embodiments, the at least two essential genes are selected from: 3-hydroxy-3-methylglutaryl-CoA synthase (erg13), sterol 14-demethylase (CYP51) and squalene monooxygenase (erg1).

[0020] In some embodiments, the at least two essential genes include all three of egr13, CYP51, and erg1.

[0021] In some embodiments, the at least one dsRNA molecule is 500 base pairs (bp) to 1,000 bp in length.

[0022] In some embodiments, the at least one dsRNA molecule comprises a first RNA sequence derived from erg13, followed by a second RNA sequence derived from CYP51, followed by a third RNA sequence derived from erg1.

[0023] In some embodiments, the length of any one of the first RNA sequence, the second RNA sequence, and the third RNA sequence is between 20 bp and 400 bp.

[0024] In some embodiments, the first RNA sequence, the second RNA sequence, and the third RNA sequence have a complementarity level of 70% to 100% with erg13, CYP51, and erg1, respectively, or with transcripts thereof.

[0025] In some embodiments, the at least one dsRNA molecule comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 4-7.

[0026] In some embodiments, the fungus is selected from the phylum Ascomycota.

[0027] In some embodiments, the fungus belongs to a genus selected from the group consisting of Botrytis, Alternaria, Aspergillus, Blumeria, Cercospora, Colletotrichum, Geotrichum, Fusarium, Lasiodiplodia, Magnaporthe, Monilinia, Mycosphaerella, Penicillium, Phytophthora, Puccinia, Rhizophus, Rhizoctoniat, Sclerotinia, Ustilago, and any combination thereof.

[0028] In some embodiments, the applying is by spraying, dipping, or both.

[0029] In some embodiments, the administering comprises multiple administrations.

[0030] In some embodiments, the multiple administrations are separated by 1 week to 4 weeks.

[0031] In some embodiments, the method further comprises co-applying a fungicide to the at least a portion of the plant in an amount that is at least 10% less than an effective amount of the fungicide when applied alone.

[0032] In some embodiments, the at least a portion of the plant includes any one of the following: leaves, fruits, flowers, and any combination thereof.

[0033] In some embodiments, the administering comprises postharvest administration.

[0034] In some embodiments, the method further comprises subjecting the at least a portion of the plant to at least one abiotic condition selected from the group consisting of: CO2 levels of 0.01% to 5%, relative humidity of 80% to 98%, and both.

[0035] In some embodiments, said subjecting is after said administering.

[0036] In some embodiments, the antifungal composition comprises at least one characteristic selected from the group consisting of: (i) an m:m ratio of magnesium to aluminum of 2 to 4; (ii) a zeta potential of 30 mV to 50 mV; and (iii) a particle size of 150 nm to 350 nm.

[0037] In some embodiments, the antifungal composition is characterized by being able to reduce or inhibit at least one fungal activity for a period of 1 to 6 weeks.

[0038] In some embodiments, the at least one essential gene encodes at least one protein involved in an ergosterol production pathway.

[0039] In some embodiments, the at least one essential gene includes three essential genes involved in the ergosterol production pathway.

[0040] In some embodiments, the three essential genes involved in the ergosterol production pathway are erg13, CYP51, and erg1.

[0041] In some embodiments, the antifungal composition is formulated for at least one route of administration selected from the group consisting of spraying and dipping.

[0042] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the invention belongs. Although methods and materials similar to or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In the event of a conflict, the patent specification (including definitions) shall prevail. In addition, materials, methods and examples are merely illustrative and are not intended to be necessarily restrictive.

[0043] Other embodiments and the entire scope of application of the present invention will become apparent from the detailed description given below. However, it should be understood that the detailed description and specific examples, although indicating preferred embodiments of the present invention, are given by way of illustration only, because through this detailed description, various changes and modifications within the spirit and scope of the present invention will become apparent to those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figures 1A-1DIncluded are images of dsRNA-ERG templates and fluorescent micrographs showing penetration of labeled dsRNA into germinating conidia of Botrytis cinerea. (1A) Image of dsRNA-ERG template consisting of three essential genes in the ergosterol pathway: erg13, erg11, and erg1, flanked by a T7 promoter and unique restriction enzyme sites (751 bases total). (1B-1D) Conidia of Botrytis cinerea germinated in the presence of Cy5-labeled dsRNA-Dicer (1C) or Cy5-labeled dsRNA-ERG (1D). Spores germinated on a PDA substrate for 12 h. Germinating conidia were observed under a confocal microscope. (1B) Control germination after 12 h in the absence of dsRNA. (1C-1D) Conidia germinated after 12 h in the presence of fluorescent dsRNA-Dicer or dsRNA-ERG, respectively.

[0045] Figures 2A-2D Included are vertical bar graphs and micrographs showing that dsRNA-ERG reduces germination and hyphal growth in vitro and in vivo. Conidia of Botrytis cinerea were germinated in 0.2% SMB on glass slides. dsRNA-ERG was added to the growth medium at time 0 or after 4 or 8 hours of incubation. After 20 h of incubation, conidial germination was assessed under a microscope. (2A) Percent germination. (2B) Germinal tube length. Data presented are mean values ​​with standard errors. Asterisks indicate statistically significant differences (P<0.05). (2C) Microscopic images of conidia germination of Botrytis cinerea (40x magnification). (2D) Representative images of conidia germination and growth of Botrytis cinerea on grapes treated with water (control; top panel) or dsRNA-ERG (bottom panel).

[0046] Figures 3A-3C Included are photos, graphs, and vertical bar graphs showing that dsRNA-ERG reduces the development of rot caused by Botrytis cinerea. Onion skins (3A), rose petals (3B), and strawberries (3C) were treated with water (control), Bc-DCL1 / 2-dsRNA (dsRNA-Dicer), or Bc-ERG1 / 13 / 11-dsRNA (dsRNA-ERG) after infection with Botrytis cinerea. The rot diameter was measured and the area under the disease progress curve (AUDPC) was calculated for each experiment (7 dpi for onion skins, 6 dpi for rose petals, and 5 dpi for strawberries). The upper figure shows representative photos taken three days after infection (dpi). The data presented are mean values ​​with standard errors. Values ​​followed by different letters are statistically significant (P<0.05).

[0047] Figures 4A-4DIncluded are graphs, vertical bar graphs, and photographs showing that dsRNA-ERG reduces fruit rot caused by Botrytis cinerea. Microlesions were created in the fruit cuticle of bell pepper (4A), cherry (4B), mango (4C), and grape (4D) using hydrocarborundum powder. After being sprayed with Botrytis cinerea, the fruit was sprayed with water (control) or Bc-ERG1 / 13 / 11-dsRNA (dsRNA-ERG). Each experiment measured the rot diameter and calculated the area under the disease progression curve (AUDPC) (10 dpi for bell pepper, 4 dpi for cherry and mango, and 6 dpi for grape). The figure below shows representative photos taken four days after inoculation (dpi). The data presented are mean values ​​with standard errors. The values ​​followed by asterisks indicate statistically significant differences (P<0.05).

[0048] Figures 5A-5H Includes vertical bar graphs and photos showing the effects of the dsRNA-ERG system. After inoculation with Botrytis cinerea at the dsRNA-ERG treatment point and two other points along the horizontal and vertical axes, sweet peppers (5A, 5C and 5E) and tomatoes (5B, 5D and 5F) were treated with water (control) or dsRNA-ERG in the upper left corner of the fruit. Infection occurred on the day of treatment (5A-5B), or 1 day after treatment (5C-5D), or 3 days after treatment (5E-5F). The rotten area was measured and the area under the disease progression curve (AUDPC) was calculated. 5G-5H are representative pictures of sweet peppers and tomatoes (respectively) inoculated one day after treatment. Representative photos were taken at three days (sweet peppers) or six days (tomatoes) after inoculation (dpi). The data presented are mean values ​​with standard errors. The values ​​followed by different letters are statistically significant differences (P<0.05).

[0049] Figures 6A-6C Included are vertical bar graphs showing penetration of dsRNA-ERG into the pulp and downregulation of gene expression. Grapes were treated with water (control) or dsRNA-ERG and then spray-inoculated with Botrytis cinerea. Peel and pulp samples for RNA extraction were collected at 8, 24 and 48 hours after inoculation. (6A) Relative abundance of applied dsRNA-ERG constructs assessed by qPCR and normalized to actin gene in control grapes at 8, 24 and 48 hours after infection. (6B) Relative expression of erg11 gene normalized to Botrytis cinerea actin gene in control grape peel or pulp 8-24 hours and 48 hours after infection. (6C) Relative expression of 3 dsRNA-ERG targeted genes and 2 non-targeted genes in the ergosterol biosynthesis pathway in peel tissue 48 hours after inoculation. Data shown are means with standard errors. Asterisks indicate statistically significant differences (P<0.05).

[0050] Figures 7A-7DIncluded are graphs and photographs showing that dsRNA application reduces the concentration of fungicide required to inhibit the growth of Botrytis cinerea. (7A) Conidia of Botrytis cinerea were grown at room temperature in 1% SMB, or in 1% SMB supplemented with dsRNA-ERG or dsRNA-ERG and ergosterol. OD measurements at 600 nm were taken every hour. (7B) Grapes were treated with water (control), or dsRNA-ERG, or dsRNA-ERG and ergosterol after spray inoculation with Botrytis cinerea. Rot severity was recorded daily. (7C) Representative photographs of grapes treated with water (control), or dsRNA-ERG, or dsRNA-ERG and ergosterol after spray inoculation with Botrytis cinerea were taken four days post infection (dpi). (7D) Conidia of Botrytis cinerea were incubated at room temperature in 1% SMB, or in 1% SMB supplemented with various concentrations of Prochloraz (with or without dsRNA-ERG). OD measurements at 600 nm were taken every hour. Data presented are mean values ​​with standard errors.

[0051] Figures 8A-8D Included are photographs and graphs showing characterization of the colloidal properties of LDH. (8A) The Tyndall effect is seen in a colloidal LDH dispersion when irradiated with a laser beam (λ = 633 nm). (8B) The LDH -1 FT-IR spectrum in the region. (8C) Zeta potential distribution of LDH measured by Doppler velocimetry. (8D) Particle size distribution of LDH measured by dynamic light scattering (DLS).

[0052] Figures 9A-9C Included are photographs showing dsRNA loading and release by LDH. (9A) Determination of dsRNA loading capacity of LDH. M, 100 bp DNA ladder; Lane 1, dsRNA. Lanes 2 to 7, dsRNA–LDH at mass ratios of 1:1, 1:5, 1:10, 1:20, 1:40, and 1:80, respectively. LDH-bound dsRNA in the wells (see arrows). (9B) Release of dsRNA from dsRNA–LDH complex under acidic conditions. M, 100 bp DNA ladder; Lane 1, dsRNA. Lane 2, dsRNA–LDH complex (1:40). Lane 3, dsRNA–LDH complex treated with release buffer. (9C) Ability of LDH to protect dsRNA from nuclease degradation. M, 100 bp DNA ladder; lanes 1 and 2, untreated dsRNA; lane 1, naked dsRNA; lane 2, dsRNA–LDH ligand release buffer; lane 3, naked dsRNA treated with nuclease; lane 4, dsRNA–LDH ligand release buffer pretreated with nuclease.

[0053] Figures 10A-10C Fluorescence micrographs, micrographs, graphs showing that LDH-dsRNA complexes reduce germination and growth of Botrytis cinerea. (10A) dsRNA-cy5 penetration. Conidia of Botrytis cinerea treated with dsRNA (upper panel) or LDH-dsRNA complexes (lower panel) on PDA slides (left panel) or grape cuticle (right panel) were germinated for 16 h. dsRNA was labeled with cy5. (10B) Conidia germination of Botrytis cinerea. Botrytis cinerea was germinated on slides at room temperature after 20 h of incubation in 0.2% SMB or 0.2% SMB supplemented with LDH, dsRNA, or LDH-dsRNA complexes. (10C) Growth inhibition of Botrytis cinerea-GFP. Growth of Botrytis cinerea measured by green fluorescence measurement in 1% SMB or 1% SMB supplemented with LDH, dsRNA, or LDH-dsRNA complexes. Values ​​followed by different letters are significantly different (P<0.05).

[0054] Figures 11A-11E Included are photographs, vertical bar graphs, and micrographs showing that LDH-dsRNA complexes reduce fruit rot caused by Botrytis cinerea inoculation. (11A) Representative image of infected cherries four days post inoculation (dpi). (11B) Rot severity of cherries at 4 dpi (index 0-5). (11C) Representative image of infected grapes at 4 dpi. (11D) Rot severity of grapes at 4 dpi (index 0-5). (11E) Representative HR-SEM images of grape skins after water or LDH treatment and 72 hours after inoculation with Botrytis cinerea. White arrows indicate scar areas. White lines represent 25 microns. Different letters are significantly different according to Tukey Kramer's statistical significance (P<0.05).

[0055] Figures 12A-12C LDH-dsRNA complexes reduce the development of natural rot during storage. Grapes were treated with water (control), LDH, dsRNA or LDH-dsRNA and stored at 0°C for three weeks and then at 22°C for another week. At the end of the experiment, the rot severity (index 0-5) and rot incidence of the fruits were evaluated. (12A) Total rot incidence (% of fruit). (12B) Incidence of rot caused by Botrytis cinerea (% of fruit). (12C) Severity of rot caused by Botrytis cinerea (index 0-5). Different letters are significantly different according to Tukey Kramer's test (P<0.05).

