Method for nucleic acid detection by using signal-mediated RNA amplification technology and RNA aptamer

Abstract

The present invention relates to a method for detecting a target nucleic acid in a sample using an optimized SMART method, the method comprising the direct detection of an RNA transcript using at least one fluorescent aptamer. Preferably, the method is used after an amplification step, for example after NASBA detection.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to the field of nucleic acid amplification and detection of target nucleic acid in a sample. Background Art

[0002] Signal-mediated RNA amplification technology (SMART) is an isothermal nucleic acid amplification assay that relies on signal amplification, is rapid and simple, and does not require thermal cycling steps. The assay has other advantages in that it can be used for either DNA or RNA targets. In addition, the signal generated is highly target-dependent (i.e., a signal is generated only when a specific target is present) and can distinguish between base changes within the target sequence.

[0003] The SMART assay consists of two single-stranded oligonucleotide probes (extension and template); each probe includes a region that can hybridize with the target (herein referred to as the foot region) and another region that can hybridize with the other probe (herein referred to as the arm region). The two probes are designed so that they can anneal to each other only in the presence of a specific target, thereby forming a structure called a three-way junction.

[0004] After the three-way junction is formed, the DNA polymerase extends the short (extension) arm of the probe and converts the single-stranded promoter sequence into a functional double-stranded RNA polymerase promoter. The assay relies on the fact that only when the double-stranded RNA polymerase promoter is functional can the RNA polymerase generate multiple copies of RNA, which are then the molecules to be detected.

[0005] Several detection methods have been described to sense and quantify amplified RNA. Among them, the enzyme-linked oligonucleotide adsorption assay (ELOSA) is based on detection by measuring a color change in a standard microplate reader, where the amplified RNA molecules are attached and hybridized to another probe containing the detection method, such as an alkaline phosphatase (AP)-linked probe. Other detection methods rely on the use of molecular beacons, which are oligonucleotide molecules that can report the presence of amplified RNA due to their hairpin-shaped structure with an internal quenched fluorophore, the fluorescence of which is restored when the molecular beacon binds to its target.

[0006] It is worth noting that the SMART process is different from other amplification and detection methods because it is based on the amplification of the detection signal rather than the amplification of the target nucleic acid. That is, the detected molecule is the amplified RNA, which is only produced when the target nucleic acid binds to the two probes that form the three-way junction.

[0007] The SMART assay is currently being developed for detecting specific nucleic acid sequences in clinical samples. But it also has some disadvantages that need to be improved. One of the disadvantages relates to the fact that when RNA molecules are generated, the method requires the addition of probes that provide a means of detecting the RNA molecules. In the case of ELOSA, the probes are alkaline phosphatase (AP)-linked probes. If beacon molecules are used, they need to be added to the reaction so that they can hybridize with the RNA molecules and thus be detected. As usually happens in amplification methods, the addition of additional steps usually sacrifices specificity and efficiency. In addition, the SMART assay includes multiple steps, which hinders the implementation of the method in a point-of-care (POC) environment, which is crucial for analyzing clinical samples in a time-saving, economical and efficient manner.

[0008] The present invention aims to solve the above problems and describes an optimized SMART method, referred to herein as the fluorescence-SMART method, which provides a detection method for detecting amplified RNA without adding other probes, thereby simplifying the SMART method and improving its sensitivity. Summary of the invention

[0009] The present invention relates to a method for detecting the presence of a target nucleic acid in a sample, the method comprising the following steps:

[0010] a) adding a first nucleic acid probe and a second nucleic acid probe to a sample containing a target nucleic acid so that the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe hybridize to form a three-way junction structure, wherein:

[0011] i) the first probe comprises: a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing with the first portion of the target nucleic acid; and an arm region located at the 3' region of the probe;

[0012] ii) The second probe comprises:

[0013] (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing to the second portion of the target nucleic acid, and

[0014] (2) an arm region located at the 5' region of the probe, the arm region including in the 5' to 3' direction:

[0015] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0016] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0017] - a region of preferably 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein said region is fully or partially contained within the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, and

[0018] iii) the target nucleic acid comprises: a first portion located at the 3' region of the target nucleic acid, the first portion being complementary to the foot region of the first probe; and a second portion located at the 5' region of the target nucleic acid, the second portion being complementary to the foot region of the second probe, wherein the first portion is adjacent or substantially adjacent to the second portion, and wherein when the target nucleic acid is present in the sample, a three-way junction structure is formed between the first probe, the second probe and the target nucleic acid, and

[0019] b) adding a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe;

[0020] c) adding a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) so as to cause de novo synthesis of a single-stranded nucleic acid comprising at least one fluorescent aptamer; and

[0021] d) adding at least one fluorophore ligand of the at least one fluorescent aptamer, thereby directly detecting the de novo synthesized nucleic acid comprising the at least one fluorescent aptamer, wherein detection of the nucleic acid comprising the at least one fluorescent aptamer indicates the presence of the target nucleic acid in the sample,

[0022] Wherein, optionally, the method further comprises an amplification step before step a), wherein the target nucleic acid is amplified, and wherein, further optionally, the first part and the second part are separated by 0 to 6 nucleotides.

