Tau peptide immunogen constructs

Abstract

The present disclosure relates to single peptide immunogen constructs targeting a portion of a Tau protein for use in the treatment and / or prevention of tauopathies. The disclosure also relates to compositions containing the peptide immunogen constructs, methods of making and using the peptide immunogen constructs, and antibodies produced by the peptide immunogen constructs.

Description

Technical Field

[0001] The present disclosure relates to peptide immunogen constructs based on portions of Tau protein and their preparations for preventing and treating tauopathy. Background Art

[0002] Tau protein is present in large quantities in neurons of the central nervous system and plays a role in stabilizing microtubules. Neurological diseases and dementias such as Alzheimer's disease are associated with defects in Tau protein and the inability to properly stabilize microtubules. Other neurodegenerative diseases, called tauopathies, are characterized by the presence of abundant filamentous Tau. These diseases include tangle-only dementia, chronic traumatic encephalopathy (CTE), argyrophilic particle disease, progressive supranuclear palsy, corticobasal degeneration, globular glial tauopathy, and Pick's disease.

[0003] There is a need to develop Tau-directed therapeutics for treating patients with diseases such as Alzheimer's disease and tauopathies. Summary of the invention

[0004] The present disclosure relates to a single peptide immunogen construct targeting a portion of the Tau protein for treating and / or preventing tau pathology. The present disclosure also relates to compositions containing the peptide immunogen constructs, methods for preparing and using the peptide immunogen constructs, and antibodies generated by the peptide immunogen constructs.

[0005] The disclosed peptide immunogen construct contains about 15 or more amino acids. The peptide immunogen construct contains a B cell epitope from a portion of the longest isoform of the human Tau protein (GenBank: AGF19246.1), which has an amino acid sequence of SEQ ID NO: 167 shown in Table 3. The B cell epitope can be connected to a heterologous T helper cell (Th) epitope derived from a pathogen protein by an optional heterologous spacer. The disclosed peptide immunogen construct stimulates the production of highly specific antibodies against Tau. The disclosed peptide immunogen construct can be used as an immunotherapy for patients with tau pathology.

[0006] The B cell epitope portion of the peptide immunogen construct has an amino acid sequence from the full-length Tau protein (SEQ ID NO: 167). In some embodiments, the B cell epitope has or includes a sequence of any one of SEQ ID NOs: 1-8, 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135, and 137 as shown in Table 1 or one of Tables 4-7.

[0007] The peptide immunogen constructs disclosed herein may contain heterologous Th epitope amino acid sequences derived from pathogenic proteins as shown in Table 2 (e.g., SEQ ID NOs: 138-166). In some embodiments, the heterologous Th epitope consists of or comprises the sequence of SEQ ID NO: 151. In some embodiments, the heterologous Th epitope consists of or comprises the sequence of SEQ ID NO: 149 or 152. In certain embodiments, the heterologous Th epitope is derived from a natural pathogen, such as diphtheria toxin (SEQ ID NO: 142), Plasmodium falciparum (SEQ ID NO: 143), cholera toxin (SEQ ID NO: 145). In other embodiments, the heterologous Th epitope is an idealized artificial Th epitope derived from measles virus fusion protein (MVF 1 to 5) or hepatitis B surface antigen (HBsAg 1 to 3), in the form of a single sequence or a combined sequence (e.g., SEQ ID NO: 149, 148 or 150).

[0008] In some embodiments, the peptide immunogen construct contains a B cell epitope from Tau connected to a heterologous T helper cell (Th) epitope by an optional heterologous spacer. In certain embodiments, the peptide immunogen construct contains a B cell antigenic site having or comprising an amino acid sequence from Tau (e.g., any one of SEQ ID NOs: 1-8, 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135, and 137), which is connected to a heterologous Th epitope derived from a pathogenic protein (e.g., SEQ ID NOs: 138-166, e.g., 151, 152, or 149) by an optional heterologous spacer. In some embodiments, the optional heterologous spacer is a molecule or chemical structure capable of connecting two amino acids and / or peptides together. In certain embodiments, the spacer is a naturally occurring amino acid, a non-naturally occurring amino acid, or a combination thereof. In certain embodiments, the peptide immunogen construct has an amino acid sequence of one of SEQ ID NOs: 9-16 (eg, 10 or 15) shown in Table 1 (or a construct in which the positions of the Tau peptide and the Th peptide are reversed).

[0009] The present disclosure also relates to compositions containing Tau peptide immunogen constructs. In some embodiments, the disclosed compositions contain more than one Tau peptide immunogen construct to cover multiple B epitopes from Tau. In certain embodiments, the composition contains a mixture of Tau peptide immunogen constructs (e.g., any combination of SEQ ID NO: 9-16) and more than one heterologous Th epitope from a pathogenic protein to cover a wide range of genetic backgrounds of patients. Compositions containing a mixture of peptide immunogen constructs can result in a higher percentage of response rates when immunotherapy of tau protein pathology compared to compositions containing only a single Th peptide immunogen construct.

[0010] The present disclosure also relates to pharmaceutical compositions for treating and / or preventing tau pathology. In some embodiments, the pharmaceutical composition contains a disclosed peptide immunogen construct in the form of a stable immunostimulatory complex, which is formed by electrostatic association by mixing a CpG oligomer (e.g., CpG1, CpG2 or CpG3) with a composition containing a peptide immunogen complex. Such stable immunostimulatory complexes can further enhance the immunogenicity of the peptide immunogen construct. In some embodiments, the pharmaceutical composition contains an adjuvant, such as a mineral salt, including alum gel (ALHYDROGEL), aluminum phosphate (ADJUPHOS) or an oil-in-water emulsion, including MONTANIDE ISA51 or 720.

[0011] The present disclosure also relates to antibodies against the disclosed Tau peptide immunogen constructs. Specifically, the peptide immunogen constructs of the present disclosure are capable of stimulating the generation of highly specific antibodies that cross-react with Tau amino acid sequences (e.g., any one of SEQ ID NOs: 1-8, 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135, and 137) when administered to a subject. The highly specific antibodies produced by the peptide immunogen constructs cross-react with recombinant Tau-containing proteins. The disclosed antibodies bind to Tau with high specificity, but hardly to heterologous Th epitopes for enhancing immunogenicity, which is in sharp contrast to conventional proteins or other biological carriers used for enhancing the antigenicity of such peptides.

[0012] The present disclosure also includes the use of disclosed peptide immunogen constructs and / or antibodies for peptide immunogen constructs to treat and / or prevent tau pathology. In some embodiments, the method for treating and / or preventing tau pathology includes administering a composition containing a disclosed peptide immunogen construct to a host. In certain embodiments, the composition used in the method contains a disclosed peptide immunogen construct, which is in the form of a stable immunostimulatory complex, and the stable immunostimulatory complex has a negatively charged oligonucleotide (e.g., CpG oligomer), which is formed by electrostatic association, and the complex is further optionally supplemented with mineral salts or oil as an adjuvant, to be applied to a patient suffering from tau pathology. The disclosed method also includes administering a dosage regimen, a dosage form, and a route of administering a peptide immunogen construct to a host having a risk of tau pathology or suffering from tau pathology. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Schematic diagram showing the Th peptide carrier linked to a target-specific B-cell epitope (top) and the primary structure of tau with annotations of functional domains and targeting peptides (bottom).

[0014] Figure 2A and Figure 2B is a dot blot, a set of graphs, and a table showing the results of antibody binding characterization.

[0015] Figure 3A and Figure 3B is a set of graphs showing the results of aggregation assays performed using the Tau biosensor system.

[0016] Figure 4A and Figure 4B is a set of graphs showing the results of Tau uptake assays.

[0017] Figures 5A-5C are graphs and photographic images showing the results of vaccination of WT and P301L mice with p5555kb. Figure 6 Arrows in A indicate injections.

[0018] Figure 6 is a graph showing the immunogenicity of p5555kb and p5187 in rats.

[0019] Figure 7-10 is a series of graphs showing isotype analysis of antibodies produced in rats.

[0020] Fig.11 is a set of graphs showing the results of Tau aggregation assays. The left graph is guinea pig data and the right graph is rat data.

[0021] Fig.12 is a set of graphs showing the results of immunogenicity studies in mice. DETAILED DESCRIPTION

[0022] The present disclosure relates to a single peptide immunogen construct targeting a portion of the Tau protein for the treatment and / or prevention of Alzheimer's disease and tau pathology. The present disclosure also relates to compositions containing the peptide immunogen constructs, methods for preparing and using the peptide immunogen constructs, and antibodies generated by the peptide immunogen constructs.

[0023] The disclosed peptide immunogen construct contains about 15 or more amino acids. The peptide immunogen construct contains a B cell epitope (GenBank: AGF19246.1) from a portion of the longest isoform of the human Tau protein, which has the amino acid sequence shown in Table 3. The B cell epitope can be connected to a heterologous T helper cell (Th) epitope derived from a pathogen protein by an optional heterologous spacer. The disclosed peptide immunogen construct stimulates the production of highly specific antibodies against Tau. The disclosed peptide immunogen construct can be used as an immunotherapy for patients with Alzheimer's disease and / or tau pathology.

[0024] The B cell epitope portion of the peptide immunogen construct has an amino acid sequence from the full-length Tau protein (Table 3). In some embodiments, the B cell epitope has or includes the sequence of any one of the target sequences listed in Table 1 (SEQ ID NO: 1-8). In some embodiments, the B cell epitope has or includes a sequence of one of Tables 4-7 (e.g., any one of SEQ ID NOs: 17-137, such as a sequence of p5543a, p5546a, p5547a, p5555a, p5557a, p5558a, p5559a, p5564a, p5565a, p5566a, p5569a, p5695a, p5696, or p5535a, which are SEQ ID NOs: 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, and 129, respectively; or a sequence of p5556a, p5456a, p4579a, p5541a, or p4062a, which are SEQ ID NOs: 49, 35, 99, 135, and 137, respectively).