[0056] Figures 13A-13IIncluded are graphs, vertical bar graphs, and photographs showing the prolonged effect of LDH-dsRNA complexes. Grapes were treated with water (control), LDH, dsRNA, or LDH-dsRNA and stored at 0°C. (13A, 13D, and 13G) Disease progression curves of rot severity after 1, 3, or 5 weeks post infection, respectively. (13B, 13E, and 13H) Area under the disease progression curve (AUDPC). (13C, 13F, and 13I) are representative photographs of infected grapes 5 days post inoculation after storage for 1, 3, or 5 weeks, respectively. Data presented are means with standard errors. Values ​​followed by different letters are significantly different according to Tukey Kramer (P<0.05).

[0057] Figures 14A-14D Included are graphs and photographs showing the effects of storage conditions on dsRNA release and treatment efficiency. Grapes were treated with water (control), LDH, dsRNA, or LDH-dsRNA and stored at 0°C in open boxes (14A and 14C) or closed bags (14B and 14D). After 2, 4, and 6 weeks, microlesions were created on the skin with silicon carbide powder and then spray-inoculated with conidia of Botrytis cinerea. (14A) and (14B) recorded rot severity on days 3-5 and calculated the area under the disease progression curve (AUDPC). (14C) and (14D) are representative photographs of infected grapes 5 days after inoculation after 6 weeks of storage in open or closed boxes, respectively. The data presented are the means and standard errors of AUDPC levels normalized to controls in open boxes. Values ​​followed by different letters are significantly different according to Tukey Kramer (P<0.05).

[0058] Fig.15 Includes photos showing the decay severity assessment scale.

[0059] Figures 16A-16C Included are micrographs and vertical bar graphs showing germination of Botrytis cinerea in the presence of various concentrations of dsRNA and LDH-dsRNA complexes. 5 Conidia ml -1 Conidia of Botrytis cinerea were germinated on glass slides with 50 μl of 0.2% SMB medium supplemented with various concentrations (15, 7.5, 3.75 and 1.875 ng / μl) of dsRNA or LDH-dsRNA complexes. The slides were incubated at room temperature for 20 hours. (16A) Representative images of Botrytis cinerea germination under various conditions. (16B) Percent germination. (16C) Germ tube length. Data presented are means with standard errors. Values ​​followed by different letters are significantly different (P<0.05).

[0060] Figures 17A-17BIncluded are vertical bar graphs showing the incidence of rot after inoculation. Cherries (17A) and grapes (17B) were treated with hydrocarbons to produce microlesions. They were then sprayed with water (control), LDH, dsRNA, and LDH-dsRNA. The fruit was then spray-inoculated with conidia of Botrytis cinerea and kept in a humid chamber at 22°C. The percentage of rotten fruit in each treatment was measured 4 days after inoculation. Values ​​followed by different letters are significantly different (P<0.05).

[0061] Figures 18A-18D Included are micrographs and spectra showing HR-SEM and EDS analysis of LDH and grape skin treated with LDH. (18A) LDH visualization (18B) EDS elemental analysis of LDH. Magnesium (Mg) and aluminum (Al) are representative elements of LDH, and silicon (Si) is the silicon component in the glass material that is beneficial to LDH. (18C) Grape skin treated with LDH. (18D) EDS elemental analysis of grape skin treated with LDH. Carbon (C) is an organic material, aluminum (Al) represents LDH, silicon (Si) is a residue of hydrogenated silicon carbide, and iridium (Ir) is a coating material of the sample. The white line represents 25 microns.

[0062] Figures 19A-19B Included are vertical bar graphs showing the incidence and severity of natural decay after cold storage. Grapes were treated with water (control), LDH, dsRNA, or LDH-dsRNA and stored at 0°C for three weeks without inoculation. (19A) Incidence of decay (% of fruit). (19B) Severity of decay (index 0-5). Note that no statistical differences were found between treatments.

[0063] Fig. 20 Included are vertical bar graphs showing the incidence of rot in stored grapes according to rot type. Grapes were treated with water (control), LDH, dsRNA, or LDH-dsRNA and stored at 0°C, then stored at 22°C for another week. The percentage of rotten fruit was assessed, and the rot was classified according to the fungal pathogen causing the rot. Values ​​followed by different letters are significantly different (P<0.05).

[0064] Figures 21A-21C Included are vertical bar graphs showing the incidence of rot after long-term cold storage. Incidence of rot in grapes five days after inoculation with Botrytis cinerea at (21A) one week, (21B) three weeks, and (21C) five weeks after grape treatment.

[0065] Figures 22A-22FIncluded are rot severity progression curves. Grapes were treated with water (control), LDH, dsRNA, or LDH-dsRNA and stored at 0°C in open boxes (upper panels; 22A-22C) or closed bags (lower panels; 22D-22F). After 2, 4, and 6 weeks, microlesions were created on the skin with hydrogenated silicon carbide powder, followed by spray inoculation with conidia of Botrytis cinerea. Rot severity was assessed 5 days after treatment. Values ​​followed by different letters are significantly different (P<0.05).

[0066] Figures 23A-23C Included are vertical bar graphs showing the incidence of rot with and without modified atmosphere.Incidence of rot in grapes five days after inoculation with Botrytis cinerea at (23A) two weeks, (23B) four weeks, and (23C) six weeks after treatment.

[0067] Fig.24 Included are tables summarizing the physiological parameters of stored grapes. DETAILED DESCRIPTION How to use

[0068] According to one aspect, a method for treating or preventing a fungal infection in a plant or part thereof in need thereof is provided.

[0069] In some embodiments, the method comprises applying an effective amount of a double-stranded RNA (dsRNA) molecule to at least a portion of the plant.

[0070] In some embodiments, the dsRNA comprises at least one dsRNA.

[0071] In some embodiments, at least one dsRNA comprises a plurality of dsRNA molecules. In some embodiments, a plurality of dsRNAs comprise a plurality of types of dsRNAs. In some embodiments, each of a plurality of types of dsRNA molecules is complementary to different essential genes or their transcripts (e.g., to their targeting (targets / targeting)).

[0072] In some embodiments, the method comprises applying to at least a portion of the plant an effective amount of a particle comprising: (i) at least one dsRNA molecule; and (ii) a layered double hydroxide (LDH).

[0073] In some embodiments, the method comprises applying to at least a portion of the plant an effective amount of an inhibitory or interfering nucleic acid molecule.

[0074] According to one aspect, a method is provided comprising applying an effective amount of a double-stranded RNA (dsRNA) molecule to at least a portion of a plant.

[0075] In some embodiments, at least one strand of the dsRNA comprises a nucleic acid sequence complementary to at least two transcripts transcribed from at least two essential genes of a fungus that causes a fungal infection, thereby treating or preventing a fungal infection in a plant or part thereof.

[0076] As used herein, the term "essential gene (one or more)" refers to any gene or gene product that is essential for cell growth or survival. The terms "essential", "essential for cell survival or growth" or "essential for cell survival and proliferation" are interchangeable. A gene is essential if, as determined by methods known in the art, inhibition of the function of such a gene or gene product will kill cells or inhibit their growth. Growth inhibition is monitored by a reduction or preferably cessation of cell proliferation. Unless otherwise indicated, the term "essential gene" includes "generally essential gene (one or more)" and "conditionally essential gene". "Generally essential gene" is a gene that is strictly essential for cell survival or growth, or a gene that is essential under conditions to which the cell is normally exposed. Generally, such conditions are normal in vivo conditions or in vitro conditions that approximate these in vivo conditions.

[0077] In some embodiments, the methods described herein that utilize essential genes are performed under conditions where the gene product is required for survival, growth, or both, of the cell (including fungi) containing it.

[0078] In some embodiments, an essential gene or gene product is required for the growth, survival, or both of the fungus in which it is contained.

[0079] In some embodiments, an essential gene or gene product is necessary for the production or functionality of a cellular component. In some embodiments, a cellular component comprises a cell membrane.

[0080] As used herein, the term "conditionally essential gene" encompasses any gene or gene product that is required for cell survival or proliferation under specific environmental conditions, caused by the presence or absence of specific environmental components, agents (including small molecules or biologics), or physical factors (such as radiation).

[0081] In some embodiments, at least two essential genes are of the same pathway. In some embodiments, the pathway comprises an ergosterol production pathway. In some embodiments, at least two essential genes are essential for or involved in ergosterol production.

[0082] In some embodiments, the at least two essential genes are selected from the group consisting of: 3-hydroxy-3-methylglutaryl-CoA synthase (erg13), sterol 14-demethylase (CYP51), and squalene monooxygenase (erg1).

[0083] In some embodiments, the at least two essential genes include all three of egr13, CYP51, and erg1. CYP51 and erg1 are interchangeable.

[0084] In some embodiments, the ERG13 gene or its transcript comprises a nucleic acid sequence disclosed in GenBank Accession No. XM_001552372.2, or a functional analog thereof, having at least 70%, 80%, 90%, 95%, 99% sequence identity or homology thereto, including any values ​​and ranges therebetween. Each possibility represents a separate embodiment of the present invention.

[0085] In some embodiments, the ERG13 gene or transcript comprises the nucleic acid sequence set forth in SEQ ID NO:1.

[0086] In some embodiments, the dsRNA molecule comprises a first RNA sequence derived from erg13 (SEQ ID NO: 1). In some embodiments, the first RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 continuous bp comprising erg13 (SEQ ID NO: 1). In some embodiments, the first RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 continuous bp derived from erg13 (SEQ ID NO: 1). In some embodiments, the first RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 continuous bp complementary to erg13 (SEQ ID NO: 1). In some embodiments, the first RNA sequence comprises 20 to 350 bp, 70 to 300 bp or 190 to 320 continuous bp of erg13 (SEQ ID NO: 1). In some embodiments, the first RNA sequence comprises a nucleic acid sequence comprising 20 to 350 bp, 70 to 300 bp, or 190 to 320 consecutive bp derived from erg13 (SEQ ID NO: 1). In some embodiments, the first RNA sequence comprises a nucleic acid sequence comprising 20 to 350 bp, 70 to 300 bp, or 190 to 320 consecutive bp complementary to erg13 (SEQ ID NO: 1). Each possibility represents a separate embodiment of the present invention.

[0087] In some embodiments, the first RNA sequence of the dsRNA has a level of complementarity of 70% to 100% to erg13 (SEQ ID NO: 1) or a transcript thereof.

[0088] In some embodiments, the ERG11 gene or its transcript comprises a nucleic acid sequence disclosed in GenBank Accession No. XM_001549911.2, or a functional analog thereof, having at least 70%, 80%, 90%, 95%, 99% sequence identity or homology thereto, including any values ​​and ranges therebetween. Each possibility represents a separate embodiment of the present invention.

[0089] In some embodiments, the ERG11 gene or transcript comprises the nucleic acid sequence set forth in SEQ ID NO:2.

[0090] In some embodiments, the dsRNA molecule comprises a second RNA sequence derived from erg11 (CPY51) (SEQ ID NO: 2). In some embodiments, the second RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 consecutive bp comprising erg11 (SEQ ID NO: 2). In some embodiments, the second RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 consecutive bp derived from erg11 (SEQ ID NO: 2). In some embodiments, the second RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 consecutive bp complementary to erg11 (SEQ ID NO: 2). In some embodiments, the second RNA sequence comprises 20 to 350 bp, 70 to 300 bp or 190 to 320 consecutive bp of erg11 (SEQ ID NO: 2). In some embodiments, the second RNA sequence comprises a nucleic acid sequence comprising 20 to 350 bp, 70 to 300 bp, or 190 to 320 consecutive bp derived from erg11 (SEQ ID NO: 2). In some embodiments, the second RNA sequence comprises a nucleic acid sequence comprising 20 to 350 bp, 70 to 300 bp, or 190 to 320 consecutive bp complementary to erg11 (SEQ ID NO: 2). Each possibility represents a separate embodiment of the present invention.

[0091] In some embodiments, the second RNA sequence of the dsRNA has a level of complementarity of 70% to 100% to erg11 (SEQ ID NO: 2) or a transcript thereof.

[0092] In some embodiments, the ERG1 gene or its transcript comprises a nucleic acid sequence disclosed in GenBank Accession No. XM_001547426.2, or a functional analog thereof, having at least 70%, 80%, 90%, 95%, 99% sequence identity or homology thereto, including any values ​​and ranges therebetween. Each possibility represents a separate embodiment of the present invention.

[0093] In some embodiments, the ERG1 gene or transcript comprises the nucleic acid sequence set forth in SEQ ID NO:3.

[0094] In some embodiments, the dsRNA molecule comprises a third RNA sequence derived from erg1 (SEQ ID NO: 3). In some embodiments, the third RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 consecutive bp comprising erg1 (SEQ ID NO: 3). In some embodiments, the third RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 consecutive bp derived from erg1 (SEQ ID NO: 3). In some embodiments, the third RNA sequence comprises a nucleic acid sequence of at least 20, 100, 200, 250 or 300 consecutive bp complementary to erg1 (SEQ ID NO: 3). In some embodiments, the third RNA sequence comprises 20 to 350 bp, 70 to 300 bp or 190 to 320 consecutive bp of erg1 (SEQ ID NO: 3). In some embodiments, the third RNA sequence comprises a nucleic acid sequence comprising 20 to 350 bp, 70 to 300 bp, or 190 to 320 consecutive bp derived from erg1 (SEQ ID NO: 3). In some embodiments, the third RNA sequence comprises a nucleic acid sequence comprising 20 to 350 bp, 70 to 300 bp, or 190 to 320 consecutive bp complementary to erg1 (SEQ ID NO: 3). Each possibility represents a separate embodiment of the present invention.

[0095] In some embodiments, the third RNA sequence of the dsRNA has a level of complementarity of 70% to 100% to erg1 (SEQ ID NO: 3) or a transcript thereof.

[0096] In some embodiments, any of the first, second, third or any combination thereof of the RNA is or constitutes at least one strand of a dsRNA disclosed herein.