[0023] Preferably, the double-stranded RNA promoter formed in step b) is a T7 RNA polymerase promoter, and the DNA-guided RNA polymerase added in step c) is a T7 RNA polymerase. Preferably, the double-stranded RNA promoter formed in step b) is a SP6 RNA polymerase promoter, and the DNA-guided RNA polymerase added in step c) is a SP6 RNA polymerase.

[0024] Preferably, the double-stranded RNA promoter formed in step b) is a T3 RNA polymerase promoter, and the DNA-guided RNA polymerase added in step c) is T3 RNA polymerase.

[0025] Preferably, the DNA-guided DNA polymerase added in step b) is Bacillus stearothermophilus DNA polymerase I.

[0026] Preferably, the foot region of the first probe and / or the second probe is at least 15 nucleotides in length.

[0027] Preferably, at least one fluorescent aptamer is a Mango aptamer or a Broccoli aptamer.

[0028] Preferably, if at least one fluorescent aptamer contained in the arm of the second probe is a Mango aptamer, the fluorescent ligand added in step d) is a TO1 biotin fluorophore, or if at least one fluorescent aptamer contained in the arm of the second probe is a Broccoli aptamer, the fluorescent ligand added in step d) is a DFHBI or DFHBI-1T fluorophore.

[0029] Preferably, the method further comprises an amplification step before step a), which comprises amplifying the target nucleic acid to provide a plurality of molecules identical to the target nucleic acid or its reverse complementary sequence, wherein the plurality of molecules represent the target nucleic acid in subsequent steps a) to d), and wherein the amplification step is optionally followed by a step of post-amplification degradation of residual amplification primers and dephosphorylation of excess dNTPs.

[0030] Preferably, the method comprises an amplification step, wherein the amplification step is performed by nucleic acid sequence based amplification (NASBA), preferably wherein the amplification step is followed by a step of post-amplification degradation of residual amplification primers and dephosphorylation of excess dNTPs. Preferably, the step of post-amplification degradation of residual amplification primers and dephosphorylation of excess dNTPs is performed by exonuclease digestion and subsequent phosphatase reaction.

[0031] Preferably, the target nucleic acid is an RNA molecule, which is preferably derived from the genome of an infectious agent, preferably a human infectious agent, such as a bacterium or a virus. More preferably, the target nucleic acid is a bacterial 16S rRNA or 23S rRNA. Still more preferably, the target nucleic acid is a viral genomic RNA, preferably selected from the SARS-CoV-2 virus or the influenza virus genome.

[0032] Preferably, the method is carried out as a one-pot reaction. Preferably, the method comprises the following steps:

[0033] a) amplifying the target nucleic acid, preferably using an amplification method, preferably the NASBA method, and subsequently or overlappingly or simultaneously, preferably subsequently, adding the first nucleic acid probe and the second nucleic acid probe to the sample, so as to form the three-way junction structure of the present invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe, wherein:

[0034] i) the first probe comprises: a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing with the first portion of the target nucleic acid; and an arm region located at the 3' region of the probe;

[0035] ii) The second probe comprises:

[0036] (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing to the second portion of the target nucleic acid, and

[0037] (2) an arm region located at the 5' region of the probe, the arm region preferably including in the 5' to 3' direction:

[0038] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0039] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0040] - a region comprising 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region comprising 5 to 9 nucleotides is fully or partially contained in the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, and

[0041] iii) the target nucleic acid comprises: a first portion located at the 3' region of the target nucleic acid, the first portion being complementary to the foot region of the first probe; and a second portion located at the 5' region of the target nucleic acid, the second portion being complementary to the foot region of the second probe, wherein the first portion is adjacent or substantially adjacent to the second portion, and wherein when the target nucleic acid is present in the sample, a three-way junction structure is formed between the first probe, the second probe and the target nucleic acid, and

[0042] b) adding a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe;

[0043] c) adding a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) so as to cause de novo synthesis of a single-stranded nucleic acid comprising at least one fluorescent aptamer; and

[0044] d) adding at least one fluorophore ligand of the at least one fluorescent aptamer, thereby directly detecting, optionally quantifying, the de novo synthesized nucleic acid comprising the at least one fluorescent aptamer, wherein the detection, optionally quantifying, of the nucleic acid comprising the at least one fluorescent aptamer indicates the presence of the target nucleic acid in the sample.

[0045] Preferably, the promoter used in the amplification performed in step a) is different from the DNA-guided RNA polymerase promoter contained in the arm region of the second probe, preferably one of the promoters is a T7 promoter and the other promoter is an SP6 promoter.