[0025] The peptide immunogen constructs disclosed herein may contain heterologous Th epitope amino acid sequences derived from pathogenic proteins (e.g., SEQ ID NOs: 138 to 166), which are shown in Table 2. In some embodiments, the Th epitope has or comprises a sequence of SEQ ID NOs: 151, 152, or 149. In certain embodiments, the heterologous Th epitope is derived from a natural pathogen, such as diphtheria toxin (SEQ ID NO: 142), Plasmodium falciparum (SEQ ID NO: 143), cholera toxin (SEQ ID NO: 145). In other embodiments, the heterologous Th epitope is an idealized artificial Th epitope derived from measles virus fusion protein (MVF 1 to 5) or hepatitis B surface antigen (HBsAg 1 to 3), in the form of a single sequence or a combined sequence (e.g., SEQ ID NOs: 149, 148, or 150).

[0026] In some embodiments, the peptide immunogen construct contains a B cell epitope from Tau linked to a heterologous T helper cell (Th) epitope via an optional heterologous spacer. In certain embodiments, the peptide immunogen construct contains a B cell antigenic site having or comprising an amino acid sequence from Tau (see, e.g., Table 1 (one of SEQ ID NOs: 1-8) and Tables 4-7 (e.g., one of SEQ ID NOs: 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135, and 137), which is linked to a heterologous Th epitope derived from a pathogenic protein (e.g., SEQ ID NOs: 138 to 166, e.g., 151, 152, or 149) via an optional heterologous spacer. In some embodiments, the optional heterologous spacer is a molecule or chemical structure capable of linking two amino acids and / or peptides together. In certain embodiments, the spacer is a naturally occurring amino acid, a non-naturally occurring amino acid, or a combination thereof. In a specific embodiment, the peptide immunogen construct has an amino acid sequence shown in Table 1 (e.g., SEQ ID NOs: 138 to 166, e.g., 151, 152, or 149). NO: 9-16 (eg, 10 or 15) or a construct in which the positions of the Tau peptide and the Th epitope are reversed).

[0027] The present disclosure also relates to compositions containing Tau peptide immunogen constructs. In some embodiments, the disclosed compositions contain more than one Tau peptide immunogen construct to cover multiple B epitopes from Tau. In certain embodiments, the composition contains a mixture of Tau peptide immunogen constructs and more than one heterologous Th epitope derived from a pathogenic protein to cover a wide range of genetic backgrounds of patients. Compositions containing a mixture of peptide immunogen constructs can result in a higher percentage of response rates when immunotherapy is used to treat Alzheimer's disease and / or tau pathology compared to compositions containing only a single peptide immunogen construct.

[0028] The present disclosure also relates to pharmaceutical compositions for treating and / or preventing Alzheimer's disease and / or tau pathology. In some embodiments, the pharmaceutical composition contains a disclosed peptide immunogen construct in the form of a stable immunostimulatory complex, which is formed by electrostatic association by mixing a CpG oligomer with a composition containing the peptide immunogen complex. Such stable immunostimulatory complexes can further enhance the immunogenicity of the peptide immunogen construct. In some embodiments, the pharmaceutical composition contains an adjuvant, such as a mineral salt, including alum gel (ALHYDROGEL), aluminum phosphate (ADJUPHOS) or an oil-in-water emulsion, including MONTANIDE ISA51 or 720.

[0029] The present disclosure also relates to antibodies against the disclosed Tau peptide immunogen constructs. Specifically, the peptide immunogen constructs of the present disclosure are capable of stimulating the generation of highly specific antibodies that cross-react with Tau amino acid sequences when administered to a subject. The highly specific antibodies produced by the peptide immunogen constructs cross-react with recombinant Tau-containing proteins. The disclosed antibodies bind to Tau with high specificity, but hardly to heterologous Th epitopes for enhancing immunogenicity, which is in sharp contrast to conventional proteins or other biological carriers used for enhancing the antigenicity of such peptides.

[0030] The present disclosure also includes the method for treating and / or preventing Alzheimer's disease and / or tau pathology using disclosed peptide immunogen constructs and / or antibodies directed to peptide immunogen constructs. In some embodiments, the method for treating and / or preventing Alzheimer's disease and / or tau pathology includes administering a composition containing a disclosed peptide immunogen construct to a host. In certain embodiments, the composition used in the method contains a disclosed peptide immunogen construct, and the peptide immunogen construct is in the form of a stable immunostimulatory complex, and the stable immunostimulatory complex has a negatively charged oligonucleotide (e.g., CpG oligomer), which is formed by electrostatic association, and the complex is further optionally supplemented with mineral salts or oil as an adjuvant, to be applied to a patient suffering from Alzheimer's disease and / or tau pathology. The disclosed method also includes administering a dosage regimen, a dosage form, and a route of administering a peptide immunogen construct to a host having a risk of tau pathology or suffering from Alzheimer's disease and / or tau pathology.

[0031] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.All references, or portions of references, cited in this application are expressly incorporated herein by reference in their entirety for all purposes.

[0032] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Unless the context clearly indicates otherwise, the singular forms "a / an" and "the / said" include multiple indicators. Similarly, unless the context clearly indicates otherwise, the word "or" is intended to include "and". Therefore, "comprising A or B" means including A or B, or A and B. It should also be understood that all amino acid sizes of the polypeptides given and all molecular weights or molecular weight values ​​are approximate and are only used for description. Although methods and materials similar or equivalent to the methods and materials described herein can be used in the practice or testing of the disclosed methods, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, this specification (including term explanation) shall prevail. In addition, materials, methods and examples are illustrative only and are not intended to be limiting.

[0033] Tau peptide immunogen constructs

[0034] The present disclosure provides peptide immunogen constructs containing a B cell epitope having an amino acid sequence from Tau covalently linked directly or through an optional heterologous spacer to a heterologous T helper cell (Th) epitope.

[0035] As used herein, the phrases "Tau peptide immunogen construct" or "peptide immunogen construct" refer to a peptide containing: (a) a B cell epitope having about 8 or more amino acid residues (e.g., about 8-40, 9-30, 10-25, 8-20, 9-18, or 10-15; or about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids) from the full length sequence of the longest Tau isoform (SEQ ID NO: 167); (b) a heterologous Th epitope; and (c) an optional heterologous spacer.

[0036] In certain embodiments, the Tau peptide immunogen construct can be represented by the following formula:

[0037] (Th) m –(A) n –(Tau fragment)–X

[0038] or

[0039] (Tau fragment) – (A) n –(Th) m –X

[0040] in

[0041] Th is a heterologous T helper epitope;

[0042] A is a heterologous spacer;

[0043] (Tau fragment) is a B cell epitope having about 8 to about 40 amino acid residues (e.g., about 8-40, 9-30, 10-25, 8-20, 9-18, or 10-15; or about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids) from SEQ ID NO: 167;

[0044] X is α-COOH or α-CONH2 of an amino acid;

[0045] m is from 1 to about 4; and

[0046] n is 0 to about 10.

[0047] The various components of the disclosed Tau peptide immunogen constructs are described below.

[0048] a. Tau fragment

[0049] The disclosed peptide immunogen construct contains about 8 or more amino acids. The peptide immunogen construct contains a B cell epitope from a portion of the longest isoform of the human Tau protein (GenBank: AGF19246.1), which has an amino acid sequence of SEQ ID NO: 167 shown in Table 3. The B cell epitope can be connected to a heterologous T helper cell (Th) epitope derived from a pathogen protein by an optional heterologous spacer. The disclosed peptide immunogen construct stimulates the production of highly specific antibodies against Tau. The disclosed peptide immunogen construct can be used as an immunotherapy for patients with Alzheimer's disease and / or tauopathy.

[0050] The B cell epitope portion of the peptide immunogen construct has an amino acid sequence from the full-length Tau protein (SEQ ID NO: 167). In some embodiments, the B cell epitope has or comprises a sequence as shown in Table 1 (one of SEQ ID NOs: 1-8) or Tables 4-7 (e.g., one of SEQ ID NOs: 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135, and 137).

[0051] In some embodiments, the Tau peptide of the peptide immunogen construct comprises or consists of a peptide of any one of Tables 1 and 4-7.

[0052] In some embodiments, the Tau peptide of the peptide immunogen construct comprises or consists of a peptide of any one of Table 1 and Tables 4-7, wherein the peptide includes 1, 2, 3, 4, or 5 additional amino acids of the Tau protein of SEQ ID NO: 167 at the N-terminus of the peptide of Table 1 or Tables 4-7. In some embodiments, the Tau peptide of the peptide immunogen construct comprises or consists of a peptide of any one of Table 1 and Tables 4-7, wherein the peptide includes 1, 2, 3, 4, or 5 additional amino acids of the Tau protein of SEQ ID NO: 167 at the C-terminus of the peptide of Table 1 or Tables 4-7. In some embodiments, the Tau peptide of the peptide immunogen construct comprises or consists of a peptide of any one of Table 1 and Tables 4-7, wherein the peptide includes 1, 2, 3, 4, or 5 additional amino acids of the Tau protein of SEQ ID NO: 167 at the N-terminus and / or C-terminus of the peptide of Table 1 or Tables 4-7. The additional amino acids in the latter peptide are understood to be those amino acids of the Tau protein of SEQ ID NO: 167 adjacent to the peptide sequence of Tables 1 and 4-7.

[0053] In some embodiments, the Tau peptide of the peptide immunogen construct comprises or consists of about 8 to about 40 amino acid residues from SEQ ID NO: 167 (e.g., about 8-40, 9-30, 10-25, 8-20, 9-18, or 10-15; or about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids). In some embodiments, the Tau peptide of the peptide immunogen construct is or comprises any of the peptides in Tables 1 and 4-7, such as any of SEQ ID NOs: 1-8, 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135, and 137, wherein optionally the peptide has one or more of the additional amino acids described above.

[0054] b. Heterologous T helper cell epitopes (Th epitopes)

[0055] The present disclosure provides peptide immunogen constructs containing a B cell epitope from Tau covalently linked directly or through an optional heterologous spacer to a heterologous T helper cell (Th) epitope.

[0056] The heterologous Th epitopes in the Tau peptide immunogen constructs enhance the immunogenicity of Tau fragments, which is beneficial for generating specific high-titer antibodies against optimized target B cell epitopes (i.e., Tau fragments) through rational design.