[0097] In some embodiments, the length of the dsRNA molecule is 50 base pairs (bp) to 1,000 bp, 150 to 1,000 bp, 250 to 1,000 bp, 300 to 1,000 bp, 400 to 1,000 bp, 500 to 1,000 bp, 650 to 1,000 bp, 700 to 1,000 bp, 800 to 1,000 bp, 900 to 1,000 bp, or 950 to 1,000 bp. Each possibility represents a separate embodiment of the invention.

[0098] In some embodiments, the third RNA sequence has a level of complementarity of 70% to 100% to erg1 (SEQ ID NO: 3) or to a transcript thereof.

[0099] In some embodiments, the dsRNA molecule comprises a first RNA sequence derived from erg13, followed by a second RNA sequence derived from CYP51, followed by a third RNA sequence derived from erg1.

[0100] In some embodiments, the dsRNA molecule comprises the following nucleic acid sequence: ATGCTACGGTGGTACCAACGCCGTTTTCAACGCTGTCAACTGGGTAGAATCATCTGCATGGGATGGAAGAGACGCCATTGTCGTTGCTGGAGATATTGCTCTATATGCCAAGGGTGCTGCACGTCCAACTGGAGGTGCTGGAGCTGTTGCCATGTTGATTGGACCAAATGCTCCAGTTGTTGTCGAGCCTGGTCTTCGCGGATCCTACATGCAACATGCCTACGATTTCTACAA (SEQ ID NO: 4), or a functional analog having 70-100% sequence identity or homology thereto.

[0101] In some embodiments, the dsRNA molecule comprises the following nucleic acid sequence: CTGTTTTGACAACCCCCGTATTTGGCAAAGATGTAGTTTACGACTGCCCAAATGCGAAGTTGATGGAGCAAAAGAAGTTCATGAAAATTGGCTTGTCTACAGAAGCTTTCCGATCCTACGTCCCAATCATACAAATGGAGGTGGAAAACTTTATGAAGCGTTCTTCGGCGTTCAAAGGTCCAAAGGGAACTGCTGACATTGGTCCCGCTATGGCTGAAATCACCATCTACACTGCTTCGCACACTCTGCAAGGAAAGGAAGTCCGCGATCGATTCGATACCTCCTTTGCCTCTCTCTACCACGACCT (SEQ ID NO: 5), or a functional analog having 70-100% sequence identity or homology thereto.

[0102] In some embodiments, the dsRNA molecule comprises the nucleic acid sequence: AGAAGCAGATTTGTTATTTTGGCCATCTCACCATCATCGCAGATGGATATGCCTCCAAATTCCGCAAGCAATACATCAACAAAACTCCCATTGTCAAAAGTAAATTCTACGCTCTAGAATTAATAGATTGTCCCATGCCAGCTCCCAATCATGGAATCGTAGTCCTCTCGGACGTCTCCCCAGTTCTCCTCTATCAAATCGGTACCCACGA (SEQ ID NO: 6), or a functional analog having 70-100% sequence identity or homology thereto.

[0103] In some embodiments, the dsRNA molecule comprises the following nucleic acid sequence: (SEQ ID NO: 7), or a functional analogue thereof having at least 70%, 80%, 90%, 95% or 99% sequence homology or identity, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention.

[0104] In some embodiments, the inhibitory or interfering nucleic acid molecule comprises RNA. In some embodiments, the inhibitory or interfering nucleic acid is a small hairpin RNA (shRNA) or a small interfering RNA (siRNA).

[0105] Inhibitory nucleic acids that can be used in the present methods and compositions include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single-stranded or double-stranded RNA interference (RNAi) compounds (such as siRNA compounds), modified base / locked nucleic acid (LNA), antagomir, peptide nucleic acid (PNA), and other oligomeric compounds or oligonucleotide mimetics that hybridize to at least a portion of a target nucleic acid (e.g., at least two essential genes or transcripts thereof) and modulate their function. In some embodiments, the inhibitory nucleic acid includes antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides containing modified bonds, interfering RNA (RNAi), short interfering RNA (siRNA); microinterfering RNA (miRNA); small sequence RNA (strRNA); or short hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activation RNA (saRNA), or a combination thereof.

[0106] As used herein, "interfering RNA" refers to any double-stranded or single-stranded RNA sequence that is capable of inhibiting or down-regulating gene expression, either directly or indirectly (i.e., upon transformation) by mediating RNA interference. Interfering RNAs include, but are not limited to, small interfering RNAs ("siRNAs") and small hairpin RNAs ("shRNAs"). "RNA interference" refers to the selective degradation of sequence-compatible messenger RNA transcripts.

[0107] As used herein, "shRNA" (small hairpin RNA) refers to an RNA molecule comprising an antisense region, a loop portion, and a sense region, wherein the sense region has complementary nucleotides that base-pair with the antisense region to form a duplex. After post-transcriptional processing, the small hairpin RNA is converted into a small interfering RNA by a cleavage event mediated by an enzyme, i.e., Dicer, a member of the RNase III family.

[0108] As used herein, "small interfering RNA" or "siRNA" refers to any small RNA molecule that can inhibit or downregulate gene expression by mediating RNA interference in a sequence-specific manner. The small RNA can be, for example, about 18 to 21 nucleotides long.

[0109] As used herein, "antagomir" refers to a small synthetic RNA that is complementary to a specific microRNA target, mismatched at the cleavage site, or has one or more base modifications to inhibit cleavage. In another embodiment, "antagomir" refers to a small synthetic RNA that is complementary to a microRNA target group, mismatched at the cleavage site, or has one or more base modifications to inhibit cleavage.

[0110] The term "nucleic acid" is well known in the art. "Nucleic acid" as used herein generally refers to any molecule (e.g., chain) of DNA, RNA, or its derivatives or analogs comprising nucleotides. Nucleotides are composed of nucleosides and phosphate groups. The nitrogenous bases of nucleosides include, for example, naturally occurring purine or pyrimidine nucleosides found in DNA (e.g., adenine "A", guanine "G", thymine "T" or cytosine "C") or RNA (e.g., A, G, uracil "U" or C).

[0111] The term "nucleic acid molecule" includes, but is not limited to, single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), small RNA, circular nucleic acids, genomic DNA or RNA fragments, degraded nucleic acids, amplification products, modified nucleic acids, plasmid or organelle nucleic acids, and artificial nucleic acids such as oligonucleotides.

[0112] In some embodiments, the particles comprise a mole / mole (m:m) ratio of 1:20 to 1:30 (m:m), 1:20 to 1:40 (m:m), 1:20 to 1:50 (m:m), 1:20 to 1:60 (m:m), 1:20 to 1:70 (m:m), 1:20 to 1:80 (m:m), 1:20 to 1:100 (m:m), 1:10 to 1:100 (m:m), 1:30 to 1:40 (m:m), 1:30 to 1:60 In some embodiments, the present invention relates to at least one dsRNA molecule and LDH in an amount of 1:10 to 1:80 (m:m), 1:30 to 1:80 (m:m), 1:40 to 1:60 (m:m), 1:40 to 1:70 (m:m), 1:40 to 1:80 (m:m), 1:50 to 1:60 (m:m), 1:50 to 1:70 (m:m), 1:10 to 1:80 (m:m), 1:60 to 1:70 (m:m), 1:60 to 1:80 (m:m) or 1:70 to 1:80 (m:m). Each possibility represents a separate embodiment of the present invention.

[0113] As used herein, the term "functional analogue" refers to any nucleic acid sequence encoding a protein product that is involved in or necessary for ergosterol production as disclosed herein, such as erg11, erg13 or erg1, and has at least 80%, 90%, 95% or 99% of the activity of the protein product encoded by any one of erg11, erg13 and erg1. Each possibility represents a separate embodiment of the present invention.

[0114] The terms "homology" or "identity" as used interchangeably herein refer to the sequence identity between two amino acid sequences or two nucleic acid sequences, with identity being a more stringent comparison. The phrases "percent identity or homology" and "% identity or homology" refer to the percentage of sequence identity found when comparing two or more amino acid sequences or nucleic acid sequences. Two or more sequences can be any value from 0-100% identity, or any value therebetween. Identity can be determined by comparing the positions in each sequence, and each sequence can be aligned for comparison with a reference sequence. When a position in the compared sequences is occupied by the same nucleotide base or amino acid, the molecules at that position have identity. The degree of identity of an amino acid sequence is a function of the number of identical amino acids at the common positions of these amino acid sequences. The degree of identity between nucleic acid sequences is a function of the number of identical or matching nucleotides at the common positions of these nucleic acid sequences. The degree of homology of an amino acid sequence is a function of the number of amino acids at the common positions of the polypeptide sequences.

[0115] The following is a non-limiting example of calculating homology or sequence identity (these terms are used interchangeably herein) between two sequences. For the purpose of optimal comparison, the sequences are aligned (e.g., for optimal alignment, gaps can be introduced in one or both of the first and second amino acids or nucleic acid sequences, and for comparison purposes, non-homologous sequences can be ignored). Using the GCG program in the GCG software package, the Blossum 62 scoring matrix is ​​used to determine the optimal alignment as the best score with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5. The amino acid residues or nucleotides at the corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecule has identity at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences.

[0116] In some embodiments, a basic local alignment search tool (BLAST) is used to calculate or determine % homology or identity as described herein. In some embodiments, a Blossum 62 scoring matrix is ​​used to calculate or determine % homology or identity as described herein.

[0117] In some embodiments, the fungus is selected from the phylum Ascomycota.

[0118] In some embodiments, the fungus belongs to a genus selected from the group consisting of Alternaria, Aspergillus, Blumeria, Botrytis, Cercospora, Colletotrichum, Geotrichum, Fusarium, Lasiodiplodia, Magnaporthe, Monilinia, Mycosphaerella, Penicillium, Phytophthora, Puccinia, Rhizophus, Rhizoctoniat, Sclerotinia, Ustilago, and any combination thereof.

[0119] In some embodiments, the fungus is a species belonging to the genus Botrytis.

[0120] In some embodiments, the fungus is Botrytis cinerea.

[0121] In some embodiments, administering is performed by soaking, dipping, soaking, injecting, spraying, coating, or any combination thereof.

[0122] In some embodiments, applying is by spraying, dipping, or both.

[0123] In some embodiments, applying is performed in an open field, a greenhouse, a storage facility, or any combination thereof.

[0124] In some embodiments, the administration is pre-harvest administration, post-harvest administration, or both. In some embodiments, the administration is post-harvest administration.

[0125] In some embodiments, administering comprises multiple administrations.

[0126] In some embodiments, in multiple administrations, each administration event is separated by at least 5 days, separated by at least 6 days, separated by at least 7 days, separated by at least 9 days, separated by at least 10 days, separated by at least 12 days, separated by at least 15 days, separated by at least 20 days, separated by at least 25 days, separated by at least 30 days, separated by at least 40 days or any value and scope therebetween. Each possibility represents a separate embodiment of the present invention. In some embodiments, in multiple administrations, each administration event is separated by 5-20 days, separated by 7-21 days, separated by 7-28 days, separated by 7-35 days, separated by 5-30 days or separated by 6-30 days. Each possibility represents a separate embodiment of the present invention. In some embodiments, multiple administrations are separated by 1 week to 4 weeks.

[0127] In some embodiments, the method further comprises co-applying an amount of a fungicide to the at least a portion of the plant. In some embodiments, the amount of the fungicide is 5%, 7%, 9%, 10%, 15%, 20%, 30% or 50% lower than the effective amount of the fungicide when applied alone, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention.

[0128] In some embodiments, the at least a portion of the plant comprises any plant part selected from the group consisting of a whole plant, a plant cell, a tissue, a fruit, a flower, and an organ. The plant may be in any form, including cuttings and harvested material (e.g., fruit). In some embodiments, at least a portion of the plant comprises: a fruit, a root, a bulb, a fruit, a tuber, a corm, a leaf, a flower, a seed, a stem, a callus, a nut, a grain, a cutting, a root stock, a scion, a harvested crop, including a root, a bulb, a tuber, a corm, a leaf, a flower, a seed, a stem, a callus, a nut, a grain, a fruit, a cutting, a root stock, a scion, or any combination thereof.

[0129] In some embodiments, the at least a portion of the plant includes any one of the following: leaves, fruits, flowers, and any combination thereof.

[0130] In some embodiments, the method further comprises subjecting at least a portion of the plant to at least one abiotic condition selected from CO2, humidity, or both.

[0131] In some embodiments, the method further comprises subjecting at least a portion of the plant to at least one abiotic condition selected from the group consisting of: CO2 levels of 0.01% to 5%, 0.1% to 5%, 0.5% to 5%, 1.0% to 5%, 2.0% to 5%, or 3% to 5%, relative humidity of 80% to 98%, 85% to 98%, 90% to 98%, 92% to 98%, or 95% to 98%, and both. Each possibility represents a separate embodiment of the present invention.

[0132] In some embodiments, the subjecting is after the administering.

[0133] Agricultural pests cause significant yield and economic losses worldwide. Pests can develop resistance to chemical pesticides and reproduce faster than engineering can address them, so alternative pest management strategies are urgently needed.

[0134] The development of RNAi biopesticides delivered via carriers that are then taken up by plants and delivered to pests could provide an alternative to broad-spectrum chemical-based pest and pathogen control measures, where the pests and pathogens would instead be accurately and specifically targeted with minimal off-target effects.

[0135] According to some embodiments, the compositions disclosed herein and methods of use thereof relate to pathogen or pest control. In some embodiments, the pathogen is a plant pathogen, such as a phytopathogen. According to some embodiments, methods for preventing or treating fungal infectious diseases of plants are provided.

[0136] As used herein, the terms "pathogen" and "pest" are interchangeable.