[0046] Another aspect of the invention relates to a computer-implemented method for designing at least one pair of probes suitable for implementing the method defined in the previous aspect, the method comprising the following steps:

[0047] i) reading the target nucleic acid,

[0048] ii) obtaining or generating a sequence of at least one pair of probes, wherein each probe comprises a foot region and an arm region, wherein:

[0049] The foot region of the first probe is located at the 5' region of the probe and is complementary to and hybridizes with the first portion of the target nucleic acid, and the arm region of the first probe is located at the 3' region of the probe and is not complementary to the target nucleic acid, wherein

[0050] The foot region of the second probe is located in the 3' region of the probe and is complementary to and hybridizes with the second portion of the target nucleic acid, and the arm region of the second probe is located in the 5' region of the probe and comprises in the 5' to 3' direction:

[0051] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0052] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0053] - a region of 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region of 5 to 9 nucleotides is fully or partially contained in the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter,

[0054] wherein the first part and the second part of the target nucleic acid are preferably separated by 0 to 6 nucleotides,

[0055] wherein the first probe and the second probe are capable of forming a three-way junction structure by hybridizing with the target nucleic acid molecule, and

[0056] iii) Optionally, providing as output the sequence obtained or generated in step ii).

[0057] Preferably, step ii) comprises the following steps:

[0058] a) obtaining a foot region of a first probe by selecting a first portion of nucleotides contained in the target nucleic acid and providing a complementary sequence thereof,

[0059] b) obtaining the foot region of the second probe by selecting a second portion of nucleotides contained in the target nucleic acid and providing a complementary sequence thereof, wherein the first portion and the second portion are preferably separated by 0 to 6 nucleotides,

[0060] c) obtaining the arm region of the second probe by selecting a nucleotide sequence comprising the full-length sequence of a DNA-guided RNA polymerase promoter and the full-length reverse complement sequence of at least one fluorescent aptamer, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0061] d) obtaining the arm region of the first probe by selecting 5 to 9 nucleotides complementary to a region located at the 3' region of the arm region of the second probe obtained in step c), and

[0062] e) Optionally, synthesizing the designed first probe and second probe.

[0063] Another aspect of the present invention relates to a kit for detecting the presence of a target nucleic acid in a sample, comprising the following elements:

[0064] a) at least one DNA-guided DNA polymerase, preferably Bst polymerase,

[0065] b) at least one DNA-guided RNA polymerase, preferably T7 RNA polymerase,

[0066] c) at least one suitable fluorophore ligand of the fluorescent aptamer,

[0067] d) spermidine,

[0068] e) nucleoside triphosphates, including deoxynucleoside triphosphates and / or ribonucleoside triphosphates,

[0069] f) a suitable buffer for carrying out the method for detecting the presence of a target nucleic acid as defined above,

[0070] g) optionally, a reverse transcriptase, an RNAse, at least one exonuclease and a phosphatase,

[0071] Therein, elements a) to g) are contained in different containers or are grouped in one or more containers.

[0072] Another aspect relates to a method for detecting the presence of a target nucleic acid in a sample as defined in the preceding aspect, wherein the method uses a kit as defined above.

[0073] Another aspect relates to a system for detecting the presence of a target nucleic acid in a sample, comprising a first probe and a second probe, wherein the first probe comprises a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing to a first portion of the target nucleic acid, and an arm region located at the 3' region of the probe; and wherein the second probe comprises:

[0074] (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing to the second portion of the target nucleic acid, and

[0075] (2) an arm region, which includes, from the 5' to the 3' direction:

[0076] i. the full-length reverse complementary sequence of at least one fluorescent aptamer,

[0077] ii. the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the RNA polymerase promoter,

[0078] iii. a region comprising 5 to 9 nucleotides that is complementary to and hybridizes with the arm region of the first probe, wherein the region comprising 5 to 9 nucleotides may be a region included in the full-length reverse complementary sequence of a DNA-guided RNA polymerase promoter. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] Figure 1 .Schematic diagram of the aptamer (apta)-SMART detection method. Apta-SMART (Mango) detection (1 hour at fixed 41°C) scheme, which shows the first DNA probe (left) and the second DNA probe (right) hybridized with the ssRNA target (in the example) or DNA. The second DNA probe contains a hybridization region with ssRNA (or DNA) and a 3WJ formation region (hybridized with the first probe), a T7 promoter region (in the form of a reverse complementary sequence (RC)), and a Mango aptamer sequence (in the form of an RC). During SMART, the activity of Bst polymerase (Bst pol) extends the first probe from 3' to 5', while the activity of T7 RNA polymerase (T7 RNA pol) forms an RNA copy of the Mango aptamer sequence (sense strand), which emits 535nm fluorescence after excitation at a wavelength of 510nm in the presence of the fluorophore TO1-biotin, which is an indirect proportional measurement of the presence of the ssRNA target.