[0057] The term "heterologous" as used herein refers to an amino acid sequence derived from an amino acid sequence that is not part of or not homologous to the wild-type sequence of Tau. Therefore, a heterologous Th epitope is a Th epitope derived from an amino acid sequence that is not naturally present in Tau (i.e., the Th epitope is not Tau self-derived). Since the Th epitope is heterologous to Tau, when the heterologous Th epitope is covalently linked to the Tau fragment, the native amino acid sequence of Tau does not extend in the N-terminal or C-terminal direction.

[0058] The heterologous Th epitope disclosed herein can be any Th epitope that does not have an amino acid sequence naturally present in Tau. The Th epitope can have an amino acid sequence derived from any species (e.g., humans, pigs, cattle, dogs, rats, mice, guinea pigs, etc.). The Th epitope can also have a promiscuous binding motif with MHC class II molecules of multiple species. In certain embodiments, the Th epitope comprises a plurality of promiscuous MHC class II binding motifs to allow maximum activation of T helper cells, thereby initiating and regulating immune responses. The Th epitope is preferably immunologically silent itself, that is, the antibodies generated by the Tau peptide immunogen construct, if any, are rarely directed against the Th epitope, thereby allowing a very concentrated immune response to the targeted B cell epitope of the Tau fragment.

[0059] Epitopes of the present disclosure include, but are not limited to, amino acid sequences derived from foreign pathogens, as exemplified in Table 2 (SEQ ID NO: 138 to 166, such as 151, 152 or 149). Further, Th epitopes include idealized artificial Th epitopes and combined idealized artificial Th epitopes (e.g., SEQ ID NO: 139 and 146-152). Heterologous Th epitope peptides presented in a combined sequence (e.g., SEQ ID NO: 147-150) contain a mixture of amino acid residues represented by a specific position within the peptide framework based on the variable residues of the homologs of the specific peptide. By adding a mixture of specified protective amino acids (rather than a specific amino acid) at a specified position during the synthesis process, an assembly of combined peptides can be synthesized in one process. This combined heterologous Th epitope peptide assembly can provide a wide range of Th epitope coverage for animals with diverse genetic backgrounds. Representative combined sequences of heterologous Th epitope peptides include SEQ ID NO: 147-150 as shown in Table 2. The epitope peptides of the present invention provide a wide range of reactivity and immunogenicity for animals and patients from genetically diverse populations.

[0060] Tau peptide immunogen constructs containing Th epitopes are simultaneously produced in tandem with Tau fragments in a single solid phase peptide synthesis. Th epitopes also include immunological analogs of Th epitopes. Immunological Th analogs include immunopotentiating analogs, cross-reactive analogs, and fragments of any one Th epitope that are sufficient to enhance or stimulate an immune response to Tau fragments.

[0061] Functional immunological analogs of Th epitope peptides are also effective and are included as part of the present invention. Functional immunological Th analogs can include conservative substitutions, additions, deletions and insertions of one to about five amino acid residues in the Th epitope, and these conservative substitutions, additions, deletions and insertions will not substantially change the Th stimulating function of the Th epitope. Conservative substitutions, additions and insertions can be achieved by natural or non-natural amino acids, as described above for Tau fragments. Table 2 shows another variant of the functional analogs of Th epitope peptides. Specifically, SEQ ID NOs: 139 and 146 of MvF1 and MvF2 Th are functional analogs of SEQ ID NOs: 149 and 151 of MvF4 and MvF5, because their differences in the amino acid framework are that two amino acids are deleted (SEQ ID NOs: 139 and 146) or included (SEQ ID NOs: 149 and 151) at the N-terminus and C-terminus. The difference between these two series of similar sequences will not affect the function of the Th epitopes contained in these sequences. Thus, functional immunological Th analogs include several types of Th epitopes derived from measles virus fusion protein MvF1-4 Ths (SEQ ID NOs: 139, 146, 147, 149 and 151) and hepatitis surface protein HBsAg 1-3 Ths (SEQ ID NOs: 148, 150 and 152).

[0062] The Th epitope in the Tau peptide immunogen construct can be covalently linked to the N-terminus or C-terminus of the Tau peptide. In some embodiments, the Th epitope is covalently linked to the N-terminus of the Tau peptide. In other embodiments, the Th epitope is covalently linked to the C-terminus of the Tau peptide. In certain embodiments, more than one Th epitope is covalently linked to the Tau fragment. When more than one Th epitope is linked to the Tau fragment, each Th epitope may have the same amino acid sequence or may have a different amino acid sequence. In addition, when more than one Th epitope is linked to the Tau fragment, the Th epitope may be arranged in any order. For example, the Th epitope may be continuously linked to the N-terminus of the Tau fragment, or continuously linked to the C-terminus of the Tau fragment, or the Th epitope may be covalently linked to the N-terminus of the Tau fragment, and a separate Th epitope is covalently linked to the C-terminus of the Tau fragment. With respect to the Tau fragment, there is no restriction on the arrangement of the Th epitope. For the immunogenic constructs shown in Table 1, it should be understood that the present disclosure includes corresponding immunogenic constructs in which the positions of the Tau peptide and the Th epitope are opposite to the directions shown in Table 1.

[0063] In some embodiments, the Th epitope is covalently linked directly to the Tau fragment. In other embodiments, the Th epitope is covalently linked to the Tau fragment via a heterologous spacer as described in further detail below.

[0064] c. Heterologous spacer

[0065] The disclosed Tau peptide immunogen constructs optionally contain a heterologous spacer that covalently links the B cell epitope of Tau to a heterologous T helper cell (Th) epitope.

[0066] As discussed herein, the term "heterologous" refers to an amino acid sequence that is derived from an amino acid sequence that is not part of or homologous to the wild-type sequence of Tau. Thus, when a heterologous spacer is covalently linked to a B-cell epitope from Tau, the native amino acid sequence of Tau is not extended in the N-terminal or C-terminal direction because the spacer is heterologous to the Tau sequence.

[0067] A spacer is any molecule or chemical structure capable of linking two amino acids and / or peptides together. The length or polarity of the spacer may vary depending on the application. Spacers may be linked by amide linkages or carboxyl linkages, but other functionalities are also possible. Spacers may include chemical compounds, naturally occurring amino acids, or non-naturally occurring amino acids.

[0068] Spacers can provide structural properties for Tau peptide immunogen constructs. Structurally, spacers physically separate Th epitopes from B cell epitopes of Tau fragments. Any artificial secondary structure generated by the engagement of Th epitopes and B cell epitopes can be destroyed by the physical separation of spacers. In addition, the physical separation of epitopes by spacers can eliminate interference between Th cell and / or B cell responses. In addition, spacers can be designed to produce or modify the secondary structure of peptide immunogen constructs. For example, spacers can be designed as flexible hinges to enhance the separation of Th epitopes and B cell epitopes. Flexible hinge spacers can also allow for more effective interactions between the presented peptide immunogens and appropriate Th cells and B cells to enhance immune responses to Th epitopes and B cell epitopes. Examples of sequences encoding flexible hinges can be found in the hinge region of immunoglobulin heavy chains, which are typically rich in proline. One particularly useful flexible hinge that can be used as a spacer is provided by the sequence Pro-Pro-Xaa-Pro-Xaa-Pro (SEQ ID NO: 168), where Xaa is any amino acid, and is preferably aspartic acid.

[0069] The spacer can also provide functional properties to the Tau peptide immunogen construct. For example, the spacer can be designed to change the overall charge of the Tau peptide immunogen construct, which can affect the solubility of the peptide immunogen construct. In addition, changing the overall charge of the Tau peptide immunogen construct will affect the ability of the peptide immunogen construct to associate with other compounds and reagents. As discussed in further detail below, the Tau peptide immunogen construct can form a stable immunostimulatory complex with a highly charged oligonucleotide (e.g., a CpG oligomer) through electrostatic association. The overall charge of the Tau peptide immunogen construct is important for the formation of these stable immunostimulatory complexes.

[0070] Compounds that can be used as spacers include, but are not limited to: (2-aminoethoxy)acetic acid (AEA), 5-aminovaleric acid (AVA), 6-aminohexanoic acid (Ahx), 8-amino-3,6-dioxaoctanoic acid (AEEA, mini-PEG1), 12-amino-4,7,10-trioxadodecanoic acid (mini-PEG2), 15-amino-4,7,10,13-tetraoxapentadecanoic acid (mini-PEG3), trioxatridecanoic acid (Ttds), 12-amino-dodecanoic acid, Fmoc-5-amino-3-oxavalacic acid (O1Pen), etc.

[0071] Naturally occurring amino acids include alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

[0072] Non-naturally occurring amino acids include, but are not limited to, ε-N lysine, β-alanine, ornithine, norleucine, norvaline, hydroxyproline, thyroxine, γ-aminobutyric acid, homoserine, citrulline, aminobenzoic acid, 6-aminocaproic acid (Aca; 6-aminohexanoic acid), hydroxyproline, mercaptopropionic acid (MPA), 3-nitro-tyrosine, pyroglutamic acid, and the like.

[0073] The Th spacer in the Tau peptide immunogen construct can be covalently linked to the Th epitope and the N-terminus or C-terminus of the Tau peptide. In some embodiments, the spacer is covalently linked to the C-terminus of the Th epitope and the N-terminus of the Tau peptide. In other embodiments, the spacer is covalently linked to the C-terminus of the Tau peptide and the N-terminus of the Th epitope. In certain embodiments, more than one spacer can be used, for example, when there is more than one Th epitope in the peptide immunogen construct. When more than one spacer is used, each spacer can be the same or different from each other. In addition, when there is more than one Th epitope in the peptide immunogen construct, the Th epitope can be separated by a spacer, which can be the same or different from the spacer used to separate the Th epitope from the B cell epitope. With respect to Th epitopes or Tau fragments, there is no restriction on the arrangement of the spacer.

[0074] In certain embodiments, the heterologous spacer is a naturally occurring amino acid or a non-naturally occurring amino acid. In other embodiments, the spacer contains more than one naturally occurring or non-naturally occurring amino acid. In a specific embodiment, the spacer is Lys-, Gly-, Lys-Lys-Lys-, (α, ε-N)Lys or ε-N-Lys-Lys-Lys-Lys (SEQ ID NO: 169).