[0137] Plant pathogens and / or pests are common and will be apparent to one of ordinary skill in the art.

[0138] As used herein, the term "plurality" encompasses any integer equal to or greater than 2. In some embodiments, a plurality includes at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention.

[0139] In some embodiments, the polynucleotide comprises RNA, DNA, a synthetic analog of RNA, a synthetic analog of DNA, a DNA / RNA hybrid, or any combination thereof. In some embodiments, the particles of the invention comprise a polynucleotide selected from the group consisting of RNA, DNA, a synthetic analog of RNA, a synthetic analog of DNA, a DNA / RNA hybrid, or any combination thereof.

[0140] As used herein, "antisense oligonucleotide" refers to a nucleic acid sequence that is opposite and complementary to a DNA or RNA sequence.

[0141] As referred to herein, a "reverse and complementary nucleic acid sequence" is a nucleic acid sequence that is capable of hybridizing with another nucleic acid sequence consisting of complementary nucleotide bases. "Hybridization" refers to the formation of a double-stranded molecule between complementary nucleotide bases under appropriate stringent conditions (e.g., adenine (A) and thymine (T) (or in the case of RNA, uracil (U)) form base pairs, while guanine (G) and cytosine (C)) form base pairs) (see, e.g., Wahl, GM and SL Berger (1987) Methods Enzymol. 152: 399; Kimmel, AR (1987) Methods Enzymol. 152: 507). For the purposes of the present method, the inhibitory nucleic acid does not need to be complementary to the entire sequence, as long as it is sufficient to provide specific inhibition; for example, in some embodiments, the sequence is 100% complementary to at least 2-7 or 2-8 nucleotides (nt), e.g., 2-7 or 20 nt at the 5' end of the microRNA itself (e.g., "seed sequence").

[0142] In some embodiments, the inhibitory nucleic acid has one or more chemical modifications to the backbone or side chains. In some embodiments, the inhibitory nucleic acid has at least one locked nucleotide, and / or has a phosphorothioate backbone.

[0143] In some embodiments, the inhibitory nucleic acid is an RNA interference molecule (RNAi). In some embodiments, the RNAi is or includes double-stranded RNA (dsRNA).

[0144] In some embodiments, the inhibition or interference RNA is chemically modified. In some embodiments, chemical modification is a modification of the main chain of the inhibition or interference RNA. In some embodiments, chemical modification is a modification of the sugar of the inhibition or interference RNA. In some embodiments, chemical modification is a modification of the core base of the inhibition or interference RNA. In some embodiments, chemical modification improves the stability of the inhibition or interference RNA in cells. In some embodiments, chemical modification improves the stability of the inhibition or interference RNA in vivo. In some embodiments, chemical modification improves the stability of the inhibition or interference RNA in the open air, in the field, on the surface exposed to air, etc. In some embodiments, chemical modification improves the ability of the inhibition or interference RNA to cause target gene or sequence silencing, and target gene or sequence include but are not limited to the RNA molecules derived from pathogens as described herein. In some embodiments, the chemical modification is selected from the group consisting of: phosphate-ribose backbone, phosphate-deoxyribose backbone, phosphorothioate-deoxyribose backbone, 2'-O-methylphosphorothioate backbone, phosphorodiamidatemorpholino backbone, peptide nucleic acid backbone, 2-methoxyethylphosphorothioate backbone, alternating locked nucleic acid backbone, phosphorothioate backbone, N3'-P5' aminophosphoracid, 2'-deoxy-2'-fluoro-β-d-arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclic DNA (tcDNA) nucleic acid backbone, ligand-conjugated antisense, and any combination thereof.

[0145] In some embodiments, the inhibitory or interfering RNA is complementary to any position along the target sequence, such as the transcript of the essential gene (one or more) disclosed herein. In some embodiments, the inhibitory or interfering RNA is complementary to the 3' end of the transcript of the target sequence, such as the essential gene (one or more) disclosed herein. In some embodiments, the inhibitory or interfering RNA is complementary to the sequence in the 3' untranslated region of the transcript of the target sequence, such as the essential gene (one or more) disclosed herein. In some embodiments, the target sequence is a gene or its transcript, such as the transcript of the essential gene (one or more) disclosed herein. In some embodiments, the transcript, such as the transcript of the essential gene (one or more) disclosed herein, comprises pre-mRNA, mature mRNA, alternative spliced ​​mRNA or any combination thereof.

[0146] In some embodiments, the effective amount is a therapeutically effective amount. In some embodiments, the effective amount is a prophylactically effective amount. In some embodiments, the effective amount is an inhibitory effective amount.

[0147] In some embodiments, any of therapeutic, preventive, inhibitory, and any combination thereof is associated with a fungal plant pathogen, e.g., an amount effective to treat a plant infected therewith, prevent infection of a plant susceptible thereto, inhibit the fungus or its activity in a plant, or any combination thereof.

[0148] As used herein, the term "treatment" or "treating" an illness, disorder, or condition encompasses alleviating at least one symptom thereof, reducing its severity, or inhibiting its progression. Treatment does not necessarily mean that the illness, disorder, or condition is completely cured. For effective treatment, the compositions or methods useful herein need only reduce the severity of the illness, disorder, or condition, reduce the severity of the symptoms associated therewith, or provide an improvement in the quality of life of the patient or subject. In some embodiments, the symptoms of the illness, disorder, or condition are alleviated.

[0149] As used herein, the term "prevention" of a disease, disorder or condition encompasses the delay, prevention, suppression or inhibition of the onset of a disease, disorder or condition. As used in accordance with the subject matter currently described, the term "prevention" relates to a preventive process in which an object is exposed to one or more compositions currently described prior to the initiation or onset of a disease / disorder process. The term "suppression" is used to describe a condition in which a disease / disorder process has begun, but the overt symptoms of the condition have not yet been realized. Thus, an individual's cells may suffer from a disease / disorder, but external signs of the disease / disorder have not yet been identified clinically. In either case, the term "prevention" can be used to encompass both prevention and suppression. In contrast, the term "treatment" refers to the clinical use of an active agent in order to combat an already existing condition, the clinical manifestations of which have been realized in the patient.

[0150] As used herein, "treatment" includes amelioration and / or prevention.

[0151] In some embodiments, amelioration comprises alleviation of at least one symptom associated with a disorder described herein. Antifungal composition

[0152] According to another aspect, an antifungal composition is provided, comprising a plurality of particles comprising: (a) a dsRNA molecule; and (b) an LDH.

[0153] In some embodiments, the dsRNA comprises a nucleic acid sequence that is complementary to at least one transcript of at least one essential gene of the fungus.

[0154] In some embodiments, the antifungal composition comprises at least one characteristic selected from the group consisting of: (i) an m:m ratio of magnesium to aluminum of 2 to 4; (ii) a zeta potential of 30 mV to 50 mV; and (iii) a particle size of 150 nm to 350 nm; or any combination thereof.

[0155] In some embodiments, the m:m ratio of magnesium to aluminum is from 2 to 4, from 2 to 3, or from 3 to 4. Each possibility represents a separate embodiment of the present invention.

[0156] In some embodiments, the particle size is 150nm to 350nm, 150nm to 200nm, 150nm to 250nm, 150nm to 300nm, 190nm to 300nm, 190nm to 330nm, 200nm to 350nm, 200nm to 300nm, 250nm to 350nm, or 100nm to 400nm. Each possibility represents a separate embodiment of the present invention.

[0157] In some embodiments, the antifungal composition is characterized by being able to reduce or inhibit at least one fungal activity for 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, 1 to 2 weeks, 2 to 6 weeks, 3 to 6 weeks, 4 to 6 weeks, 3 to 5 weeks, or 2 to 4 weeks. Each possibility represents a separate embodiment of the present invention.

[0158] In some embodiments, the fungal activity is selected from the group consisting of cell proliferation, cell division, DNA synthesis, mycelium production, hyphae production, ergosterol production, secretion, or both, or any combination thereof.

[0159] In some embodiments, the at least one essential gene encodes at least one protein involved in the ergosterol production pathway.

[0160] In some embodiments, the at least one essential gene includes three essential genes involved in the ergosterol production pathway.

[0161] In some embodiments, the antifungal composition is formulated for at least one route of administration selected from the group consisting of: spraying, dipping.

[0162] In some embodiments, the antifungal composition is formulated as a dip, powder, spray, or concentrate.

[0163] In some embodiments, the composition is formulated to be applied by spraying. In some embodiments, the composition is formulated to be applied as a spray or aerosol. In some embodiments, the composition is formulated to be applied by spraying, soaking, dipping, soaking or injection.

[0164] In some embodiments, an agricultural composition is provided, comprising an agriculturally effective amount of dsRNA and LDH. In some embodiments, the agriculturally effective amount comprises a therapeutically effective amount. In some embodiments, the therapeutically effective amount relates to an agricultural organism or crop. In some embodiments, the organism or crop comprises a sensitive or susceptible plant. In some embodiments, the plant is sensitive or susceptible to fungal infection.

[0165] In some embodiments, the carrier is an agriculturally acceptable carrier. In some embodiments, the agriculturally acceptable carrier includes an environmentally acceptable carrier. Such carriers can be any material that the animal, plant or environment to be treated can tolerate. In some embodiments, the carrier includes any material that can be added to the particles of the present invention or the composition comprising it, without causing or having an adverse effect on the environment or any species or organism other than pathogens. In addition, the carrier must make the particles or compositions comprising it still effective, so as to achieve the introduction of polynucleotides into plants and / or the prevention or treatment of viral infectious diseases in plants.

[0166] In some embodiments, the agriculturally acceptable carrier is selected from the group consisting of: a solvent, a surfactant, a dispersant, a sticking agent, a spreading agent, a synergist, a penetrant, a compatibilizer, a buffer, a defoamer, a thickener, a drift retardant, or any combination thereof.

[0167] In some embodiments, the agriculturally acceptable carrier is or includes a surfactant.

[0168] In some embodiments, the w / w concentration of the agriculturally acceptable carrier in the composition is 0.1 to 99%, 0.1 to 1%, 1 to 10%, 10 to 20%, 20 to 30%, 30 to 50%, 50 to 60%, 60 to 80% or 80 to 90%, including any range therebetween. Each possibility represents a separate embodiment of the present invention.

[0169] In some embodiments, the carrier is a liquid carrier. In some embodiments, the carrier is configured for spray application.

[0170] In some embodiments, prevention or treatment comprises reducing the survival rate of pathogens. In some embodiments, prevention or treatment comprises reducing the replication rate of pathogens. In some embodiments, prevention or treatment comprises reducing the tolerance of pathogens to standard therapies and / or preventive measures. In some embodiments, prevention or treatment comprises increasing the susceptibility and / or vulnerability of pathogens to standard therapies and / or preventive measures.

[0171] In some embodiments, contacting comprises spraying the plant or part thereof. In some embodiments, contacting comprises spraying near the plant or part thereof. In some embodiments, contacting comprises spraying a growth medium comprising the plant. In some embodiments, the growth medium comprises soil.

[0172] In some embodiments, the nearby distance is 10 cm to 50 cm, 1 cm to 100 cm, 10 cm to 1 m, 0.5 m to 2.5 m, 1 m to 50 m, 0.1 m to 30 m. Each possibility represents a separate embodiment of the present invention.

[0173] In some embodiments, the plant part comprises at least one leaf of the plant. In some embodiments, the plant part comprises one or more leaves of the plant. In some embodiments, the plant part comprises at least a portion of the foliage of the plant. In some embodiments, the plant part comprises the foliage of the plant.

[0174] In some embodiments, the fungus is a pathogen. In some embodiments, the fungus is a pathogenic fungus. In some embodiments, the fungus is a plant pathogen. In some embodiments, the fungus is a plant pathogen. In some embodiments, the composition is an anti-plant fungus composition. General considerations

[0175] Where a range of values ​​is provided, it is understood that each intermediate value between the upper and lower limits of the range and any other exposition or intermediate value within the exposition, up to one tenth of the unit of the lower limit, is encompassed within the present invention unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may be independently included within the smaller ranges and are also encompassed within the present invention, subject to any specifically excluded limitations within the exposition range. When the exposition range includes one or both of the limits, ranges excluding one or both of the included limits are also encompassed within the present invention.

[0176] As used herein, the term "about" when combined with a value refers to plus or minus 10% of the reference value. For example, a length of about 1,000 nanometers (nm) refers to a length of 1,000 nm +- 100 nm.

[0177] It should be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to a "polynucleotide" includes a plurality of such polynucleotides, and reference to a "polypeptide" includes reference to one or more polypeptides and their equivalents known to those skilled in the art, and so on. It should also be noted that the claims may be drafted to exclude any optional elements. Thus, this statement is intended to serve as antecedent basis for the use of exclusive terminology such as "solely", "only", etc. in conjunction with limitations of claim elements, or use of a "negative" limitation.

[0178] In those cases where a convention similar to "at least one of A, B, and C, etc." is used, such a construction is generally intended to be in the sense that one skilled in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include, but is not limited to, systems having only A, only B, only C, having A and B together, having A and C together, having B and C together, and / or having A, B, and C together, etc.). One skilled in the art would further understand that virtually any antonymous conjunction and / or phrase presenting two or more optional terms, whether in the specification, claims, or drawings, would be understood to contemplate the possibility of including one of the terms, any one of the terms, or both of the terms. For example, the phrase "A or B" would be understood to include the possibility of "A" or "B" or "A and B."