[0080] Figure 2.Schematic diagram of NASBA isothermal amplification and subsequent apta-SMART protocol. (Step 1) NASBA isothermal amplification (Kao et al. Anal Letters, 2010) is performed at 37°C for 1.5 hours, starting with primer 1 (containing T7), annealing at the 3' end of the target (RNA(+)), and then converted into hybrid RNA / cDNA through reverse transcriptase (RT) activity. The hybrid will be treated with RNAse H, thereby eliminating the RNA chain. Primer 2 then anneals to the 3' end of the cDNA, and the cDNA is replicated again through RT activity to obtain dsDNA with a T7 promoter. Then, T7 RNA polymerase forms RNA copies. The result of the initial RNA(+) isothermal amplification is its reverse complementary sequence (RC): RNA(-). This NASBA amplicon is the starting point of step 2. (Step 2) Apta-SMART (Mango) detection (fixed at 41°C) is initiated by adding SMART probes, enzymes, NTPs and dNTPs (the latter are optional because the remaining dNTPs in step 1 are sufficient for SMART to achieve optimal results). The scheme shows the hybridization of the first DNA probe (left) and the second DNA probe (right) with the ssRNA target (in the example) or the DNA target. The second DNA probe contains a hybridization region with ssRNA (or DNA) and a 3WJ formation region (the first probe and the second probe hybridize), a T7 promoter region (in the form of a reverse complementary sequence (RC)), and a Mango aptamer sequence (in the form of an RC). During SMART, the activity of Bst polymerase (Bst pol) extends the first probe from 3' to 5', while the activity of T7 RNA polymerase (T7 RNApol) forms an RNA copy of the Mango aptamer sequence (sense strand), which emits 535nm fluorescence after excitation at a wavelength of 510nm in the presence of the fluorophore TO1-biotin, which is an indirect proportional measurement of the presence of the ssRNA target.

[0081] Figure 3. Diagram of the combination of NASBA, Exo-CIP treatment and Apta-SMART protocols. Apta-SMART reactions (1 hour at 41°C) can be performed directly after NASBA isothermal amplification (1.5 hours at 37°C) by adding dNTPs (+dNTPs, far left square) to the mix (in addition to the always required SMART probe, enzyme and NTPs) or without adding them (-dNTPs, left square) (on the left side of the diagram), or by performing Exo-CIP treatment (right square) (to clean up DNA primers and dephosphorylate remaining dNTPs), which is performed by 4 minutes at 37°C and 1 minute at 80°C (to inactivate the enzyme), and then continuing with Apta-SMART (41°C) by adding (+dNTPs, lower left square) or without adding dNTPs (-dNTPs, lower right square).

[0082] Figure 4 . Scheme of SMART DNA probes with Mango aptamers for sequence detection of E. coli 23S rRNA is detailed. The segments of each probe (SEQ ID NO: 1 and 2) are detailed. These include the region for ssRNA target binding (the foot of the first probe (SEQ ID NO: 1) and the second probe (SEQ ID NO: 2), shown in bold) and the region that hybridizes to form a three-way junction structure (3WJ in the scheme), the reverse complement of the T7 promoter (sequence shown in bold), and the reverse complement of the Mango aptamer (gray square). In addition, in the second probe, the 18-atom hexaethylene glycol spacer (iSp18) between the ssRNA target binding region and the start of 3WJ is indicated, as well as the terminal 3'-amino group (to prevent 3'-end extension) (NH3, dark gray box). The lengths of the spacer (0-6nt-gap-) and 3WJ (6-8nt) between the two annealed probes are also indicated (in nucleotides, nt), as well as the minimum length of the foot region of the first and second probes (15-30-nt). The regions hybridizing to the ssRNA target in the first and second probes, the 3WJ formation segment and the T7 promoter were the same as those reported in Wharam et al. Nucl Acids Res, 2001.

[0083] Figure 5Apta-SMART (Mango aptamer) detection of 1.75 and 17.5 nM E. coli 16S synthetic RNA (sRNA) using different lengths of inter-probe 3WJ hybridization regions. Panel (A) shows the raw fluorescence units (RFU) of the Mango-TO1 complex after hybridization of the E. coli 16S rRNA first probe, which hybridized between probes of 2nt, 4nt, 6nt, 8nt, 10nt and 15nt (SEQ ID NO: 10, 11, 12, 7, 14 and 15) and the common second probe (SEQ ID NO: 8) with the sRNA target (SEQ ID NO: 13). Panel (B) shows the fold change of the tested samples with sRNA compared to the no sRNA control. The results of panels A and B represent the mean ± standard deviation of the fluorescence measurements of 3 independent experiments (for 8nt and 6nt), or the results of a single experiment (for 15nt, 10nt, 4nt and 2nt, the latter using only 17.5 nM sRNA concentration). Panel (C) shows the raw fluorescence units (RFU) of the Mango-TO1 complex after hybridization of the E. coli 16S rRNA first probe, which has 3WJs of 6, 8, 10 and 15 nt (SEQ ID NOs: 12, 7, 14 and 15) and the common second probe (SEQ ID NO: 8) with the sRNA target (SEQ ID NO: 13) without using Bst polymerase in the SMART reaction (only T7 RNA polymerase was added). Panel (D) shows the fold change of the no RNA control with sRNA compared to the same sample in panel (C). The results of panels C and D represent the fluorescence measurements of a single experiment.

[0084] Figure 6 Apta-SMART (Mango aptamer) detection of synthetic RNA (sRNA) at 1.75nM and 17.5nM using different inter-probe distances of E. coli 16S rRNA and RNA targets. Panel (A) shows the raw fluorescence units (RFU) of the Mango-TO1 complex after hybridization of the E. coli 16S rRNA first probes, which are 0-nt, 1-nt, 2-nt, 4-nt and 6-nt (SEQ ID NOs: 7, 16, 17, 18 and 19) from each other after binding to the sRNA target (SEQ ID NO: 13) using a common second probe (SEQ ID NO: 8). Panel (B) shows the fold change of the tested samples with sRNA compared to the no RNA control. The results represent the mean ± standard deviation of 2 independent experiments (for 0-nt, 1-nt and 2-nt), or the results of a single experiment (for 4-nt and 6-nt).