[0075] d. Specific Embodiments of Tau Peptide Immunogen Constructs

[0076] The Tau peptide immunogen construct can be represented by the following formula:

[0077] (Th) m –(A) n –(Tau fragment)–X

[0078] or

[0079] (Tau fragment) – (A) n –(Th) m –X

[0080] in

[0081] Th is a heterologous T helper epitope;

[0082] A is a heterologous spacer;

[0083] (Tau fragment) is a B cell epitope having about 8 to about 40 amino acid residues (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 amino acids) from the full-length Tau protein of SEQ ID NO: 167;

[0084] X is α-COOH or α-CONH2 of an amino acid;

[0085] m is from 1 to about 4; and

[0086] n is 0 to about 10.

[0087] In certain embodiments, the heterologous Th epitope in the Tau peptide immunogen construct has an amino acid sequence selected from any one of the amino acid sequences shown in Table 2. In certain embodiments, the Tau peptide immunogen construct contains more than one Th epitope.

[0088] In certain embodiments, the optional heterologous spacer is selected from any one of Lys-, Gly-, Lys-Lys-Lys-, (α,ε-N)Lys, ε-N-Lys-Lys-Lys-Lys (SEQ ID NO: 169), and combinations thereof. In a specific embodiment, the heterologous spacer is ε-N-Lys-Lys-Lys-Lys (SEQ ID NO: 169).

[0089] In certain embodiments, the Tau fragment has about 8 to about 40 (e.g., 10-30, 10-25, 12-20, or 12-15) amino acid residues from the full-length Tau protein of SEQ ID NO: 167. In specific embodiments, the Tau fragment has an amino acid sequence set forth in Table 1 (one of SEQ ID NOs: 1-8) or one of Tables 4-7 (e.g., one of SEQ ID NOs: 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135, and 137).

[0090] In some embodiments, the tau peptide immunogen construct is selected from the group consisting of:

[0091]

[0092] In some embodiments, the T cell epitope of any one of SEQ ID NOs: 9-16 (e.g., 10 or 15) is replaced by a T cell epitope of any one of SEQ ID NOs: 138-166. In some embodiments, the positions of the B cell epitope and the T cell epitope of any one of SEQ ID NOs: 9-16 (e.g., 10 or 15) are reversed within the molecule (i.e., if the B cell epitope is at the N-terminus of the original molecule, it is placed at the C-terminus of the molecule in the reversed molecule, etc.).

[0093] a. Variants, homologues and functional analogs

[0094] Variants and analogs of the above-mentioned immunogenic peptides that induce antibodies against preferred epitopes of Tau proteins and / or cross-react with the antibodies can also be used. Analogs, including alleles, species, and induced variants, are usually different from naturally occurring peptides at one, two, or several positions, usually due to conservative substitutions. Analogs typically exhibit at least 80% or 90% sequence identity with natural peptides. Some analogs also include non-natural amino acids or modifications of the N-terminal or C-terminal amino acids at one, two, or several positions.

[0095] Variants that are functional analogs may have conservative substitutions at amino acid positions; changes in overall charge; covalent linkage to another moiety; or amino acid additions, insertions or deletions; and / or any combination thereof.

[0096] Conservative substitutions refer to substitutions of one amino acid residue by another amino acid residue having similar chemical properties. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

[0097] In a specific embodiment, the functional analog has at least 50% identity with the original amino acid sequence. In another embodiment, the functional analog has at least 80% identity with the original amino acid sequence. In yet another embodiment, the functional analog has at least 85% identity with the original amino acid sequence. In yet another embodiment, the functional analog has at least 90% identity with the original amino acid sequence.

[0098] Variants also include variations of phosphorylated residues. For example, variants may include different residues within phosphorylated peptides. Variant immunogenic Tau peptides may also include pseudo-phosphorylated peptides. Pseudo-phosphorylated peptides are generated by replacing one or more of the phosphorylated serine, threonine and tyrosine residues of the Tau peptide with acidic amino acid residues (e.g., glutamic acid and aspartic acid).

[0099] Composition

[0100] The present disclosure also provides compositions comprising the disclosed Tau immunogenic constructs.

[0101] a. Peptide Composition

[0102] The composition containing the disclosed Tau peptide immunogen construct can be in liquid or solid form. The liquid composition can include water, buffer, solvent, salt and / or any other acceptable agent, as long as it does not change the structural or functional properties of the Tau peptide immunogen construct. The peptide composition can contain one or more disclosed Tau peptide immunogen constructs.

[0103] b. Pharmaceutical Compositions

[0104] The present disclosure also relates to pharmaceutical compositions containing the disclosed Tau peptide immunogen constructs.

[0105] The pharmaceutical composition may contain a carrier and / or other additives in a pharmaceutically acceptable delivery system. Therefore, the pharmaceutical composition may contain a pharmaceutically effective amount of a Tau peptide immunogen construct and a pharmaceutically acceptable carrier, adjuvant and / or other excipient, such as a diluent, additive, stabilizer, preservative, solubilizer, buffer, etc.

[0106] The pharmaceutical composition may contain one or more adjuvants that can be used to accelerate, prolong or enhance the immune response to the Tau peptide immunogen construct without having any specific antigenic effect itself. Adjuvants used in pharmaceutical compositions may include oils, aluminum salts, virosomes, aluminum phosphates (e.g., ADJU- ), aluminum hydroxide (e.g. ), Lebuxin, saponin, squalene, L121, Monophosphoryl lipid A (MPL), QS21, ISA35, ISA206, ISA50V, ISA51, ISA720, and other adjuvants and emulsifiers.

[0107] In some embodiments, the pharmaceutical composition contains MONTANIDE TM ISA 51 (oil adjuvant composition consisting of vegetable oil and mannide oleate for the production of water-in-oil emulsions), 80 (also known as: polysorbate 80 or polyoxyethylene (20) sorbitan monooleate), CpG oligonucleotides and / or any combination thereof. In other embodiments, the pharmaceutical composition is a water-in-oil-in-water (i.e., w / o / w) emulsion, wherein Emulsigen or Emulsigen D is used as an adjuvant.

[0108] The pharmaceutical composition can be formulated into a rapid release formulation or a sustained release formulation. In addition, the pharmaceutical composition can be formulated to induce systemic or local mucosal immunity by immunogen encapsulation and co-administration with microparticles. Such delivery systems can be easily determined by those of ordinary skill in the art.

[0109] The pharmaceutical composition can be prepared as an injection as a liquid solution or suspension. A liquid vehicle containing a Tau peptide immunogen construct can also be prepared before injection. The pharmaceutical composition can be administered by any suitable application method, for example, id, iv, ip, im, intranasal, oral, subcutaneous, etc., and by any suitable delivery device. In certain embodiments, the pharmaceutical composition is prepared for intravenous, subcutaneous, intradermal or intramuscular administration. Pharmaceutical compositions suitable for other modes of administration can also be prepared, including oral and intranasal administration.

[0110] The pharmaceutical composition can be formulated into a rapid release formulation or a sustained release formulation. In addition, the pharmaceutical composition can be formulated to induce systemic or local mucosal immunity by immunogen encapsulation and co-administration with microparticles. Such delivery systems can be easily determined by those of ordinary skill in the art.

[0111] The pharmaceutical composition can also be formulated into a suitable dosage unit form. In some embodiments, the pharmaceutical composition contains about 0.5 μg to about 1 mg of Tau peptide immunogen construct per kilogram of body weight. The effective dose of the pharmaceutical composition varies according to many different factors, including the mode of administration, the target site, the physiological state of the patient, whether the patient is a human or an animal, other drugs administered, and whether the treatment is preventive or therapeutic. Typically, the patient is a human, but non-human mammals, including transgenic mammals, can also be treated. When delivered in multiple doses, the pharmaceutical composition can be conveniently divided into appropriate amounts per dosage unit form. As is well known in the therapeutic field, the dosage administered will depend on the age, weight, and overall health of the subject.

[0112] In some embodiments, the pharmaceutical composition contains more than one Tau peptide immunogen construct. A pharmaceutical composition containing a mixture of more than one Tau peptide immunogen construct to allow for synergistic enhancement of the immunological efficacy of the construct. Due to the broad MHC class II coverage, pharmaceutical compositions containing more than one Tau peptide immunogen construct can be more effective in a larger genetic population, thereby providing an improved immune response to the Tau peptide immunogen construct.

[0113] In some embodiments, the pharmaceutical composition contains a Tau peptide immunogen construct shown in Table 1, and homologs, analogs and / or combinations thereof. In some embodiments, the pharmaceutical composition contains a Tau peptide immunogen construct, including a Tau peptide from Table 1 and one of Tables 4-7.

[0114] Pharmaceutical compositions containing Tau peptide immunogen constructs can be used to elicit an immune response and produce antibodies in a host upon administration.

[0115] c. Immunostimulatory complex

[0116] The present disclosure also relates to pharmaceutical compositions containing Tau peptide immunogen constructs in the form of immunostimulatory complexes with CpG oligonucleotides. Such immunostimulatory complexes are particularly suitable for use as adjuvants and peptide immunogen stabilizers. The immunostimulatory complex is in the form of microparticles, which can effectively present the Tau peptide immunogen to immune system cells to produce an immune response. The immunostimulatory complex can be formulated into a suspension for parenteral administration. The immunostimulatory complex can also be formulated in the form of a w / o emulsion, a suspension combined with a mineral salt or an in situ gelling polymer, so as to effectively deliver the Tau peptide immunogen to the host's immune system cells after parenteral administration.

[0117] Stable immunostimulatory complexes can be formed by complexing Tau peptide immunogen constructs with anionic molecules, oligonucleotides, polynucleotides, or combinations thereof through electrostatic association. Stable immunostimulatory complexes can be incorporated into pharmaceutical compositions as immunogen delivery systems.