[0179] It should be understood that, for the sake of clarity, certain features of the present invention described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for the sake of brevity, various features of the present invention described in the context of a single embodiment may also be provided individually or in any suitable sub-combination. All combinations of embodiments related to the present invention are specifically encompassed by the present invention and disclosed herein, just as each combination is individually and explicitly disclosed. In addition, all sub-combinations of various embodiments and elements thereof are also specifically encompassed by the present invention and disclosed herein, just as each such sub-combination is individually and explicitly disclosed herein.

[0180] After examining the following examples, other objects, advantages and novel features of the present invention will become apparent to those skilled in the art, and these examples are not intended to be limiting. In addition, as described above and as claimed in the following claims, each of the various embodiments and aspects of the present invention is experimentally supported in the following examples.

[0181] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. Example

[0182] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are fully described in the literature.See, for example, "Molecular Cloning: A laboratory Manual," Sambrook et al., (1989); "Current Protocols in Molecular Biology," Vol. to Molecular Cloning", John Wiley&Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Volumes 1-4, ColdSpring Harbor Laboratory Press, New York (1998); the methods listed in U.S. Patent Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, JE, ed. (1994); "Culture of Animal Cells-A Manual of Basic Technique", by Freshney, Wiley-Liss, NY (1994), third edition; "Current Protocols in Immunology" Volumes I-III Coligan JE, ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Strategies for Protein Purification and Characterization-A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference.Other general references are provided throughout this document. Materials and Methods Construction and production of dsRNA

[0183] To silence the ergosterol pathway, SnapGene ( dsRNA constructs were designed for three transcripts in the ergosterol biosynthesis pathway, erg11, erg1 and erg13, using the software from GSL Biotech, resulting in 791 bp. Each sequence was selected from an expression region of 250-300 bp. The complete sequence including the flanking EcoR1 restriction site and T7 transcriptional promoter synthesized by GeneScript Inc is as follows. ERG constructs

[0184] The ERG construct has the combined sequences of three selected essential genes (ERG13, ERG11 = CYP51 and ERG1) from the ergosterol biosynthetic pathway in Botrytis cinerea B05.10, totaling 751 bp.

[0185] EcoRI restriction site GAATTC (SEQ ID NO: 8).

[0186] T7 promoter sequence (sense) TAATACGACTCACTATAGGGAGA (SEQ ID NO: 9).

[0187] ERG13–234 bp (SEQ ID NO: 4).

[0188] ERG11 = CYP51 - 307 bp (SEQ ID NO: 5).

[0189] ERG1 - 210 bp (SEQ ID NO: 6).

[0190] DCL1 / DCL2 Dicer using the DCL1 and DCL2 sequences was cloned in a similar manner as shown above. Briefly, DCL1 / DCL2 Dicer was cloned between the T7 transcriptional promoter in a similar manner using the following sequences for DCL1 and DCL2.

[0191] DCL1–252 bp TGCGGAAGAACTTGAAGGTTTGCTACACAGTCAAATATGTACTGCAGAAGATCCCA GCTTGCTGCAGTACTCAATCAAAGGTAAACCTGAGACTCTTGCCTACTATGATCCCT TGGGCCCGAAATTCAATACTCCTCTTTATCTTCAAATGCTCCCGCTTCTAAAAGACA ATCCTATCTTTCGGAAGCCATTTGTATTTGGGACAGAAGCCAGTAGAACTCTAGGATCTTGGTGTGTTGACCAGATCTGGAC(SEQ ID NO:10)。 DCL2–238 bp GGATGCCATTTGCTGCACGCCAAAAATACATCGAGCAGATCTTCGCCTTCGAGTAAA GCTACCACTTCTATCTATTATCTACTATACCCCAGAGTCAAATATCATCGTGACGAA AACTGTGGCGAGCCTGAGAAAGATTGTGCAAAGTCTCAACATTTTCGAAGACCCCT ACGTTTTGACACTAAAAAGGAGTGATAGCGAAAAAAGTCAACGTGAGCTGGCGAAAGTACTCAAGAGT(SEQ ID NO:11)。

[0192] For RNA synthesis, high-yield transcription reactions were performed according to the Ambion MEGAscript protocol (Thermo Fisher Scientific). The plasmid template was linearized by the EcoR1 restriction enzyme, with complete linearization monitored by gel fractionation and purified by the Wizard SV purification system (Promega). After RNA synthesis produced two self-hybridizing complementary RNA transcripts, DNA and single-stranded RNA were removed by nuclease digestion. The remaining dsRNA was purified on a solid phase adsorption system to remove proteins and oligonucleotides. The integrity and efficiency of dsRNA duplex formation were checked by agarose gel and spectrophotometry. Pure dsRNA was stored at -20°C until use. Off-target sequences of dsRNA constructs were tested using siFi21 as previously described by Luck S. et al. (2019) (licensed by CC-BY-SA-4.0). Briefly, the entire dsRNA-ERG sequence was analyzed using siFi software against all genome sequences of Botrytis cinerea (RefSeq: GCF_000143535.2), Alternaria alternata (RefSeq: GCF_001642055.1), Penicillium expansum (RefSeq: GCF_000769745.1), Vitis venifera (RefSeq: GCF_000003745.3) and human (RefSeq: GCF_000001405.39; all data were downloaded from NCBI database), with default parameters to achieve higher off-target sensitivity. Additional off-target searches used the ERG construct from Botrytis cinerea as a DNA gene query with BLAST technology. More than 90% identity was detected for some fungal pathogens closely related to the genus Botrytis. These fungal pathogens included: Sclerotinia and Botrytis for ERG13, Botrytis and Sclerotinia for ERG11, and Botrytis for ERG1. No significant homology to plant or animal DNA was detected. Preparation and Characterization of Layered Double Hydroxide (LDH)

[0193] LDH was synthesized by a modification of the coprecipitation method described previously (Xu et al., 2006). Briefly, 10 mL of a mixed salt solution containing Mg(NO3)2 (3 mmol) and Al(NO3)3 (1 mmol) was quickly added to 40 mL of NaOH solution (0.15 M) under vigorous stirring and then stirred for 30 min in a N2-purged flask. To avoid preferential adsorption of carbonate ions by LDH, all solutions were degassed under vacuum, and all synthetic steps were performed under N2 flow. The LDH slurry was isolated by centrifugation, dispersed in 40 mL of deionized water, and hydrothermally treated at 100 °C for 16 h in a 45 mL Teflon-lined autoclave (Parr Instruments, Moline, IL, USA).

[0194] The size and zeta potential of LDH were measured using a Zetasizer ZS Nano (Malvern Instruments, Malvern, UK) equipped with a He-Ne laser (λ=633 nm). To measure the zeta potential, the electrophoretic mobility of the particles was measured by laser Doppler velocimetry, and the zeta potential value was calculated by the Smoluchowski approximation of the Henry equation. To determine the size, dynamic light scattering (DLS) was detected at an angle of 175°, and the autocorrelation function of the scattered light intensity was analyzed using DTS 5.0 software.

[0195] The wavelength range of 4,000–500 cm was obtained on a Nicolet iS5 FTIR-ATR (Thermo Scientific, Waltham, Massachusetts, US). -1 Fourier transform infrared (FT-IR) spectroscopy with a resolution of 0.4 cm -1 .

[0196] For integration, dsRNA-Dicer was mixed with LDH and incubated at 30°C with shaking (400 rpm) for 30 min. The protection of LDH against nuclease digestion was studied by exposing naked dsRNA and dsRNA doped with LDH to benzonase endonuclease (Millipore, USA). The samples were treated at 37°C for 30 min and dsRNA was released from the LDH complex by treatment with acidic release buffer (4.11 mL of 0.2 M Na2HPO4 + 15.89 mL of 0.1 M citric acid; pH 3) in a volume ratio of 5:1. Under these conditions, the activity of benzonase was inhibited. To visualize the attachment and release of LDH-dsRNA, samples were run on 1% agarose gel and stained with ethidium bromide. Fungal strains and growth media

[0197] Cultures of Botrytis cinerea B05-10 were routinely grown on potato dextrose agar (PDA; Difco, New Jersey, USA) medium at 22° C. for 14 days. Conidia were gently collected by suspension in sterile distilled water, filtered through four layers of sterile cheesecloth, and diluted to 10 5 Conidia ml -1 concentration for in vitro experiments, or diluted to 10 4 Conidia ml -1 The concentration of conidia in the suspension was determined under a microscope using a hemacytometer. Uptake of dsRNA by Botrytis cinerea

[0198] Synthetic fluorescent dsRNA was used to assess the uptake of naked dsRNA or dsRNA in LDH-dsRNA complexes by Botrytis cinerea as described (Duanis-Assaf et al., 2021). PDA glass slides were prepared for in vitro assessment of dsRNA uptake by fungal cells. Clean glass slides were immersed in a 50 mL tube containing PDA to form a thin layer of PDA on the glass. A suspension of Botrytis cinerea conidia (10 5 Conidia mL -1 , 10μl) and 50μl of cy5-labeled dsRNA or cy5-labeled dsRNA-LDH complex at a concentration of 15ng / μl (total 750ng), the PDA slides were placed in a biological hood to dry for 15 minutes. The slides were incubated in a humidified petri dish at room temperature for 12-16 hours. To test the uptake of dsRNA in vivo, grapes were treated with silicon carbide to create microlesions. Cy5-labeled dsRNA or cy5-labeled dsRNA-LDH complex at a concentration of 15ng / μl was placed in the droplets (total 50μl). Droplets of Botrytis cinerea (total 20μl of conidia suspension, conidia concentration 10 5 mL -1 ) were inoculated into treated grapes and incubated at 25° C. in a humid chamber for 24 h. Conidia were examined under a confocal laser scanning microscope (CLSM; Olympus IX81, Center Valley, PA). Effects of dsRNA on decay development

[0199] All fruits and crops were purchased from local growers. For non-invasive inoculation assays, a 7 μl drop of 10 4 Conidia ml -1After the removal of Botrytis cinerea, onion (Allium cepa) petals, cultivated pink rose (Rosa) petals and 'Gilli' strawberry (Fragariaananassa) were treated with water (control) or dsRNA-ERG (15ng / μl). The onion petals, petals and fruits were incubated at 25°C for 5-7 days. The rot diameter was measured every day. To measure the irregular shape of the rot, the rot diameter of each rot was determined as the average of 3 diameters in different directions. Each experiment was conducted with at least 10 replicates and the experiment was repeated twice.

[0200] For the wound inoculation assay, red bell peppers (Capsicum annuum), 'Sweet-Hart' cherries (Prunus cerasus), 'Shelly' mangoes (Mangiferae indica), or 'Autumn Royal' and 'Scarlotta' grapes (Vitis vinifera) were pretreated with hydrogenated silicon carbide powder (Fisher Scientific, Loughborough, UK) by gently rubbing the fruit until the skin loses its smooth texture without releasing cellular fluid, thereby creating microlesions on the fruit epidermis that mimic natural wounds. Without this uniform infection, reliable quantitative measurements of protection cannot be obtained. Spray inoculation concentrations of 10 4 Conidia ml -1 After 100 μl of Botrytis cinerea conidia suspension, water (control) or dsRNA (15 ng / μl) spray treatment was applied until drainage. The fruits were stored in a humid chamber at 25°C for 6 days and the rot area or severity (index 0-5; 0-no rot, 1-slight rot, 5-severe rot) was measured. Effects of LDH-dsRNA complexes on decay development

[0201] 'Sweet-Hart' cherries (European sour cherries) were harvested in the Golan Heights and purchased from the 'Beresheet' packing-house, while 'Scarlotta' grapes (wine grapes) were harvested in the Lachish region of Israel. The cherries and grapes were gently pre-rubbed with silicon carbide powder (Fisher Scientific, Loughborough, UK) to create micro-damage on the fruit surface. The spray inoculation concentration was 10 4 Conidia mL -1After inoculation with a suspension of Botrytis cinerea conidia, water (control), LDH, dsRNA (15 ng / μl) or LDH-dsRNA complex (15 ng / μl) was sprayed until water ran out. The inoculated fruits were stored in a humid chamber at 25°C for 6 days and the severity was measured (index 0-5; 0-no rot, 1-slight rot, 5-severe rot). 40 fruits per cultivar were used in each treatment. System protection assessment

[0202] Red bell pepper (jalapeno) and tomato (Solanum lycopersicum) were pretreated with hydrogenated silicon carbide powder to create microlesions. Ten (10) μl drops of water (control) or dsRNA-ERG (15 ng / μl) were placed on the upper left corner of the fruit. A concentration of 10 4 Conidia ml -1 The fruit was inoculated with a drop of 7 μl of Botrytis cinerea at three time points: the day of treatment, one day after treatment or three days after treatment. Conidia of Botrytis cinerea were inoculated at five inoculation points: the treatment point (T) and four other points, separated by distances of 2 and 4 cm for bell pepper or 1.5 and 3 cm for tomato, placed vertically and horizontally. After inoculation, the fruit was stored at 25°C in a humid chamber for 7 days and the rot area was measured. Effects of LDH-dsRNA complex on conidia germination

[0203] The effect of LDH-dsRNA complexes on the germination of Botrytis cinerea conidia was tested in vitro (Galsurker et al., 2020; Gatto et al., 2011). Briefly, conidial suspensions (10 μl) were inoculated on glass slides containing 0.2% Sabouraud maltose broth [SMB; 10 gr peptone (Difco), 40 gr maltose (Caisson labs, Smithfield, Utah, United States) per 1 L] with or without 15 ng / μl dsRNA or LDH-dsRNA complexes. Conidia were incubated in humidified culture dishes at room temperature for 16 hours. Conidial germination was examined under a microscope (Leica DM500 equipped with a Leica ICC50 HD camera). Percent germination and germ tube length were assessed in three microscopic fields for each droplet (six droplets per treatment) using ImageJ software (rsb.info.nih.gov / ij). RNA extraction and transcript expression (quantitative PCR; qPCR)