[0085] Figure 7Apta-SMART (Mango aptamer) detection of 17.5 nM E. coli 16S synthetic RNA (sRNA) using different lengths of hybridization regions between probe and target. Panel (A) shows the raw fluorescence units of Mango-TO1 (510 nm-exc- and 535 nm-emi-wavelengths) complexes after SMART reaction of E. coli 16S first probes (SEQ ID NOs: 7, 20, 21 and 22) with 29-nt, 22-nt, 15-nt or 7-nt hybridization regions and second probes of the same length hybridization regions (SEQ ID NOs: 8, 23, 24 and 25) in the presence (+sRNA) and absence (no RNA) of 17.5 nM E. coli 16S synthetic RNA (75-nt, SEQ ID NO: 13). Panel (B) shows the fold change in the presence of sRNA compared to the no RNA control in the same samples tested. Panel (C) shows the raw fluorescence units of Mango-TO1 (510 nm-exc- and 535 nm-emi-wavelengths) complexes ...D) shows the raw fluorescence units of Mango-TO1 (510 nm-exc- and 535 nm-emi-wavelengths) complexes in the presence of sRNA compared to the no RNA control in the same samples tested. Panel (E) shows the raw fluorescence units of Mango-TO1 (510 nm-exc- and 535 nm-emi-wavelengths) complexes in the presence of sRNA compared to the no RNA control in the same samples tested. Panel (F) shows the raw fluorescence units of Mango-TO1 (510 nm 6 CFU / mL (10e6 CFU / mL) or 10 2 Raw fluorescence units of Mango-TO1 complex after SMART reaction of E. coli 16S first probes (SEQ ID NOs: 7, 20, 21 and 22) with 29-nt, 22-nt, 15-nt or 7-nt hybridization regions and second probes (SEQ ID NOs: 8, 23, 24 and 25) of the same length hybridization regions in the presence of NASBA products of E. coli culture at 10 CFU / mL (10e2 CFU / mL). Panel (D) shows the fold change of NASBA products compared to NASBA without RNA (control) for the samples tested. Results for all graphs represent the mean of fluorescence measurements of independent experiments ± standard error of the mean of the data points for each replicate.

[0086] Figure 8 SMART reaction and detection by molecular beacon. SMART reaction was performed at 41°C for 1 hour as described previously (see Fig. 22 ), where detection is accomplished by the interaction of a molecular beacon (MB) with an RNA detection sequence (in the form of a reverse complement (RC)). Once bound, the hairpin-shaped MB (containing a quencher-Q- and a reporter-R-fluorophore on the 3' and 5' sides, respectively, which do not emit fluorescence when forming a stem) changes conformation, thereby opening to bind the detection sequence, the quencher and reporter separate, and the reporter emits fluorescence (different wavelengths depending on the fluorophore used). In Example 4, 5'-6-FAM is used as a reporter (R), 3'-Dabcyl is used as a quencher (Q), and the fluorescence signal from the MB / target hybrid is read at 495nm (excitation-exc-) and 520nm (emission-emi-).

[0087] Fig. 9 Apta-SMART (Mango aptamers) and molecular beacon (MB) detection of SARS-CoV-2 using synthetic RNA (sRNA) fragments of the S "spike" ssRNA at increasing concentrations (1.75, 17.5, and 175 nM). Panel (A) shows the raw fluorescence units (RFU) of Mango-TO1 for SARS-CoV-2 sRNA (SEQ ID NO: 28) using the first and second probes (SEQ ID NO: 26 and 27). Panel (B) shows the RFU of MB detection using the first probe (SEQ ID NO: 26), the modified second probe (SEQ ID NO: 30), and MB (SEQ ID NO: 31) with the addition of SARS-CoV-2 sRNA (SEQ ID NO: 28). Panel (C) shows the fold change in Mango-TO1 with sRNA relative to the no RNA control, and panel (D) shows the calculated fold change for MB detection. In panels (B) and (D), the tested concentrations of MB were 300, 100, and 10 nM. Mango aptamer fluorescence (510nm-exc- and 535nm-emi-) was measured in the presence of 480nM TO1-biotin fluorophore substrate. Fluorescence signals from hybridized MB / target were read at 495nm (exc) and 520nm (emi). Results represent mean ± SD of 4 independent experiments.