[0118] In certain embodiments, the Tau peptide immunogen construct is designed to contain a cationic portion that is positively charged at a pH range of 5.0 to 8.0. The net charge of the cationic portion of the Tau peptide immunogen construct or construct mixture is calculated by assigning a +1 charge to each lysine (K), arginine (R) or histidine (H), a -1 charge to each aspartic acid (D) or glutamic acid (E), and a 0 charge to the other amino acids in the sequence. The charges within the cationic portion of the Tau peptide immunogen construct are added and expressed as a net average charge. Suitable peptide immunogens have cationic portions with a net average positive charge of +1. Preferably, the peptide immunogen has a net positive charge greater than +2. In some embodiments, the cationic portion of the Tau peptide immunogen construct is a heterologous spacer. In certain embodiments, when the spacer sequence is (α, ε-N)Lys, ε-N-Lys-Lys-Lys-Lys (SEQ ID NO: 169), the cationic portion of the Tau peptide immunogen construct is charged with +4.

[0119] "Anionic molecule" as described herein refers to any molecule with a negative charge in the range of pH 5.0-8.0. In certain embodiments, the anionic molecule is an oligomer or polymer. The net negative charge on the oligomer or polymer is calculated by assigning a -1 charge to each phosphodiester or thiophosphate group in the oligomer. Suitable anionic oligonucleotides are single-stranded DNA molecules with 8 to 64 nucleotide bases, wherein the number of repetitions of the CpG motif is in the range of 1 to 10. Preferably, the CpG immunostimulatory single-stranded DNA molecule contains 18-48 nucleotide bases, wherein the number of repetitions of the CpG motif is in the range of 3 to 8.

[0120] More preferably, the anionic oligonucleotide is represented by the following formula: 5'X 1 CGX 2 3', where C and G are unmethylated; and X 1 is selected from the group consisting of A (adenine), G (guanine) and T (thymine); and X 2 is C (cytosine) or T (thymine). Alternatively, the anionic oligonucleotide is represented by the following formula: 5'(X 3 )2CG(X 4 )2 3', wherein C and G are not methylated; and X 3 is selected from the group consisting of A, T or G; and X 4 It is C or T.

[0121] In some embodiments, the CpG oligonucleotide is as described in WO 03 / 068169, the contents of which are incorporated by reference. In some embodiments, the CpG comprises or consists of the following sequence: CpG1 (tcgtcgtttt gtcgttttgtcgttttgtcgtttgtcg tt; SEQ ID NO: 170), CpG2 (tcgtcgtttt gtcgttttgt cgtt; SEQ ID NO: 171) or CpG3 (tcgtcgtttt gtcgttttgt cgtt; SEQ ID NO: 173). In some embodiments, the CpG oligonucleotide (e.g., CpG1, CpG2 or CpG3) is a phosphorothioate oligonucleotide.

[0122] The immunostimulatory complexes produced are in the form of particles whose size is generally in the range of 1-50 microns and varies with many factors, including the charge stoichiometry and molecular weight of the relative interacting substances. Microparticulate immunostimulatory complexes have the advantage of providing adjuvants and upregulating specific immune responses in vivo. In addition, the stable immunostimulatory complexes are suitable for preparing pharmaceutical compositions by various processes, including water-in-oil emulsions, mineral salt suspensions, and polymer gels.

[0123] Antibody

[0124] The present disclosure also provides antibodies elicited by Tau peptide immunogen constructs.

[0125] The disclosed Tau peptide immunogen construct comprises a Tau fragment, a heterologous Th epitope and an optional heterologous spacer, and is capable of eliciting an immune response and producing antibodies when administered to a host. The design of the Tau peptide immunogen construct can break tolerance to self-Tau and induce the production of site-specific antibodies that recognize conformational rather than linear epitopes.

[0126] Antibodies generated by Tau peptide immunogen constructs recognize and bind to monomeric, dimer, trimer, and oligomeric forms of Tau.

[0127] Antibodies elicited by Tau peptide immunogen constructs surprisingly can prevent Tau aggregation (anti-aggregation activity) and can dissociate preformed Tau aggregates (disaggregation activity).

[0128] The immune responses generated by animals immunized with the Tau peptide immunogen constructs of the present invention demonstrate that the constructs are capable of generating effective site-directed antibodies that react with monomeric, dimer, trimer, and oligomeric forms of Tau.

[0129] method

[0130] The present disclosure also relates to methods of making and using Tau peptide immunogen constructs, compositions, and pharmaceutical compositions.

[0131] a. Methods for making Tau peptide immunogen constructs

[0132] The Tau peptide immunogen constructs disclosed herein can be prepared by chemical synthesis methods well known to ordinary technicians (see, for example, Fields et al., Synthetic Peptides: A User's Guide Chapter 3, ed. Grant, WH Freeman & Co., New York, NY, 1992, p. 77). Tau peptide immunogen constructs can be synthesized using automated Merrifield solid phase synthesis technology (wherein α-NH2 is protected by t-Boc or F-moc chemistry using side chain protected amino acids) on, for example, Applied Biosystems peptide synthesizer model 430A or 431. By providing a mixture of alternative amino acids for coupling at a given variable position, Tau peptide immunogen constructs containing combinatorial library peptides of Th epitopes can be prepared.

[0133] After the desired Tau peptide immunogen construct is fully assembled, the resin can be treated according to standard procedures to cleave the peptide from the resin and to unblock the functional groups on the amino acid side chains. The free peptide can be purified by HPLC and characterized biochemically, such as by amino acid analysis or sequencing. Methods for purification and characterization of peptides are well known to those of ordinary skill in the art. The quality of the peptides produced by this chemical process can be controlled and defined, thereby ensuring the reproducibility, immunogenicity and yield of the Tau peptide immunogen construct.

[0134] The range of structural variation that allows retention of the intended immunological activity has been found to be more adaptable than the range of structural variation that allows retention of specific drug activity for small molecule drugs or the range of structural variation that allows retention of the desired activity and undesired toxicity found in macromolecules co-produced with bioderived drugs. Thus, peptide analogs (whether intentionally designed or unavoidably produced due to errors in the synthetic process) that are mixtures of deleted sequence byproducts that have similar chromatographic and immunological properties to the intended peptide are often as effective as purified preparations of the intended peptide. Both designed analogs and unintended analog mixtures are effective as long as a rigorous QC program is implemented to monitor the manufacturing process and product evaluation process to ensure the reproducibility and efficacy of the final product using these peptides.

[0135] Tau peptide immunogen constructs can also be made using recombinant DNA technology (including nucleic acid molecules, vectors and / or host cells). Therefore, nucleic acid molecules encoding Tau peptide immunogen constructs and immunologically functional analogs thereof are also included in the present disclosure as part of the present invention. Similarly, vectors (including expression vectors) containing nucleic acid molecules and host cells containing the vectors are also included in the present disclosure as part of the present invention.

[0136] Various exemplary embodiments also encompass methods for producing Tau peptide immunogen constructs and immunologically functional analogs thereof. For example, the method may include the following steps: incubating a host cell containing an expression vector under such conditions that express peptides and / or analogs, the expression vector containing a nucleic acid molecule encoding a Tau peptide immunogen construct and / or an immunologically functional analog thereof. Longer synthetic peptide immunogens can be synthesized by well-known recombinant DNA techniques. Such techniques are provided with detailed protocols in well-known standard manuals. In order to construct a gene encoding a peptide of the present invention, the amino acid sequence is reverse translated to obtain a nucleic acid sequence encoding the amino acid sequence, preferably using the optimal codon for the organism in which the gene is to be expressed. Next, a synthetic gene is usually made by synthesizing oligonucleotides encoding the peptide and any regulatory elements (if necessary). The synthetic gene is inserted into a suitable cloning vector and transfected into a host cell. The peptide is then expressed under appropriate conditions suitable for the selected expression system and host. The peptide is purified and characterized by standard methods.

[0137] b. Method for producing immunostimulatory complex

[0138] Various exemplary embodiments also encompass methods for producing immunostimulatory complexes comprising Tau peptide immunogen constructs and CpG oligodeoxynucleotide (ODN) molecules. Stable immunostimulatory complexes (ISCs) are derived from the cationic portion of the Tau peptide immunogen construct and the polyanionic CpG ODN molecules. The self-assembly system is driven by electrostatic neutralization of charges. The stoichiometry of the molar charge ratio of the cationic portion of the Tau peptide immunogen construct to the anionic oligomer determines the degree of association. The non-covalent electrostatic association of the Tau peptide immunogen construct and the CpG ODN is a fully reproducible process. The peptide / CpG ODN immunostimulatory complex aggregates, which facilitates presentation to the "professional" antigen presenting cells (APCs) of the immune system, thereby further enhancing the immunogenicity of the complex. These complexes are easily characterized for quality control during manufacturing. The peptide / CpG ISCs are well tolerated in vivo. This novel microparticle system containing CpG ODN and Tau fragment-derived peptide immunogen constructs was designed to exploit the broad B cell mitogenic activity associated with the use of CpG ODN, promoting a balanced Th-1 / Th-2 type response.

[0139] The CpG ODN in the disclosed pharmaceutical composition is 100% bound to the immunogen in a process mediated by electrostatic neutralization of opposite charges, thereby forming micron-sized particles. Compared with the use of traditional CpG adjuvants, the microparticle form can significantly reduce the dose of CpG, reduce the possibility of producing adverse innate immune responses, and promote alternative immunogen processing pathways including antigen presenting cells (APCs). Therefore, such preparations are conceptually novel and have potential advantages by promoting the stimulation of immune responses through alternative mechanisms.

[0140] c. Methods for manufacturing pharmaceutical compositions

[0141] Various exemplary embodiments also encompass pharmaceutical compositions containing Tau peptide immunogen constructs. In certain embodiments, the pharmaceutical compositions employ water-in-oil emulsions and suspensions with mineral salts.

[0142] In order for the pharmaceutical composition to be usable by a wide range of people and to prevent Tau aggregation as part of the administration goal, safety becomes another important factor to consider. Although water-in-oil emulsions have been used in many formulations in clinical trials, alum remains the main adjuvant used in formulations due to its safety. Therefore, alum or its mineral salt aluminum phosphate (ADJUPHOS) is often used as an adjuvant in formulations for clinical applications.