[0204] 'Superior' and 'Scarlotta' wine grapes were inoculated with Botrytis cinerea and treated with water (control) or dsRNA-ERG as described above. 8, 24 and 48 hours after inoculation, the peel or pulp was collected in liquid nitrogen. For RNA extraction, the peel or pulp was ground into a fine powder using a mortar and pestle and purified using Spectrum Biotechnology according to the manufacturer's instructions after DNase treatment (TURBO DNA-free kit, Ambion Life Technologies, USA). TMTotal RNA was extracted using a plant total RNA kit (Sigma-Aldrich, St.Louis, Missouri, United States). cDNA was constructed from total RNA (1 μg) using the RevertAid first-strand cDNA synthesis kit (Thermo Scientific, USA) according to the manufacturer's instructions. cDNA samples were diluted 1:10 and used for qRT-PCR. The relative expression of three ergosterol-targeted genes (erg11, erg1, and erg13) and two ergosterol-non-targeted genes (erg3 and erg9) was evaluated by qRT-PCR analysis using Step One Plus real-time PCR (Applied Biosystems, USA). PCR amplification was performed with 3 μL of the diluted cDNA template in a 10 μL reaction mixture containing 5 μL Syber Green (Applied Biosystems) and 250 nM primers. qRT-PCR analysis was performed using the corresponding primer sets for the selected genes. All primers were selected from transcript sequence regions that did not belong to the dsRNA-ERG construct to avoid cross contamination.The primers used in this study are as follows: erg11, forward primer 5'-GCTGATCTCCCTGCTCTCAAGTA-3' (SEQ ID NO: 12) and reverse primer 5'-TGTGGAGGCGTAGAGTTTCCTT-3' (SEQ ID NO: 13); erg1, forward primer 5'-GAGGAAAGCGTGTGCAAGCT-3' (SEQ ID NO: 14) and reverse primer 5'-TTCGCCCGTAGATGGATTGG-3' (SEQ ID NO: 15); erg13, forward primer 5'-AAGAAGCGTTTCAACGAGCG-3' (SEQ ID NO: 16) and reverse primer 5'-AGGGCGGCACTATCAACATT-3' (SEQ ID NO: 17); erg3, forward primer 5'-TGGAAGTGACCGACAAATAC-3' (SEQ ID NO: 18); NO:18) and reverse primer 5'-GAGGGTTGTGCCATTGAT-3'(SEQ ID NO:19); erg9, forward primer 5'-TCACCCATTTCACCCAGTTT-3'(SEQ ID NO:20) and reverse primer 5'-GTTGATCCGAGTCCGTCTATTG-3'(SEQ ID NO:21), and for evaluating dsRNA-ERG constructs, we used forward primer 5'-TACCTCCTTTGCCTCTCTACC-3'(SEQ ID NO:22) located on the erg13 sequence and reverse primer located on the erg11 sequence (SEQ ID NO:23). The PCR cycle program included: 94°C for 10 min; then 94°C for 10 s, 60°C for 15 s, 72°C for 20 s, and 40 cycles. The Ct values ​​of Botrytis cinerea actin (forward primer 5'-TGCTCCAGAAGCTTTGTTCCAA-3') (SEQ ID NO: 24) and reverse primer 5'-TCGGAGATACCTGGGTACATAG-3') (SEQ ID NO: 25) or grape actin (forward primer 5'-CTTGCATCCCTCAGCACCTT-3') (SEQ ID NO: 26) and reverse primer 5'-TCCTGTGGACAATGGATGGA-3' (SEQ ID NO: 27) were used as reference genes to normalize the expression of selected genes and the expression values ​​were calculated relative to the (water treated) control samples using Step One software v2.2.2 (Applied Biosystems). Each treatment consisted of three biological replicates and three technical replicates. In vitro fungal growth

[0205] To evaluate the inhibition of fungal growth by naked dsRNA or LDH-dsRNA, 6 μl of a concentration of mL -1 Botrytis cinerea expressing GFP (Leroch et al., 2011)10 5 Conidial suspensions of 10 conidia were inoculated in black 96-well plates (Greiner, Kremsmünster, Austria) containing 200 μl of PDB. LDH-dsRNA complexes or dsRNA alone were added to each well at a concentration of 15 ng / μl. The plates were incubated at room temperature and GFP measurements were taken every hour at 488 nm excitation and 509 nm emission using a Synergy LX plate reader (BioTek, Winooski, Vermont, United States) for 50 hours. The fluorescence intensities of the three replicates were averaged together and background corrected by subtracting the mean fluorescence intensity of the fungus-free treatment (Galsurker et al., 2020; Langvad, 1999).

[0206] To test the effects of common fungicides on the growth of Botrytis cinerea, "prochloraz" (Sportak, Bayer Cropscience LLC, Monheim am Rhein, Germany) or "fludioxonil" (scholar, Hod-Hasharon, Israel) fungicides were diluted in 1% SMB to final concentrations of 1-1000 ppb or 0.01-1,000 ppb, respectively.

[0207] Plates were incubated at room temperature and OD measurements at 600 nm were taken every hour for 48-72 hours using a Synergy LX plate reader (BioTek, Winooski, Vermont, United States). The absorbance of triplicate wells was averaged together and background corrected by subtracting the average absorbance of medium alone at time zero (Galsurker et al., 2020; Langvad, 1999). Percent growth inhibition was calculated (OD in control wells - OD in treated wells) / O.DX 100 in control wells (Meletiadis et al., 2003). The coefficient treatment interaction (CTI) was calculated as follows: CTI = AB / (A × B). AB is the ratio of the treatment combination to the control; A or B is the ratio of a single treatment to the control. When CTI < 1, the treatment interaction coefficient is considered synergistic (Chen et al., 2014). Characterization of LDH-treated grapes using scanning electron microscopy

[0208] Wash and sterilize the grapes with 70% ethanol. After drying, rub the grapes lightly with silicon carbide powder and then spray them with water or LDH. Inoculate half of the fruits with 10 μl of Botrytis cinerea conidia (10 5 Conidia mL -1 ). Grape peel samples were taken for high-resolution scanning electron microscopy (HR-SEM) imaging and energy dispersive spectroscopy (EDS) elemental analysis. Uninoculated samples were obtained immediately after treatment, while inoculated samples were obtained after 72 hours of incubation. The samples were immersed in 4% formaldehyde for 24 hours, then dehydrated by immersion in increasing concentrations of ethanol (25, 50, 75, 90, 95 and 100%) and air-dried. For LDH characterization, the LDH suspension was dropped on a cleaned silicon wafer and dried under vacuum for 24 hours. Before HR-SEM visualization, the grape skin was fixed to a silicon stub and sputter-coated with iridium. SEM images were obtained using a Sirion XL30 SFEG HR-SEM (ThermoFisher Scientific, Waltham, MA, USA). EDS was performed using an electron beam with a diameter of 5 μm and an X-ray detector system attached to the SEM. This method allows the relative amounts of magnesium (Mg) and aluminum (Al) to be determined. Effects of LDH-dsRNA complex on the quality of long-term stored fruits

[0209] Grapes were sprayed with water (control), LDH, dsRNA (15 ng / μl) or LDH-dsRNA complex (15 ng / μl) until water ran off. One hundred (100) berries per treatment were divided into four replicates and placed in plastic fruit storage containers. Grapes were refrigerated (CS) at 0°C for three weeks and then incubated for another week at 22°C during the storage period (SL). Fruit quality was checked at each time point (after CS and after SL).

[0210] Physiological parameters: Fruit firmness was determined by measuring force-deformation compression with a 350 g dynamometer, with 20 fruits per treatment measured at each time point, by placing the fruit horizontally on the turntable of a small fruit firmness analyzer (Firmtech II; BioWorks, Wamego, KS, USA) with a 15 mm flat probe. Total soluble sugars (%TSS) were measured in the pulp juice (juice of 5 fruits per replicate) using a Palette digital refractometer PR-1 (Model DBX-55, Atago, Japan) in triplicate for each treatment at each time point. Acidity was determined as the equivalent mass of malic acid or tartaric acid (cherry or grape, respectively) in 1 mL of pulp juice (juice of 5 fruits per replicate) dissolved in 40 mL of double distilled water using an automatic titrator (Model 719s, Titrino Metrohm Ion Analysis Ltd., Switzerland) in triplicate for each treatment at each time point.

[0211] Decay severity assessment: At the end of CS and SL, the severity of decay was assessed on a 0-5 index scale with 6 severity levels, where 0 = no decay and 5 = severe decay. The decay severity scale can be found in ( Fig.15 ). The results presented are the mean ± SE of the measurements. The overall rot incidence was determined by calculating the percentage of rotten fruit per plastic box in each treatment at the end of CS or SL. These results are presented as the mean ± SE of each treatment. Effects of LDH-dsRNA complexes on the development of decay after long-term storage

[0212] Grapes were sprayed with water (control), LDH, dsRNA (15 ng / μl), or LDH-dsRNA complex (15 ng / μl) until water flowed out. Grapes were stored at 0°C (CS), and 30 grapes from each group were used for infection experiments after 1, 3, and 5 weeks of storage. 4 Conidia mL -1 After applying a suspension of Botrytis cinerea conidia, 30 grapes were gently rubbed with silicon carbide powder to create micro-damage on the fruit cuticle. The fruits were stored in a humid chamber at 25°C for six days, and the severity of rot was measured (index 0-5; 0-no rot, 1-mild rot, 5-severe rot). Effect of LDH-dsRNA complexes on the development of rot after long-term storage under different atmospheric conditions

[0213] 'Red Globe' grapes were sprayed with water (control), LDH, dsRNA (15 ng / μl) or LDH-dsRNA complex (15 ng / μl) until water ran off. Grapes were stored in open boxes at 0°C (CS) to minimize CO2 accumulation or in modified atmosphere liners (GR-4, After 2, 4, and 6 weeks of storage, the CO2 level in the sealed bags was measured using Oxybaby (WITT, Witten, Germany), and 30 grapes from each group were used for inoculation experiments. Grapes were treated with silicon carbide powder to create micro-lesions on the fruit cuticle, and then 10 4 Conidia mL -1 The fruit was then stored in a humid room at 25°C for six days and the severity of rot was measured (index 0-5, increment 1; 0-no rot, 5-severe rot). The area under the disease progression curve (AUDPC) was calculated using the trapezoidal approximation method: Since no significant differences were found between the control treatments under both storage conditions, the average AUDPC value of the control (water-treated grapes in open boxes) at each time point was set to 100%, and the AUDPC value of each treatment was normalized compared to the control: Normalized AUDPC = AUDPC value of treatment / AUDPC of control × 100. Due to technical problems, the severity of decay of the water-treated grapes in the modified atmosphere bags was not recorded after four weeks of storage. Statistical analysis

[0214] Data presented are means with standard errors. A t-test was performed to compare two treatments. A one-way ANOVA analysis was performed to compare the different treatments at each time point. The analysis was performed by Tukey–Kramer HSD test for paired comparisons of parameter values ​​or Wilcoxon test for nonparametric values. A two-way ANOVA analysis was performed to compare the different treatments at different time points. Statistical analyses were performed using JMP Pro 15 software (SAS Institute, Cary, North Carolina, USA). Different letters or asterisks indicate significant differences at P ≤ 0.05. Example 1 dsRNA penetrates the emergence zone of hyphae and inhibits germination and growth of Botrytis cinerea

[0215] Three different genes in the ergosterol biosynthesis pathway of Botrytis cinerea were selected as targets. Sequences from erg13, erg11 and erg1 were connected to generate a construct with a total length of 751 bp (dsRNA-ERG; Figure 1, see "Materials and Methods"). For the positive control, another construct targeting the Botrytis cinerea DCL1 / DCL2 Dicer (dsRNA-Dicer) was cloned in a similar manner. To verify that Botrytis cinerea can take up external dsRNA from the environment, fluorescent dsRNA constructs were prepared by incorporating Cy5-labeled nucleotides into the sequences of dsRNA-ERG or dsRNA-Dicer. The results showed that dsRNA was taken up and internalized in a punctate manner near the germination zone of conidial hyphae (Figure 1).

[0216] The growth of Botrytis cinerea from conidia was monitored for 50 h in the presence of different amounts of dsRNA-ERG and showed that fungal growth was gradually reduced in a dose-dependent manner over the 200-800 ng (1-4 ng / μl) dsRNA-ERG concentration range. When dsRNA-ERG was added to the growth medium at the beginning of the incubation, the in vitro germination assay showed a significant decrease in germination rate and germ tube length compared to the control ( Figure 2A-2C When dsRNA was applied after 8 h of conidia incubation, the addition of dsRNA-ERG had a slight effect on the germination percentage ( Figure 2A ). However, the germ tube length was still significantly lower ( Figure 2B-2C To evaluate the effect on germination in vivo, grapes treated with water (control) or dsRNA-ERG were inoculated with Botrytis cinerea and then stained with lactophenol blue. Compared with Botrytis cinerea grown on water-treated grapes, grapes treated with dsRNA-ERG showed shorter germ tubes ( Figure 2D ). These results suggest that dsRNA-ERG is more effective in inhibiting fungal germ tube elongation than in germination percentage. Example 2 dsRNA targeting ergosterol biosynthesis inhibits gray mold development on fruit

[0217] After inoculation with B. cinerea conidia, dsRNA-ERG was applied externally to various crops and rot development was monitored. Compared to the (water-treated) control, the treated tissues showed a slower rate of rot development and a smaller rot diameter around the inoculation site (Figure 3). Calculation of the area under the disease progression curve (AUDPC) showed a significant reduction in rot development of about 5-fold in onion petals, 8-fold in rose petals, and 9-fold in strawberry compared to the control (Figure 3). In addition, dsRNA-ERG showed similar or greater efficacy in reducing rot development than dsRNA targeting dicer encoding genes (dcl1 and dcl22; dsRNA-Dicer), which was previously shown to reduce B. cinerea rot development (Wang et al., 2016) (Figure 3).