[0088] Fig.10 Apta-SMART (Mango aptamers) versus molecular beacon (MB) detection of SARS-CoV-2 following NASBA amplification of the S "spike" RNA region fragment. Panel (A) shows the raw fluorescence units (RFU) of Mango-SMART detection of the SARS-CoV-2 S "spike" RNA region (SEQ ID NO: 29) after NASBA amplification using the first and second probes (SEQ ID NOs: 26 and 27) in three SARS-CoV-2 RNA samples (#3 - black bars; #4 - dark grey bars; and #8 - light grey bars) as well as the NASBA no RNA control (black dashed bars) and no RNA control (white bars). Panel (B) shows the detection of the same samples by MB (SEQ ID NO: 31) at three different concentrations (300, 100, and 10 nM) (each using the first and second probes, SEQ ID NOs: 26 and 30). Panels (C, D) show the fold changes of the data in panels (A) and (B) for the NASBA samples normalized to the NASBA no RNA control. The contents of these three SARS-CoV-2 RNA samples were previously analyzed by standard qPCR methods and by C tAmplification values ​​of 13.23 (NASBA#3), 20.80 (NASBA#4) and 22.66 (NASBA#8) were confirmed as positive. Mango aptamer fluorescence (510nm-exc- and 535nm-emi-) was measured in the presence of 480nM TO1-biotin fluorophore substrate. Fluorescence signals from hybridized MB / targets were read at 495nm (exc) and 520nm (emi). Results represent mean ± SD of 4 independent experiments. No RNA control was omitted in the fold change graphs because it was used only as background RFU value.

[0089] Fig.11 Apta-SMART detection of E. coli 16S rRNA by SMART probes and 75-nt synthetic RNA (sRNA) fragments. The aptamers and substrates used were Mango and TO1-biotin. Panel (A) shows the raw fluorescence units (RFU) of Mango-TO1 detection (510nm-exc- and 535nm-emi-wavelengths) using E. coli 16S sRNA (SEQ ID NO: 13) using the first and second probes (SEQ ID NO: 7 and 8); Panel (B) shows the fold change of fluorescence detection in the presence of sRNA compared to the absence of RNA (ctrl = control). Data represent the mean ± SD of fluorescence readings at 1 hour after SMART detection for 9 independent experiments.

[0090] Fig.12 Apta-SMART detection of E. coli 23S rRNA by 23S SMART probe and 79-nt synthetic RNA (sRNA) fragment of E. coli 23S rRNA. Panel (A) shows the raw fluorescence units (RFU) of Mango-TO1 detection (510nm-exc- and 535nm-emi-wavelengths) using the first and second probes (SEQ ID NO: 35 and 36) and sRNA (SEQ ID NO: 39). Panel (B) shows the fold change of fluorescence detection in the presence of sRNA compared to the absence of RNA (ctrl = control). Data represent the mean ± standard deviation of fluorescence readings at 1 hour after SMART detection of 6 independent experiments.

[0091] Fig.13Apta-SMART detection of S. aureus mecA by mecASMART probe and 98-nt synthetic RNA fragment. Panel (A) shows the raw fluorescence units (RFU) of Mango-TO1 detection (510nm-exc- and 535nm-emi-wavelengths) using the first and second probes (SEQ ID NO: 40 and 41) and sRNA (SEQ ID NO: 44). Panel (B) shows the fold change of fluorescence detection in the presence of sRNA compared to the absence of RNA (ctrl = control). Data represent the mean ± SD of fluorescence readings at 1 hour after SMART detection from 6 independent experiments.

[0092] Fig.14 .Apta-SMART detection of the SARS-CoV-2 "spike" S RNA 30-nucleotide synthetic RNA (sRNA) region using SARS-CoV-2 probes. Panel (A) shows the raw fluorescence units (RFU) of the Mango-TO1 detection (510nm-exc- and 535nm-emi-wavelengths) using the first and second probes (SEQ ID NOs: 26 and 27) and sRNA (SEQ ID NO: 28). Panel (B) shows the fold change of fluorescence detection in the presence of sRNA versus the absence of RNA (ctrl = control). Data represent the mean ± standard deviation of fluorescence readings at 1 hour after SMART detection from 4 independent experiments.

[0093] Fig.15 Mango-SMART detection of influenza A and influenza B synthetic RNA (sRNA) regions using influenza A and influenza B specific probes. Panel (A) shows the raw fluorescence units (RFU) of Mango-TO1 detection (510nm-exc- and 535nm-emi-wavelengths) using specific first and second probes for influenza A (SEQ ID NOs: 45 and 47) and influenza B (SEQ ID NOs: 46 and 48), and 17.5nM of influenza A or influenza B sRNA (SEQ ID NOs: 49 and 50, respectively). Panel (B) shows the fold change of fluorescence detection with sRNA compared to no RNA data points (ctrl = control). Data represent the mean ± standard deviation of fluorescence readings at 1 hour after SMART detection of independent experiments performed in duplicate.

[0094] Fig.16Apta-SMART detection of the E. coli 16S rRNA region by SMART probes after NASBA amplification. Panel (A) shows the first and second probes (SEQ ID NOs: 7 and 8) for the detection of no RNA (ctrl = control), NASBA no RNA, and 10 RNA from 1 mL LB inoculated with SMART reaction mixtures after addition (+dNTPs) and without addition (-dNTPs). 2 and 10 6 Raw fluorescence units (RFU) of the NASBA product (SEQ ID NO: 9) of CFU E. coli for Mango-TO1 detection (510 nm-exc- and 535 nm-emi-wavelengths). Panel (B) shows the RFU from the Mango-TO1 complex using the first and second probes (SEQ ID NO: 7 and 8) for the same samples after NASBA with ExoCIP treatment, with (+dNTPs) and without (-dNTPs) addition to the SMART reaction mixture (see Figure 3 Figure (C) shows the fold change in fluorescence detection of samples without ExoCIP treatment in Figure A, where 10 2 and 10 6 Signals for CFU / mL NASBA reactions were normalized to NASBA no RNA controls. Panel (D) shows the fluorescence fold change for ExoCIP treated samples in panel B (normalized to NASBA no RNA). No RNA (ctrl) was omitted for normalization as it was used only as background RFU. Data represent mean ± SD of fluorescence readings at 1 hour after SMART assay from at least 3 independent experiments.