[0143] Other adjuvants and immunostimulants include 3De-O-acylated monophosphoryl lipid A (MPL) or 3-DMP, polymeric or monomeric amino acids, such as polyglutamic acid or polylysine. Such adjuvants may be used with or without other specific immunostimulants, such as muramyl peptides (e.g., N-acetyl muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetyl muramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1′-2′ dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), N-acetylglucosaminyl-N-acetyl muramyl-L-Al-D-isoglutamate-L-Ala-dipalmitoxypropylamide (DTP-DPP) Theramide TM ) or other bacterial cell wall components. Oil-in-water emulsions include MF59 (see WO 90 / 14837 to Van Nest et al., which is hereby incorporated by reference in its entirety), containing 5% squalene, 0.5% Tween 80 and 0.5% Span 85 (optionally containing varying amounts of MTP-PE), formulated into submicron particles using a microfluidizer; SAF, containing 10% squalene, 0.4% Tween 80, 5% Pluronic blocking polymer L121 and thr-MDP, made into submicron emulsions by microfluidization or vortexing to generate larger particle size emulsions; and Ribi TM Adjuvant system (RAS) (RibiImmunoChem, Hamilton, Mont.) containing 2% squalene, 0.2% Tween 80 and one or more bacterial cell wall components selected from the group consisting of monophosphoryl lipid A (MPL), trehalose dimycolate (TDM) and cell wall skeleton (CWS), preferably MPL + CWS (Detox TM Other adjuvants include complete Freund's adjuvant (CFA), incomplete Freund's adjuvant (IFA), and cytokines such as interleukins (IL-1, IL-2, and IL-12), granulocyte-macrophage colony-stimulating factor (GM-CSF), and tumor necrosis factor (TNF).

[0144] The choice of adjuvant depends on the stability of the immunogenic formulation containing the adjuvant, the route of administration, the dosing regimen, the efficacy of the adjuvant on the vaccinated species, and, in humans, a pharmaceutically acceptable adjuvant is an adjuvant that has been approved or is approved for human administration by the relevant regulatory agency. For example, alum, MPL or incomplete Freund's adjuvant (Chang et al., Advanced Drug Delivery Reviews 32: 173-186 (1998), which is hereby incorporated by reference in its entirety) alone or optionally all combinations thereof are suitable for human administration.

[0145] The composition may include a pharmaceutically acceptable, non-toxic carrier or diluent, which is defined as a vehicle commonly used to formulate a pharmaceutical composition for administration to animals or humans. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological phosphate buffered saline, Ringer's solution, dextrose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation may also include other carriers, adjuvants, or non-toxic, non-therapeutic, non-immunogenic stabilizers, etc.

[0146] Pharmaceutical compositions can also include large, slowly metabolized macromolecules, such as proteins, polysaccharides such as chitosan, polylactic acid, polyglycolic acid and copolymers (e.g., latex functionalized agarose gel, agarose, cellulose, etc.), polymeric amino acids, amino acid copolymers, and lipid aggregates (e.g., oil droplets or liposomes). In addition, these carriers can serve as immunostimulants (i.e., adjuvants).

[0147] The pharmaceutical composition of the present invention may also include a suitable delivery vehicle. Suitable delivery vehicles include, but are not limited to, viruses, bacteria, biodegradable microspheres, microparticles, nanoparticles, liposomes, collagen microspheres, and cochleates.

[0148] d. Methods of using the pharmaceutical compositions

[0149] The present disclosure also includes methods of using pharmaceutical compositions containing Tau peptide immunogen constructs.

[0150] In certain embodiments, pharmaceutical compositions containing Tau peptide immunogen constructs can be used to:

[0151] (a) Inhibit Tau aggregation in the host;

[0152] (b) Inducing the disaggregation of preformed Tau aggregates in the host;

[0153] (c) reducing neurodegeneration triggered by exogenous Tau aggregates in the host;

[0154] (d) Reduced neurodegeneration in Tau-overexpressing cells;

[0155] (e) reducing Tau levels in host serum;

[0156] (f) reducing the level of oligomeric Tau in the host brain;

[0157] (g) reducing host neuropathology and restoring motor activity; etc.

[0158] The above method comprises administering a pharmaceutical composition comprising a pharmacologically effective amount of a Tau peptide immunogen construct to a host in need thereof.

[0159] As used herein, "tauopathy" encompasses any neurodegenerative disease involving pathological aggregation of the microtubule protein Tau in the brain. Thus, in addition to familial and sporadic Alzheimer's disease, other tauopathies that can be treated using the methods of the invention include, but are not limited to, frontotemporal dementia, Parkinson's disease linked to chromosome 17 (FTDP-17), progressive supranuclear palsy, corticobasal degeneration, Pick's disease, progressive subcortical gliomatosis, tangle-only dementia, diffuse neurofibrillary tangles with calcifications, argyrophilic grain dementia, amyotrophic lateral sclerosis-Parkinson's disease-dementia complex, dementia pugilistica, Down syndrome, Gerstmann-Straussler-Scheinker disease, Hallerworden-Spatz disease, inclusion body myositis, Creutzfeld-Jakob disease, multiple system atrophy, Niemann-Pick disease type C, and symptomatic dementia. C), prion protein cerebral amyloid angiopathy, subacute sclerosing panencephalitis, myotonic dystrophy, non-Guamian motor neuron disease with neurofibrillary tangles, post-encephalitis Parkinson's disease and chronic traumatic encephalopathy. The method can also be further used for the prevention and treatment of Lewy body disease.

[0160] Another aspect of the present disclosure relates to a method for promoting the clearance of Tau aggregates in a subject's brain. The method involves administering to the subject any one or more immunogenic Tau peptides in Table 1 or one of Tables 4-7, or one or more antibodies that recognize an epitope of one of such peptides, under conditions effective to promote the clearance of Tau aggregates from the subject's brain.

[0161] The clearance of tau aggregates includes the clearance of neurofibrillary tangles and / or pathological tau precursors of neurofibrillary tangles. Neurofibrillary tangles are often associated with neurodegenerative diseases, including, for example, sporadic and familial Alzheimer's disease, amyotrophic lateral sclerosis, argyrophilic grain dementia, dementia pugilistica, chronic traumatic encephalopathy, diffuse neurofibrillary tangles with calcification, Down syndrome, Gerstmann-Straussler-Schenck disease, Hallervorden-Spatz disease, hereditary frontotemporal dementia, Parkinson's disease linked to chromosome 17 (FTDP-17), inclusion body myositis, Creutzfeldt-Jakob disease, multiple system atrophy, Niemann-Pick disease type C, Pick disease, prion protein cerebral amyloid angiopathy, sporadic corticobasal degeneration, progressive supranuclear palsy, subacute sclerosing panencephalitis, myotonic dystrophy, motor neuron disease with neurofibrillary tangles, tangle-only dementia, and progressive subcortical gliomatosis.

[0162] Another aspect of the present disclosure relates to a method for slowing the progression of a Tau pathology-related behavioral phenotype in a subject. The method involves administering to the subject any one or more immunogenic Tau peptides in Table 1 or one of Tables 4-7, or one or more antibodies that recognize an immunogenic Tau epitope of one of such peptides, under conditions effective to slow the Tau pathology-related behavioral phenotype in the subject.

[0163] As used herein, Tau pathology-associated behavioral phenotypes include, but are not limited to, cognitive impairment, early personality changes and disinhibition, apathy, loss of avolition, mutism, apraxia, perseverative speech, stereotyped movements / behaviors, hyperorality, disorganization, inability to plan or organize sequential tasks, selfishness / callousness, antisocial traits, lack of empathy, hesitation, agrammatic speech, frequent paraphasias with relatively preserved comprehension, impaired comprehension and word-finding deficits, slowly progressive gait instability, backing away, freezing, frequent falls, non-levodopa-responsive axial rigidity, supranuclear gaze palsy, square wave jerks, slow vertical saccades, pseudobulbar palsy, limb apraxia, dystonia, cortical sensory loss, and tremor.

[0164] According to the methods disclosed herein, in one embodiment, an immunogenic Tau peptide or a combination of immunogenic Tau peptides is administered to a subject in need thereof. Suitable immunogenic Tau peptide fragments of Tau protein contain one or more antigenic epitopes that mimic pathological forms of Tau protein. Exemplary immunogenic Tau epitopes are phosphorylated at one or more amino acids that are phosphorylated in pathological forms of Tau but not in normal or non-pathological forms of Tau.

[0165] In some embodiments, administration of an immunogenic Tau peptide induces an active immune response to the immunogenic Tau peptide and Tau pathological forms in a subject, thereby promoting the clearance of relevant Tau aggregates, slowing the progression of Tau pathology-related behaviors, and treating potential tauopathy. According to this aspect of the invention, the immune response involves the development of a beneficial humoral (antibody-mediated) and / or cellular (mediated by antigen-specific T cells or their secretory products) response to the immunogenic Tau peptide.

[0166] The presence of a humoral immunological response can be determined and monitored by testing the presence of antibodies to immunogenic Tau peptides in a biological sample (e.g., blood, plasma, serum, urine, saliva, feces, CSF, or lymph) of the subject. Methods for detecting antibodies in biological samples are well known in the art, such as ELISA, dot blot, SDS-PAGE gel, or ELISPOT. The presence of a cell-mediated immunological response can be determined by proliferation assays (CD4+T cells) or CTL (cytotoxic T lymphocyte) assays known in the art.

[0167] The isolated immunogenic Tau peptide of the present invention is, includes or comprises any one of the amino acid sequences in Table 1 and Tables 4-7 below. In a preferred embodiment, the peptide of Tables 4-7 is a peptide having at least one value greater than 1.

[0168] Specific implementation plan

[0169] (1) A Tau peptide immunogen construct, which can be represented by the following formula:

[0170] (Th) m –(A) n –(Tau fragment)–X

[0171] or

[0172] (Tau fragment) – (A) n –(Th) m –X

[0173] in

[0174] Th is a heterologous T helper epitope;

[0175] A is a heterologous spacer;

[0176] (Tau fragment) is a B cell epitope having about 8 to about 40 amino acid residues (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 amino acids) from the full-length Tau protein of SEQ ID NO: 167;

[0177] X is α-COOH or α-CONH2 of an amino acid;

[0178] m is from 1 to about 4; and

[0179] n is 0 to about 10.

[0180] (2) The Tau peptide immunogen construct according to (1), wherein the Tau fragment is selected from the group consisting of: SEQ ID NO: 1-8, 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135 and 137.