[0218] The effect of dsRNA-ERG on rot development was also tested on various fruits. Inoculation of various fruits, including tomatoes, with Botrytis cinerea without prior wounding resulted in very little rot development in the control. This may be due to the poor ability of Botrytis cinerea to penetrate the waxy epidermis. To achieve consistent wounding, the inoculated area of ​​the fruit was pretreated to create micro-damage by rubbing with hydrogenated silicon carbide powder. This promotes conidial inoculation and promotes uniform mold development on the fruit. The fruit was then sprayed with dsRNA-ERG or water (control) and subsequently sprayed with Botrytis cinerea conidia. In all fruits tested (sweet pepper, cherry, mango and grape), the rot development rate and rot area decreased (Figure 4). AUDPC analysis showed that the mold development of sweet pepper, mango and grape was significantly reduced by about 5 times, while the reduction in rot development in cherry fruit was not statistically significant ( Figure 4B ). Example 3 Applying dsRNA-ERG to protect the fruit systemically

[0219] Next, the inventors aimed to evaluate the ability of dsRNA-ERG to spread to other fruit parts and provide protection. Using bell peppers and tomatoes, the systemic protection of dsRNA-ERG was evaluated by applying dsRNA-ERG at one point on the fruit and inoculating along the horizontal and vertical axes. The rot area was measured once a day and the AUDPC of the disease curve was calculated. When inoculation was performed on the same day as the application of dsRNA-ERG, the AUDPC of bell peppers and tomatoes treated with dsRNA-ERG was surprisingly lower at all inoculation points, although not significantly ( Figure 5A-5B However, inoculation with Botrytis cinerea one day after treatment resulted in a significant 4-fold reduction in rot development in both peppers and tomatoes compared to control fruits ( Figure 5C-5DIt is worth mentioning that the reduction in rot development was similar at all inoculation sites close to and far from the dsRNA-ERG treatment sites ( Figure 5C-5D ).

[0220] The ability of dsRNA-ERG treatment to provide durable systemic protection was evaluated by inoculation with Botrytis cinerea three days after treatment. Infected bell peppers three days after treatment did not show any differences between dsRNA-ERG treated fruits and controls ( Figure 5E ). Nevertheless, the rot area in both groups was significantly lower compared with the bell peppers inoculated on the treatment day or one day after treatment ( Figure 5A , 5C and 5E). This may be due to the healing of microlesions on the pepper epidermis. In tomatoes inoculated three days after dsRNA-ERG treatment, dsRNA-ERG treated fruits showed significantly lower rot development at all inoculation points compared to the control ( Fig. 5F ). In addition, a significant reduction in rot development was observed near the treatment point. These results indicate that dsRNA-ERG is able to transfer systemically in the fruit and reduce rot development.

[0221] To evaluate the penetration and action of dsRNA-ERG, microlesions were created on grape skins using hydrogenated silicon carbide powder and then the grapes were sprayed with water (control) or with dsRNA-ERG. Next, the fruits were sprayed with conidia of Botrytis cinerea and samples of the skin (exocarp) or pulp (mesocarp) were collected 8, 24 and 48 hours later for RNA analysis (Figure 6). The later time points were included because the initial symptoms of rot appeared 48h after inoculation. Eight hours after the dsRNA-ERG treatment of the skin, the dsRNA-ERG moved to the pulp and smaller amounts were measured in the grape pulp ( Fig. 6A Although the relative abundance of dsRNA-ERG in the peel was still high 48 hours after treatment, the relative amount in the flesh decreased 10-fold after 24 hours and remained almost unchanged after 48 hours ( Fig. 6A The effectiveness of downregulating the erg11 transcript over time was tested in both the skin and the flesh using primers from regions of the transcript sequence that were not included in the dsRNA construct. In grape skin, downregulation of the erg11 transcript was observed at all time points tested ( Figure 6BIn grape pulp at 8 and 24 h post infection, Botrytis cinerea actin and erg11 were not detected in dsRNA-ERG treated grapes, but were detected in inoculated controls, which may be due to fungal inhibition. These results indicate that the selected erg11 primers are specific for the transcript and cannot detect the dsRNA-ERG construct. At 48 h, expression of erg11 transcript levels was significantly reduced in dsRNA-ERG treated grape pulp compared to the control ( Figure 6B ).

[0222] The dsRNA-ERG construct was designed to affect the post-transcriptional expression of three transcripts in the ergosterol biosynthetic pathway. Therefore, the three targeted transcripts erg13, erg11 and erg1 ( Figure 6C ) and two non-targeted transcripts erg3 and erg9 were quantified. The relative expression of mRNA transcripts was measured by qPCR and normalized to the expression of fungal actin. Compared with the control, the relative expression of these three targeted transcripts was reduced by more than 50% on average in dsRNA-ERG treated fruits 48 hours after inoculation ( Figure 6C ). However, the two non-targeted transcripts were significantly upregulated in treated grapes 48 h after inoculation compared to controls, suggesting an attempt to compensate ( Figure 6C ). Example 4 Synergistic effects of dsRNA-ERG and ergosterol inhibitors and ergosterol supplementation

[0223] To complement the effect of dsRNA-ERG on the growth of Botrytis cinerea, exogenous ergosterol was added to the dsRNA-ERG treatment. In vitro fungal growth kinetics were determined using optical density (OD) measurements that correlated with fungal biomass. The fungal growth curve showed a substantial decrease ( Fig. 7A However, when B. cinerea conidia were grown in medium containing exogenous ergosterol in addition to dsRNA-ERG, the fungal growth curve showed a similar growth pattern to that of untreated B. cinerea conidia, reaching the same final OD level ( Fig. 7A Importantly, the addition of ergosterol to the control did not alter fungal growth. The effect of exogenous ergosterol addition on the development of fruit rot in vivo was evaluated in infected grapes ( Figure 7B-7C). Grapes were micro-injured using hydrogenated silicon carbide powder and then sprayed with water (control), dsRNA-ERG, or dsRNA-ERG combined with exogenous ergosterol. Fruits were inoculated by spraying with conidia of Botrytis cinerea and the severity of rot was assessed daily. Compared with the control, dsRNA-ERG treatment reduced the rate of Botrytis cinerea development and rot severity by more than 50% up to 6 days post inoculation (dpi) ( Figure 7B-7C In contrast, the addition of exogenous ergosterol supplemented the decay development and restored the decay progression to a level similar to that of the control ( Figure 7B-7C The results of reduced mRNA accumulation and exogenous ergosterol supplementation indicated that the lack of ergosterol synthesis resulted in the inhibition of decay development.

[0224] It is of interest to explore spray-induced gene silencing (SIGS) in combination with commercial fungicides. The fungicide prochloraz is an ergosterol inhibitor of the enzyme lanosterol 14α-demethylase (CYP51A1; encoded by erg11), which is required for the production of ergosterol. However, fungicides also have multiple targets in animal systems, suggesting a need to limit their use (Vinggaard et al., 2006). Increasing concentrations of prochloraz in the growth medium (1-1,000 ppb) resulted in a dose-dependent reduction in fungal growth as measured by OD ( Fig.7D When 4 ng / μl dsRNA-ERG was added, the inhibition of fungal growth was enhanced ( Fig.7D The combination of dsRNA-ERG with various concentrations of 'prochloraz' showed synergistic fungal growth reduction compared to each fungicide treatment or dsRNA-ERG treatment alone ( Fig.7D ). Another fungicide, fludioxonil, was recently shown to act on triose phosphate isomerase activity to induce methylglyoxal stress, thereby altering the perception of histidine kinases to trigger fungal death (Brandhorst and Klein, 2019). 'Fludioxonil' reduced Botrytis cinerea growth in a nonlinear manner, with a greater and non-synergistic reduction in fungal growth achieved by the addition of 4 ng / μl dsRNA-ERG (data not shown). These results suggest that the application of dsRNA-ERG is able to significantly reduce the amount of fungicide required to inhibit fungal growth. Example 5 Synthesis and characterization of LDH

[0225] MgAl layered double hydroxide clay (LDH) with a Mg / Al ratio of 3 was prepared using a modified coprecipitation method (Duan and Evans, 2006; Xu et al., 2006). The synthesis produced a translucent dispersion. After irradiation with a laser beam, the LDH solution exhibited the Tyndall effect of light scattering ( Fig. 8A), confirming the colloidal nature of the dispersion. LDH exhibits a typical FT-IR spectrum of hydrotalcite-like compounds ( Figure 8B ). The spectrum is at 3,400 cm -1 The 1,350-cm-1 band shows a strong broad band corresponding to the hydrogen bond stretching vibrations of the OH groups in the brucite-like layer and water molecules. -1 The band at 770, 637 and 545 cm -1 The band at can be attributed to MO and MOH stretching vibrations (Xu et al., 2008). Doppler velocimetry measurements show that the Z potential distribution is narrow due to the net positive charge of the LDH layer ( Figure 8C ), with an average value of +35 mV. Dynamic light scattering (DLS) showed that these particles had a unimodal size distribution ( Fig.8D ), with an average particle size of 266 nm and a moderate polydispersity index (0.275). Example 6 LDH-dsRNA complex and RNase protection

[0226] The ability of LDH to bind and release dsRNA was assessed by a gel retardation assay. This assay is based on the inability of dsDNA complexed with LDH to penetrate and migrate through the pores of an agarose gel (Ladewig et al., 2010; Li et al., 2014). In the absence of LDH or at a low mass ratio of dsRNA to LDH (i.e., 1:1 and 1:5), no detectable binding was observed. In this case, free dsRNA-Dicer (490 bp) migrated toward the anode in the form of a band stained with ethidium bromide. However, at a mass ratio of 1:10, a significantly lower intensity band was observed, while at ratios of 1:20, 1:40, and 1:80, no detectable free RNA was visualized. Conversely, at ratios of 1:20, 1:40, and 1:80, dsRNA was able to be detected in the loading wells ( Fig. 9A , lanes 5-7). This result indicates that dsRNA is completely bound to LDH particles at a mass ratio of 1:20. As expected, treatment under acidic conditions (release buffer, pH = 3) triggers the expulsion of dsRNA from LDH particles ( Fig. 9B , lane 3). Thereafter, the amount of dsRNA used for all experiments described in this work was 15 ng / μl, close to a 1:60 ratio.

[0227] The ability of LDH to protect dsRNA molecules from degradation was investigated by RNase protection assay. When treated with the promiscuous endonuclease benzonase, naked dsRNA underwent complete degradation, whereas dsRNA complexed with LDH remained intact ( Fig. 9C , compare lanes 3 and 4). Example 7 LDH-dsRNA complex inhibits the growth of Botrytis cinerea

[0228] To compare the uptake of naked dsRNA alone and LDH-dsRNA complexes, dsRNA was labeled with cy5 fluorescent dye. In both cases, after 24 h of incubation, the fluorescent dsRNA penetrated the B. cinerea cells in vitro and in vivo ( Fig. 10A Next, fungal growth was recorded to quantitatively assess the effects of dsRNA on fungal germination and growth when applied alone or in LDH-dsRNA complexes ( Figures 10B-10C In germination assays, both dsRNA and LDH-dsRNA complexes significantly delayed the germination of Botrytis cinerea in vitro ( Fig. 10B and 16). To follow the fungal growth, Botrytis cinerea expressing the fluorescent protein GFP was used and the in vitro fungal growth kinetics were determined using fluorescence intensity measurements related to fungal biomass. Thus, the control group started to grow significantly after 20 h, while dsRNA or LDH-dsRNA treatments started only after 30 and 45 h, respectively ( Fig. 10C ). Addition of dsRNA to the growth medium reduced fungal growth by 40%, while the LDH-dsRNA complex reduced fungal growth by 50% ( Fig. 10C Direct observation of germination after 20 h showed that dsRNA reduced germination by 25%, while LDH-dsRNA complex reduced germination rate by 70% ( FIG. 16 ).

[0229] Interestingly, dilution of LDH, dsRNA, or LDH-dsRNA complex from 15 ng / μl showed that lower concentrations were not as effective in inhibiting germination. However, they all showed effective inhibition of germ tube length as low as 3.75 ng / μl ( Fig. 16C ). These results indicate that Botrytis cinerea is able to take up dsRNA, inhibiting fungal germination and growth in vitro, when applied alone or in LDH-dsRNA complexes. Hyphal growth appears to be more sensitive to the presence of dsRNA than initial germination. Example 8 LDH-dsRNA complex reduces gray mold caused by Botrytis cinerea

[0230] The effects of dsRNA and LDH-dsRNA complexes on the development of gray mold in fruit were studied. Grapes or cherries were gently rubbed with silicon carbide to create controlled micro-damage, thereby increasing the incidence of infection. This was followed by spray treatment with water (control), LDH, dsRNA, or LDH-dsRNA complexes. The treated fruits were then spray-inoculated with conidia of Botrytis cinerea, and the incidence and severity of rot were measured daily. In cherries, in the control groups (water and LDH), most of the fruit rotted and the incidence of rot was high (100% and 90%, respectively; Figure 17). However, in the treated groups (dsRNA and LDH-dsRNA), the incidence of rot was significantly lower (the incidence of rot was reduced by approximately 60% and 80%, respectively; Figure 17). In addition, the naked dsRNA and LDH-dsRNA complex treatments significantly reduced the severity of rot by 2-fold ( Figures 11A-11B In grapes, the incidence of rot was lower in the control than in cherries at four days post inoculation (dpi). Nevertheless, the incidence of rot was even lower in the dsRNA and LDH-dsRNA treatments (Figure 17), and the severity of rot was also lower ( Figures 11C-11D ). Compared with the control, the area under the disease progression curve (AUDPC) calculation results showed that LDH and dsRNA treatments decreased by 2 times, while LDH-dsRNA complexes decreased by 3 times ( Fig.11D ).