[0095] Fig.17 .Apta-SMART detection of the E. coli 23S rRNA region using the 23S SMART probe after NASBA amplification. Figure (A) shows the use of the first and second probes (SEQ ID NOs: 35 and 36) to detect the no RNActrl (control), NASBA no RNA, and 10 4 and 10 6 Raw fluorescence units (RFU) of CFU E. coli in the Mango-TO1 assay (510nm-exc- and 535nm-emi-wavelengths). Panel (B) shows the fold change in fluorescence assay (10 4 and 10 6Signals from NASBA amplicons were normalized to NASBA no RNA controls). No RNA (ctrl) was not used for normalization (used only as background RFU). Data represent mean ± SD of fluorescence readings at 1 hour after SMART assay from at least 3 independent experiments.

[0096] Fig.18 Apta-SMART detection of the reverse complementary sequence RNA region of S. aureus mecA (NASBA product) by mecASMART probe. Panel (A) shows the raw fluorescence units (RFU) of the Mango-TO1 detection (510nm-exc- and 535nm-emi-wavelengths) using the first and second probes (SEQ ID NO: 40 and 41). Panel (B) shows the fold change of fluorescence detection in the presence of NASBA product (SEQ ID NO: 42) relative to the NASBA no RNA control. Data represent the mean ± standard deviation of fluorescence readings at 1 hour after SMART detection of 6 independent experiments.

[0097] Fig.19 .Apta-SMART detection of the SARS-CoV-2S "spike" RNA region using the SARS-CoV-2SMART probe after NASBA amplification. Figure (A) shows the raw fluorescence units (RFU) of the Mango-TO1 detection (510nm-exc- and 535nm-emi-wavelengths) of three SARS-CoV-2 RNA samples (#1, black bars; #3, dark gray bars; and #7, light gray bars) after NASBA amplification using the first and second probes (SEQ ID NOs: 26 and 27), as well as the NASBA no RNA control (black dashed line) and the no RNA control (white bar). Figure (B) shows the fold change in fluorescence detection in the presence of NASBA amplicons compared to the NASBA no RNA control. The RNA content of these three SARS-CoV-2 RNA samples had been previously analyzed by standard qPCR methods and by C t Amplification values ​​of 18 (NASBA#1), 7.5 (NASBA#3), and 24 (NASBA#7) were confirmed as positive. Data represent the mean ± standard deviation of fluorescence readings at 1 hour after SMART assay from 6 independent experiments.

[0098] Fig. 20Apta-SMART detection of E. coli 16SrRNA by Broccoli-SMART probe and 75-nt synthetic RNA (sRNA) fragment. The aptamers and substrates used were Mango and TO1-biotin, or Broccoli and DFHBI or DFHBI-1T. Panel (A) shows the raw fluorescence units (RFU) of RNA aptamer-substrate detection using a common first probe (SEQ ID NO: 7) and a second probe (SEQ ID NO: 8 for Mango and SEQ ID NO: 58 for Broccoli aptamer) and sRNA (SEQ ID NO: 13) (510nm-exc- and 535nm-emi-wavelengths for Mango and 472nm-exc- and 507nm-emi-wavelengths for Broccoli). Panel (B) shows the fold change of fluorescence detection in the presence of sRNA compared to the absence of RNA (ctrl = control). Data represent the fluorescence readings at 1 hour after SMART detection for a single experiment.

[0099] Fig.21 Apta-SMART detection of the SARS-CoV-2 S "spike" 30 nucleotide RNA region using SARS-CoV-2 first and second probes. The aptamers and substrates used were Mango and TO1-biotin, or Broccoli and DFHBI or DFHBI-1T. Panel (A) shows the raw fluorescence units (RFU) of the RNA aptamer-substrate complex using a common first probe (SEQ ID NO: 26) and a second probe (SEQ ID NO: 27 for Mango and SEQ ID NO: 59 for Broccoli aptamer) and sRNA (SEQ ID NO: 28) (510nm-exc- and 535nm-emi-wavelengths for Mango and 472nm-exc- and 507nm-emi-wavelengths for Broccoli). Panel (B) shows the fold change in fluorescence detection in the presence of synthetic RNA compared to the absence of RNA (ctrl = control). Data represent the average of fluorescence readings at 1 hour after SMART detection for a single experiment.