[0181] (3) The Tau peptide immunogen construct according to any one of (1) or (2), wherein the Th epitope is selected from the group consisting of: SEQ ID NO: 138-166, such as 151, 152 or 149.

[0182] (4) The Tau peptide immunogen construct according to any one of (1) to (3), wherein the peptide immunogen construct is selected from the group consisting of SEQ ID NO: 9-16 (eg, 10 or 15) (or a construct in which the positions of the Tau peptide and Th epitopes are reversed).

[0183] (5) A Tau peptide immunogen construct comprising:

[0184] A B cell epitope comprising about 8 to about 40 amino acid residues (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids) from the full-length Tau protein sequence of SEQ ID NO: 167;

[0185] A T helper epitope comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 138-166; and

[0186] an optional heterologous spacer selected from the group consisting of amino acids, Lys-, Gly-, Lys-Lys-Lys-, (α,ε-N)Lys, and ε-N-Lys-Lys-Lys-Lys (SEQ ID NO: 169),

[0187] wherein said B cell epitope is covalently linked to said T helper epitope directly or via said optional heterologous spacer.

[0188] (6) The Tau peptide immunogen construct as described in (5), wherein the B cell epitope is selected from the group consisting of: SEQ ID NO: 1-8, 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135 and 137.

[0189] (7) The Tau peptide immunogen construct as described in (5) or (6), wherein the T helper epitope is selected from the group consisting of: SEQ ID NO: 138-166.

[0190] (8) The Tau peptide immunogen construct of any one of (5) to (7), wherein the optional heterologous spacer is (α,ε-N)Lys or ε-N-Lys-Lys-Lys-Lys (SEQ ID NO: 169).

[0191] (9) The Tau peptide immunogen construct of any one of (5) to (8), wherein the T helper epitope is covalently linked to the amino terminus of the B cell epitope.

[0192] (10) The Tau peptide immunogen construct of any one of (5) to (8), wherein the T helper epitope is covalently linked to the amino terminus of the B cell epitope via the optional heterologous spacer.

[0193] (11) A composition comprising the Tau peptide immunogen construct according to any one of (1) to (10).

[0194] (12) A pharmaceutical composition comprising:

[0195] a. A peptide immunogen construct according to any one of (1) to (10); and

[0196] b. and a pharmaceutically acceptable delivery vehicle and / or adjuvant.

[0197] (13) The pharmaceutical composition according to (12), wherein

[0198] a. The Tau peptide immunogen construct is selected from the group consisting of SEQ ID NOs: 9-16, or a Tau peptide immunogen construct in which the positions of the B cell epitope and the T cell epitope are reversed compared to one of SEQ ID NOs: 9-16 (e.g., 10 or 15); and

[0199] b. Mixing the Tau peptide immunogen construct with CpG oligodeoxynucleotide (ODN), such as CpG1, CpG2 or CpG3, to form a stable immunostimulatory complex.

[0200] (14) An isolated antibody or epitope-binding fragment thereof, which specifically binds to a B cell epitope of the Tau peptide immunogen construct according to any one of (1) to (10).

[0201] (15) The isolated antibody or epitope-binding fragment thereof according to (14), wherein the isolated antibody or epitope-binding fragment thereof binds to the Tau peptide immunogen construct.

[0202] (16) A composition comprising the isolated antibody or epitope-binding fragment thereof according to (14) or 15).

[0203] (17) A Tau peptide immunogen construct selected from the group consisting of:

[0204]

[0205]

[0206] (18) A composition comprising the Tau peptide immunogen construct according to (17).

[0207] (19) A pharmaceutical composition comprising:

[0208] a. The Tau peptide immunogen construct according to (17); and

[0209] b. and a pharmaceutically acceptable delivery vehicle and / or adjuvant.

[0210] (20) The pharmaceutical composition as described in (19), wherein the Tau peptide immunogen construct is mixed with CpG oligodeoxynucleotide (ODN) (e.g., CpG1, CpG2 or CpG3) to form a stable immunostimulatory complex.

[0211] (21) A pharmaceutical composition as described in (19) or (20), wherein the composition comprises an aluminum-based adjuvant (aluminum phosphate or aluminum hydroxide) or another adjuvant described herein.

[0212] (22) A method for preventing, inhibiting, reducing the severity of, delaying or treating tauopathy in a subject, the method comprising administering to the subject the tau peptide immunogen construct or composition of any one of (1) to (21).

[0213] (23) A method as described in (22), wherein the tauopathy is selected from the group consisting of: Alzheimer's disease, Lewy body disease, frontotemporal dementia, Parkinson's disease linked to chromosome 17 (FTDP-17), progressive supranuclear palsy, corticobasal degeneration, Pick's disease, progressive subcortical gliomatosis, tangle-only dementia, diffuse neurofibrillary tangles with calcifications, argyrophilic grain dementia, amyotrophic lateral sclerosis-Parkinson's disease-dementia complex, dementia pugilistica, Down syndrome, Gerstmann-Straussler-Schenck disease, Hallervorden-Spatz disease, inclusion body myositis, Creutzfeldt-Jakob disease, multiple system atrophy, Niemann-Pick disease type C, prion protein cerebral amyloid angiopathy, subacute sclerosing panencephalitis, myotonic dystrophy, non-Guam motor neuron disease with neurofibrillary tangles, postencephalitic Parkinson's disease and chronic traumatic encephalopathy.

[0214] Example 1

[0215] Accumulation of misfolded Tau in the brain is associated with clinical decline in Alzheimer's disease (AD), but precedes the onset of cognitive symptoms by decades (Congdon and Sigurdsson, Nat. Rev. Neurol, 2018). Targeting pathological Tau before the clinical onset of AD may help prevent disease and / or progression. We have developed a vaccine-based immunotherapy approach to prevent and treat Alzheimer's disease. The results of preclinical characterization of the Tau vaccine are shown in Table A below. The peptides noted in the figure can be cross-referenced according to Table 1, column 1.

[0216]

[0217] Ec50 values ​​were generated by 12-point dilution curve ELISA against T helper peptide, CpG, Tau construct specific peptide, full length monomeric Tau (Mono) and Tau preformed fibrils (PFF) using terminal bleed sera from vaccinated male Hartley guinea pigs (15 weeks).

[0218] The platform on which the vaccine is based is Figure 1The illustrated diagram includes a B cell epitope, a spacer or linker, and a Th peptide carrier. B cells will recognize B cell epitopes and generate antibodies against peptides that mimic biological targets (e.g., Tau). The spacer chemically connects the B cell epitope to the Th peptide, thereby optimizing the presentation of the B cell epitope to the immune system. The Th peptide carrier activates T helper cells, alerting B cells to begin generating antibodies against B cell epitopes while avoiding inflammation and off-target activity. Figure 1 The primary structure of Tau is shown at the bottom, with the functional domains and targeting peptides labeled. The peptides indicated in this figure and other figures listed in this article are as follows:

[0219] Constructs were formulated in Adju-Phos CpG1 at 100ug / mL + 300ug / 0.25mL peptide. Guinea pigs were injected intramuscularly 5 times at 3-week intervals and terminal bleeds were collected at 15wpi. Antibodies against T helper peptide, adjuvant components, and Tau were quantified by ELISA at serial dilutions. In addition, antibody binding to recombinant and brain-derived Tau preparations was characterized by Western blotting, dot blotting, and biolayer interferometry (BLI). In vitro functionality was assessed by Tau FRET aggregation and pHrodo uptake assays in HEK293 and B103 cells.

[0220] Antibody binding characterization results Figure 2A and Figure 2B The binding potency of vaccine-derived antibodies to three forms of recombinant Tau (monomer, oligomer, and PFF) and Sarcosyl extract from postmortem brain tissue (Br) was characterized by dot blot analysis ( Figure 2A Different binding profiles were observed for different forms of Tau. BLI results showed that the antibodies bound to the Tau forms of the constructs with Kd in the nM range, with the three constructs having slower dissociation rates than berenezumab ( Figure 2B ). Representative binding curves of Bep and construct A to PFF are shown.

[0221] The results of aggregation assays using the Tau biosensor system are shown in Figure 3A and Figure 3B The Tau biosensor system (Frost et al., J. Biol. Chem., 2009) was used to evaluate the functional inhibition of vaccine-derived antibodies compared with anti-Tau mAbs, sirenecumab and berenuzumab. The assay conditions included the addition of lipofectamine ( Figure 3A ) and without adding lipofectamine( Figure 3B ). Only the condition without the addition of lipofectamine resulted in Ab inhibition of aggregation.

[0222] The results of Tau uptake assay were Figure 4A and Figure 4B B103 cells were exposed to pHrodo-labeled Tau preparations for 6 hours. Upon uptake, pHrodo-Tau fluoresces, enabling quantification using the IncuCyte live cell imager. Constructs A, B, C, and F inhibited the uptake of monomeric Tau in a dose response ( Figure 4A All constructs resulted in a dose-dependent reduction in PFF uptake ( Figure 4B ). The potency of the constructs varied; however, all constructs exhibited stronger inhibition of PFF than monomeric Tau uptake.

[0223] Tau candidate antibodies exhibited different binding profiles against different forms of Tau. No significant immunogenicity was observed against Th1 peptides or CpG1. Functional assays showed that binding antibodies could prevent aggregation by inhibiting uptake.

[0224] Example 2

[0225] Vaccination studies were performed in WT and P301L mice. Figure 5A We show that vaccination of P301L mice expressing p5555kb generated robust titers against monomeric and PFF Tau. Figure 5B showed that Tau accumulation in P301L was reduced after vaccination with p5555kb. Figure 5C Brain lysates from P301L mice vaccinated with p5555kb showed evidence of reduced aggregation induction in the Tau biosensor line. These results suggest that both WT and P301L mice exhibit a positive response to p5555kb vaccination.

[0226] Example 3

[0227] The immunogenicity of p5555kb and p5187kb was evaluated in rats. Figure 6 ELISA analysis showed titers comparable to those in guinea pig studies. These constructs are therefore immunogenic in different species.