[0231] To gain a deeper understanding of the effect of LDH alone on the development of decay, HR-SEM was used to visualize grape skins treated with water or LDH in the presence and absence of inoculation. These images show microdamage created by silicon carbide abrasion ( Fig.11E ). The peels treated with water and LDH displayed different morphologies. The peels treated with water showed scar lesions as large as 100 μm, while the lesions in the LDH treated samples appeared to be physically blocked and filled in part by LDH particles. Notably, direct EDS analysis of the LDH samples showed both aluminum and magnesium (Figure 18). EDS analysis of the scar tissues showed that they contained aluminum but no magnesium, which could indicate the presence of residual clay flakes inside the microlesions. Interestingly, visualization of the peels 72 hours after inoculation with Botrytis cinerea showed that the development of fungal hyphae was less in the LDH treatment without dsRNA than in the water treatment ( Fig.11E These results suggest that LDH alone can act as a partial barrier to interfere with the colonization of Botrytis cinerea ( Fig. 16C , 11B and 11D-11E). Example 9 Effects of LDH-dsRNA on natural infection and specificity of dsRNA protection

[0232] Infection of table grapes also occurs in the field before harvest, when the fungus is still latent. In addition, most fruits and vegetables are stored postharvest before being marketed. In summary, it is crucial to examine the efficacy of dsRNA treatments to promote protection during different storage stages. To this end, the effects of LDH, dsRNA or LDH-dsRNA on the development of spontaneous decay and quality parameters in table grapes during long-term fruit storage were evaluated. In these experiments, fruit quality was evaluated on treated fruits at key time points during storage and storage. Quality parameters can be mainly divided into two categories: physiological sensory parameters such as acidity, sugar content, and firmness, and pathological parameters such as decay incidence and severity. In all four treatments (water, LDH, dsRNA, LDH-dsRNA), there were no significant differences between these treatments when evaluating sensory quality ( Fig.24 ).

[0233] To establish the efficacy of the dsRNA formulations, grapes were sprayed with water (control), LDH, dsRNA, or LDH-dsRNA complexes and stored at 22°C for one week (representing the storage period) and then at 0°C for three weeks (representing the cold storage period). After cold storage, the overall incidence of rot was relatively low, and in the dsRNA treatment, the total number of infected fruits was even lower, although not statistically significant (Figure 19). However, after the storage period, the incidence of rotten fruits increased in all treatments ( Fig. 12A In the control group, 25% of the fruits rotted, while in the LDH treatment, there was no significant reduction in rot, and about 20% of the fruits rotted ( Fig. 12A Compared with the control, both dsRNA and LDH-dsRNA complexes showed a significant 2-fold reduction in the incidence of rotten fruit ( Fig. 12A ).

[0234] Since the inventors examined natural decay and the fruit was not inoculated with a specific fungus, it was of interest to identify the fungal pathogen causing the decay. In this case, the effect of the dsRNA and LDH-dsRNA complex was much more significant when only decay caused by Botrytis cinerea was measured. In the control, most of the fruit decay was caused by Botrytis cinerea, accounting for about 23%-25% of the total. In grapes treated with dsRNA or LDH-dsRNA, the percentage of Botrytis cinerea was reduced to about 5% ( Fig. 12B and 20 LDH treatment also resulted in a slight reduction in the development of rot caused by Botrytis cinerea infection, with approximately 13.5% of the fruit rotted ( Fig. 12B The severity of rot caused by Botrytis cinerea showed that LDH treatment had no significant effect on the severity of gray mold, while both dsRNA and LDH-dsRNA complex significantly reduced the incidence and severity of gray mold by 5 times compared with the control group ( Figures 12B-12C). These results highlight the specificity of dsRNA protection and the need to tailor dsRNA to maximize its protective effect. Example 10 LDH-dsRNA complex has a prolonged effect on reducing decay development

[0235] One of the challenges of food storage is to maintain long-term freshness, and it is of interest to investigate whether LDH contributes to the stability of dsRNA, thereby achieving its "slow release". To this end, grapes were sprayed with water (control), LDH, dsRNA or LDH-dsRNA and stored at 0°C for 1, 3 or 5 weeks (refrigerated). This was followed by a five-day examination of the development of fruit rot during the storage period in the following manner. At the end of each storage period, the grapes were treated with silicon carbide and then spray-inoculated with Botrytis cinerea, and the severity of rot was recorded every day. Compared with the control, LDH-treated grapes did not change the development of rot at all time points. However, dsRNA and LDH-dsRNA complex treatments significantly reduced the occurrence of gray mold at each time point (Figure 13). According to the disease progression curve and AUDPC calculation results, after one week of refrigeration, the severity of rot in the LDH-dsRNA complex treatment was reduced by about 50% compared with the control group, while the severity of rot in the dsRNA treatment ( Figures 13A-13C ) and decay incidence ( Fig.21A ) was even more reduced, by 80%. Three weeks after treatment, both dsRNA and LDH-dsRNA complexes similarly reduced rot development by 65% ​​( Figures 13D-13F ), however, LDH-dsRNA complex reduced the incidence of decay by 20% compared with other treatments ( Fig.21B When grapes were inoculated 5 weeks after treatment, there was no significant difference in the incidence of rot among the treatments ( Fig. 21C ), however, the decay severity trend changed, and although both dsRNA and LDH-dsRNA complexes significantly reduced decay severity, dsRNA reduced severity by 50% and LDH-dsRNA complexes reduced decay progression by 65% ​​( Figures 13G-13I ). These results indicate that the LDH-dsRNA complex has a prolonged and slow release effect ( FIG. 13 ). Embodiment 11 Storage conditions affect the release rate of dsRNA from LDH

[0236] To further evaluate the conditions that affect dsRNA stability, the inventors investigated how storage under elevated CO2 and humidity levels would affect the release of dsRNA from LDH-dsRNA complexes, as these conditions are common in storage protocols. Grapes were treated with water (control), LDH, dsRNA, and LDH-dsRNA and stored at 0°C under two conditions: open boxes (i.e., normal atmosphere) and sealed bags with modified atmosphere packaging (MAP). The latter is designed to increase CO2 and humidity levels. CO2 levels in MAP are at about 0.5±0.02%, compared to 0.04% in normal atmosphere. Relative humidity in MAP is stabilized at 93-95%, while relative humidity in cold rooms is 85%. After silicon carbide treatment, grapes for each treatment were spray-inoculated with Botrytis cinerea every two weeks and examined after 3-5 days. At all experimental time points and under both storage conditions, the severity of rot was reduced by 60-80% in dsRNA and LDH-dsRNA treatments compared to the control and LDH alone. It is clear that the effectiveness of dsRNA alone in preventing rot development decreased over time. Notably, LDH-dsRNA treatment in open boxes maintained efficacy in reducing rot development (incidence and severity) and did not change over the six-week storage period ( Fig.14A , 22A -22C and 23). However, LDH-dsRNA treatment in MAP (higher CO2 and humidity) showed a similar trend to dsRNA alone and its efficiency decreased with storage period, indicating that dsRNA is rapidly released from LDH ( Fig. 14B , 22D -22F and 23). Nevertheless, after six weeks of storage, LDH-dsRNA treatments in controlled atmosphere and normal atmosphere showed better decay control than dsRNA alone. These results suggest that storage packaging affects the dynamics of LDH-dsRNA stability.

[0237] Although the present invention has been described in conjunction with the specific embodiments of the present invention, it is apparent that various alternatives, modifications and variations will be apparent to those skilled in the art. Therefore, it is intended to cover all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

Claims

1. A method for treating or preventing a fungal infection in a plant or part thereof in need thereof, the method comprising applying to at least a part of the plant an effective amount of at least one double-stranded RNA (dsRNA) molecule comprising a nucleic acid sequence complementary to at least two transcripts transcribed from at least two essential genes of a fungus that causes the fungal infection, thereby treating or preventing the fungal infection in the plant or part thereof.

2. A method for treating or preventing a fungal infection in a plant or part thereof in need thereof, the method comprising applying to at least a part of the plant an effective amount of particles comprising: (i) at least one dsRNA molecule comprising a nucleic acid sequence complementary to at least two transcripts transcribed from at least two essential genes of a fungus that causes said fungal infection; and (ii) a layered double hydroxide (LDH), thereby treating or preventing fungal infection of the plant or part thereof.

3. The method of claim 2, wherein the particles comprise the at least one dsRNA molecule and the LDH in a mole / mole (m:m) ratio of 1:20 to 1:

80.

4. The method according to any one of claims 1 to 3, wherein the at least two essential genes are of the same pathway.

5. The method of claim 4, wherein the pathway is an ergosterol production pathway.

6. The method according to any one of claims 1 to 5, wherein the at least two essential genes are selected from the group consisting of: 3-hydroxy-3-methylglutaryl-CoA synthase (erg13), sterol 14-demethylase (CYP51) and squalene monooxygenase (erg1). 7 . The method of claim 6 , wherein the at least two essential genes include all three of egr13, CYP51 and erg1.

8. The method of any one of claims 1 to 7, wherein the at least one dsRNA molecule is 500 base pairs (bp) to 1,000 bp in length.

9. The method according to claim 7 or 8, wherein the at least one dsRNA molecule comprises a first RNA sequence derived from the erg13, followed by a second RNA sequence derived from the CYP51, followed by a third RNA sequence derived from the erg1.

10. The method according to claim 9, wherein the length of any one of the first RNA sequence, the second RNA sequence and the third RNA sequence is between 20 bp and 400 bp. 11 . The method according to claim 9 or 10 , wherein any one of the first RNA sequence, the second RNA sequence and the third RNA sequence has a complementarity level of 70% to 100% with erg13, CYP51 and erg1, respectively, or with transcripts thereof.

12. The method according to any one of claims 6 to 11, wherein the at least one dsRNA molecule comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 4-7.

13. The method according to any one of claims 1 to 12, wherein the fungus is selected from the phylum Ascomycota.

14. The method of claim 13, wherein the fungus belongs to a genus selected from the group consisting of Botrytis, Alternaria, Aspergillus, Blumeria, Cercospora, Colletotrichum, Geotrichum, Fusarium, Lasiodiplodia, Magnaporthe, Monilinia, Mycosphaerella, Penicillium, Phytophthora, Puccinia, Rhizophus, Rhizoctoniat, Sclerotinia, Ustilago, and any combination thereof.

15. The method according to any one of claims 1 to 14, wherein the applying is carried out by spraying, dipping or both.

16. The method of any one of claims 1 to 15, wherein the administering comprises multiple administrations.

17. The method of claim 16, wherein the multiple administrations are separated by 1 week to 4 weeks.

18. The method of any one of claims 1 to 17, further comprising co-applying a fungicide to the at least a portion of the plant in an amount that is at least 10% less than an effective amount of the fungicide when applied alone.

19. The method according to any one of claims 1 to 18, wherein the at least a portion of the plant comprises any one of the following: leaves, fruits, flowers, and any combination thereof.

20. The method of any one of claims 1 to 19, wherein the administering comprises postharvest administration.

21. The method of any one of claims 1 to 20, further comprising subjecting the at least a portion of the plant to at least one abiotic condition selected from the group consisting of: CO2 levels of 0.01% to 5%, relative humidity of 80% to 98%, and both.

22. The method of claim 21, wherein said subjecting is subsequent to said administering.

23. An antifungal composition comprising a plurality of particles, the plurality of particles comprising: a. at least one dsRNA molecule comprising a nucleic acid sequence complementary to at least one transcript of at least one essential gene of the fungus; and b.LDH.

24. The antifungal composition of claim 23, comprising at least one characteristic selected from the group consisting of: (i) an m:m ratio of magnesium to aluminum of 2 to 4; (ii) a zeta potential of 30 mV to 50 mV; and (iii) a particle size of 150 nm to 350 nm.

25. The antifungal composition according to claim 23 or 24, characterized in that At least one fungal activity can be reduced or inhibited for a period of 1 to 6 weeks.

26. An antifungal composition according to any one of claims 23 to 25, wherein the at least one essential gene encodes at least one protein involved in the ergosterol production pathway.

27. An antifungal composition according to any one of claims 23 to 26, wherein the at least one essential gene comprises three essential genes involved in the ergosterol production pathway.

28. The antifungal composition according to claim 27, wherein the three essential genes involved in the ergosterol production pathway are erg13, CYP51 and erg1.

29. The antifungal composition of any one of claims 23 to 28, wherein the at least one dsRNA molecule is 500 base pairs (bp) to 1,000 bp in length.

30. The antifungal composition of claim 28 or 29, wherein the at least one dsRNA molecule comprises a first RNA sequence derived from the erg13, followed by a second RNA sequence derived from the CYP51, followed by a third RNA sequence derived from the erg1.

31. The antifungal composition of claim 30, wherein the length of any one of the first RNA sequence, the second RNA sequence, and the third RNA sequence is between 20 bp and 400 bp.

32. The antifungal composition according to claim 30 or 31, wherein any one of the first RNA sequence, the second RNA sequence and the third RNA sequence has a complementarity level of 70% to 100% with erg13, CYP51 and erg1, or with transcripts thereof, respectively.

33. The antifungal composition of any one of claims 27 to 32, wherein the at least one dsRNA molecule comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 4-7.

34. The antifungal composition according to any one of claims 23 to 33, formulated for at least one route of application selected from the group consisting of spraying and dipping.

Images