[0228] In further studies, isotype analysis of the antibodies produced in rats was performed. Ten male Sprague-Dawley rats weighing 200-250g were used in each group, with a total of 2 groups (20 rats). The vaccine was administered at weeks 0, 3, 6, 9 and 12 (intramuscular injection, 0.25mL / dose). The blood sampling schedule was before dosing at weeks 0, 3, 6, 9 and 12; blood was collected at the end of week 15. Blood samples were separated into serum and placed on dry ice, followed by subsequent thawing and analysis. Group 1: p5555kb, 10 animals, 30ug / 0.25mL / dose / IM (Adjuphos, CpG1), Group 2: p5187, 10 animals, 30ug / 0.25mL / dose / IM (Adjuphos, CpG1). The results are as follows Figure 7-10 The data are shown in Figure 2 and demonstrate that: (i) total IgG titers were significantly higher in Group 1 (p5555kb) after the 42 day time point, (ii) IgG1 was the major isotype in all groups, followed by IgG2b, IgG2c, and IgG2a, indicating the presence of a TH-2 response, and (iii) antibody titers in Groups 1 and 2 plateaued after the 42 day time point (second boost) (104-5).

[0229] In additional studies, Western blot analysis was performed to assess antibody binding to brain tissue (normal hippocampus, normal temporal lobe, diseased hippocampus, and diseased temporal lobe). The data were consistent with the guinea pig data, as both p5187 and p5555 rat IgG bound well to human brain lysates.

[0230] Tau aggregation assays showed that rat TgG from p5555 and p5187 inhibited tau aggregation at levels comparable to those of the monoclonal antibodies ceranatumumab and berenuzumab ( Fig.11 ).

[0231] In further studies, the immunogenicity of p5555kb and p5187kb was evaluated in mice. Fig.12 As shown, p5555 and p5187 achieved robust titers against PFF and monomeric forms of tau.

[0232] Table 1 Amino acid sequences of immunogenic constructs

[0233]

[0234] The target peptide sequences are underlined and are SEQ ID NOs: 1-8, respectively (from top to bottom of the table). The immunogenic construct sequences are SEQ ID NOs: 9-16, respectively (from top to bottom of the table and refer to the column labeled "Sequence")

[0235] Table 2

[0236] Amino acid sequences of pathogen protein-derived Th epitopes including ideal artificial Th epitopes for designing Tau peptide immunogen constructs

[0237]

[0238]

[0239] Table 3 Tau protein sequence, full length (441aa) isoform with 4R and 2N (GenBank: AGF19246.1)

[0240]

[0241] Table 4

[0242] Localization of immunogenic regions within Tau 275-311 by fine epitope mapping (SEQ ID NOs: 17-34)

[0243] Tau(275-311)B epitope mapping for p4604kb

[0244] 2 / 28 / 2018

[0245]

[0246] Hyperimmune sera from:

[0247] The PTAU-15-01GP of the pooled group 10 (4603 kb, UBITh1-εk-kkk-(V275-K311, P301→S301), 6 wpi.

[0248] Positive peptide: 4604a (V275-K311)

[0249] Hyperimmune serum against the mapped peptides 1 / 10000 dilution

[0250] Hyperimmune serum against positive peptides diluted 1 / 10000

[0251] Table 5 - Localization of immunogenic regions within Tau 1-45 by fine epitope mapping

[0252]

[0253] Table 6 - Localization of immunogenic regions within Tau 145-160 by fine epitope mapping

[0254]

[0255] Table 7 - Localization of immunogenic regions within Tau 379-408 by fine epitope mapping

[0256]

Claims

1. A Tau peptide immunogen construct represented by the following formula: (Th) m –(A) n –(Tau fragment)–X or (Tau fragment) – (A) n –(Th) m –X in Th is a heterologous T helper epitope; A is a heterologous spacer; (Tau fragment) is a B cell epitope having about 10 to about 40 amino acid residues from the full-length Tau protein of SEQ ID NO: 167; X is α-COOH or α-CONH2 of an amino acid; m is from 1 to about 4; and n is 0 to about 10.

2. The Tau peptide immunogen construct of claim 1, wherein the Tau fragment is selected from the group consisting of SEQ ID NO: 1-8, 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135 and 137.

3. The Tau peptide immunogen construct of any one of claims 1 or 2, wherein the Th epitope is selected from the group consisting of: SEQ ID NO: 138-166, such as 151, 152 or 149.

4. The Tau peptide immunogen construct of claim 1, wherein the peptide immunogen construct is selected from the group consisting of: SEQ ID NO: 9-16 (eg, 10 or 15) or a construct in which the positions of the Tau peptide and the Th peptide are reversed.

5. A Tau peptide immunogen construct comprising: A B cell epitope comprising about 8 to about 40 amino acid residues (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids) from the full-length Tau protein sequence of SEQ ID NO: 167; A T helper epitope comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 138-166; and an optional heterologous spacer selected from the group consisting of amino acids, Lys-, Gly-, Lys-Lys-Lys-, (α,ε-N)Lys, and ε-N-Lys-Lys-Lys-Lys (SEQ ID NO: 169), wherein said B cell epitope is covalently linked to said T helper epitope directly or via said optional heterologous spacer.

6. The Tau peptide immunogen construct of claim 5, wherein the B cell epitope is selected from the group consisting of SEQ ID NO: 1-8, 36, 39, 40, 48, 50, 51, 52, 57, 58, 59, 62, 87, 88, 129, 49, 35, 99, 135 and 137.

7. The Tau peptide immunogen construct of claim 5 or 6, wherein the T helper epitope is selected from the group consisting of: SEQ ID NO: 138-166.

8. The Tau peptide immunogen construct of claim 5 or 6, wherein the optional heterologous spacer is (α,ε-N)Lys or ε-N-Lys-Lys-Lys-Lys (SEQ ID NO: 169).

9. The Tau peptide immunogen construct of claim 5 or 6, wherein the T helper epitope is covalently linked to the amino terminus of the B cell epitope.

10. The Tau peptide immunogen construct of claim 5 or 6, wherein the T helper epitope is covalently linked to the amino terminus of the B cell epitope via the optional heterologous spacer.

11. A composition comprising the Tau peptide immunogen construct according to any one of claims 1, 2, 4, 5 or 6.

12. A pharmaceutical composition comprising: a. A Tau peptide immunogen construct according to any one of claims 1, 2, 4, 5 or 6; and b. and a pharmaceutically acceptable delivery vehicle and / or adjuvant.

13. The pharmaceutical composition of claim 12, wherein a. The Tau peptide immunogen construct is selected from the group consisting of: SEQ ID NO: 9-16 (e.g., 10 or 15), or a Tau peptide immunogen construct in which the positions of the B cell epitope and the T cell epitope are reversed, as compared to one of SEQ ID NO: 9-16 (e.g., 10 or 15); and b. Mixing the Tau peptide immunogen construct with CpG oligodeoxynucleotide (ODN), such as CpG1, CpG2 or CpG3, to form a stable immunostimulatory complex.

14. An isolated antibody or epitope-binding fragment thereof, which specifically binds to a B cell epitope of the Tau peptide immunogen construct according to any one of claims 1, 2, 4, 5 or 6.

15. The isolated antibody or epitope-binding fragment thereof according to claim 14, which binds to the Tau peptide immunogen construct.

16. A composition comprising the isolated antibody or epitope-binding fragment thereof according to claim 14.

17. A Tau peptide immunogen construct selected from the group consisting of: a.MAEPRQEFEVMEDHAGTYGLGDKKK-eK-ISITEIKGVIVHRIETILF-NH2; SEQ ID NO:9 b.DHAGTYGLGDKKK-eK-ISITEIKGVIVHRIETILF-NH2; SEQ ID NO:10 c.ISITEIKGVIVHRIETILF-eK-KKKNITHVPGGGNKK-NH2; SEQ ID NO:11 d.ISITEIKGVIVHRIETILF-eK-KKKKDNIKHVPGGGSVQIVYK-NH2; SEQ ID NO: 12 e.ISITEIKGVIVHRIETILF-eK-KKKTKIATPRGAAPP-NH2; SEQ ID NO:13 f.ISITEIKGVIVHRIETILF-eK-KKKVVRTPPKSPSAKSRL-NH2; SEQ ID NO:14 g.ISITEIKGVIVHRIETILF-eK-KKKIKHVPGGGSVQIVYK-NH2; and SEQ ID NO: 15 h.ISITEIKGVIVHRIETILF-eK-KKKVSGDTSPRHLSNVSST-NH2 SEQ ID NO:

16.

18. A composition comprising the Tau peptide immunogen construct according to claim 17.

19. A pharmaceutical composition comprising: a. The Tau peptide immunogen construct according to claim 17; and b. and a pharmaceutically acceptable delivery vehicle and / or adjuvant.

20. The pharmaceutical composition of claim 19, wherein the Tau peptide immunogen construct is mixed with CpG oligodeoxynucleotides (ODN) (eg, CpG1, CpG2, or CpG3) to form a stable immunostimulatory complex.

21. A pharmaceutical composition as claimed in claim 19 or 20, wherein the composition comprises an aluminium-based adjuvant (aluminium phosphate or aluminium hydroxide) or another adjuvant as described herein.

22. A method of preventing, inhibiting, reducing the severity of, delaying, or treating tauopathy in a subject, the method comprising administering to the subject a tau peptide immunogen construct or composition of any one of the preceding claims.

23. The method of claim 22, wherein the tauopathy is selected from the group consisting of Alzheimer's disease, Lewy body disease, frontotemporal dementia, Parkinson's disease linked to chromosome 17 (FTDP-17), progressive supranuclear palsy, corticobasal degeneration, Pick's disease, progressive subcortical gliomatosis, tangle-only dementia, diffuse neurofibrillary tangles with calcifications, argyrophilic grain dementia, amyotrophic lateral sclerosis-parkinsonism-dementia complex, dementia pugilistica, Down syndrome, Gerstmann-Straussler-Schenck disease, Hallervorden-Spatz disease, inclusion body myositis, Creutzfeldt-Jakob disease, multiple system atrophy, Niemann-Pick disease type C, prion protein cerebral amyloid angiopathy, subacute sclerosing panencephalitis, myotonic dystrophy, non-Guam motor neuron disease with neurofibrillary tangles, postencephalitic Parkinson's disease, and chronic traumatic encephalopathy.

Images