[0100] Fig. 22.SMART and SMART plus amplified RNA probe detection schemes. (A) SMART detection method (performed isothermally at 41°C for 1 hour) showing the hybridization of the first and second DNA probes to the DNA or ssRNA target (in the example). The second DNA probe contains a hybridization region with the DNA or ssRNA and a 3WJ forming region, a T7 promoter region (in the form of a reverse complementary sequence (RC)) and a detection sequence. During SMART, the activity of Bst polymerase (Bst pol) extends the first probe from 3' to 5', while the activity of T7 RNA polymerase (T7 RNApol) forms an RNA copy of the detection sequence (which can be detected by different methods, see below for details). (B) SMART detection method as shown in (A), including an amplified RNA probe containing a complementary sequence to RNA (1) (the product of T7 RNApol) and a T7 promoter. Once RNA (1) binds again to its complementary sequence, the combined activities of Bst pol and T7 RNApol will produce several copies of the so-called RNA (2), which can be detected by any detailed RNA detection method. The protocol and procedures were adapted from Wharam et al. Nucl Acids Res, 2001.

[0101] Fig.23 One-pot NASBA-Apta-SMART detection of E. coli 23S rRNA region using the first and second probes for E. coli 23S. Panel (A) shows the detection of 10 cells inoculated in 1 mL LB without RNActrl (control) using the first and second probes (SEQ ID NOs: 35 and 76). 6 The raw fluorescence units (RFU) of the Mango-TO1 assay (510 nm-exc- and 535 nm-emi-wavelengths) of CFU E. coli and E. coli 23S sRNA (SEQ ID NO: 39) as a SMART positive control at 1, 1.5, and 2 hours after the start of the reaction. Panel (B) shows the fold change of fluorescence detection (10 6 Signals for NASBA amplicons and E. coli 23S sRNA were normalized to a no-RNA control.) Data represent the mean fluorescence readings at 1, 1.5, and 2 hours after the start of the NASBA-Apta-SMART one-pot assay from a single experiment.

[0102] Fig.24.One-pot NASBA-Apta-SMART assay using SARS-CoV-2 first probe and probe for SARS-CoV-2 S "spike" RNA region. Panel (A) shows the raw fluorescence units (RFU) of Mango-TO1 assay (510nm-exc- and 535nm-emi-wavelengths) using first and second probes (SEQ ID NO: 26 and 78) for two SARS-CoV-2 RNA samples (#1: black bar, #2: dark grey bar) as well as 30 nucleotide synthetic sRNA (SEQ ID NO: 28; light grey bar) and no RNA control (white bar). Panel (B) shows the fold change in fluorescence detection in the presence of NASBA amplicons compared to no RNA control. The RNA content of these two SARS-CoV-2 RNA samples had been previously analyzed by standard qPCR methods and confirmed as positive by Ct amplification values ​​of 11.98 (RNA#1) and 29.00 (RNA#2). Data represent the mean fluorescence readings at 1, 1.5 and 2 hours after the start of the NASBA-Apta-SMART one-pot assay from a single experiment.

[0103] Fig.25 One-pot NASBA-Apta-SMART detection of the E. coli 23S rRNA region using the first and second probes of E. coli 23S and exchange of RNA polymerases. Figure (A) shows the first and second probes (SEQ ID NO: 35 and 36) for the detection of 10 cells inoculated in 1 mL LB without RNActrl (control). 6 The raw fluorescence units (RFU) of the Mango-TO1 assay (510 nm-exc- and 535 nm-emi-wavelengths) of CFU E. coli and E. coli 23S sRNA (SEQ ID NO: 39) as a SMART positive control at 1, 1.5, and 2 hours after the start of the reaction. Panel (B) shows the fold change of fluorescence detection (10 6 Signals for NASBA amplicons and E. coli 23S sRNA were normalized to a no-RNA control.) Data represent fluorescence readings at 1, 1.5, and 2 hours after initiation of the NASBA-Apta-SMART one-pot assay from a single experiment.

[0104] Fig.26 One-pot NASBA-Apta-SMART detection of the mecA gene region of Staphylococcus aureus using the first and second mecA probes. Figure (A) shows the first and second probes (SEQ ID NOs: 40 and 81) for the detection of 10 cells inoculated in 1 mL LB without RNActrl (control). 6Raw fluorescence units (RFU) of CFU S. aureus and S. aureus mecA sRNA (SEQ ID NO: 44) as a SMART positive control in Mango-TO1 assay (510 nm-exc- and 535 nm-emi-wavelengths) 1, 1.5, and 2 hours after the start of the reaction. Panel (B) shows the fold change of fluorescence assay (10 6 Signals for NASBA amplicons and S. aureus mecA sRNA were normalized to a no-RNA control.) Data represent the mean fluorescence readings at 1, 1.5, and 2 hours after the start of the NASBA-Apta-SMART one-pot assay from a single experiment.

[0105] Fig. 27 . Apta-SMART detection of two adjacent regions of E. coli 23S rRNA by 23S SMART probes after NASBA amplification. Figure (A) shows the detection of no RNA control, NASBA no RNA, 10 E. coli inoculated in 1 mL LB using two pairs of first and second probes (region R1 is SEQ ID NO: 35 and 36, region R2 is SEQ ID NO: 83 and 84). 6 Raw fluorescence units (RFU) of Mango-TO1 assay (510 nm-exc- and 535 nm-emi-wavelengths) for CFU E. coli and synthetic E. coli 23S sRNA of region R1 (SEQ ID NO: 39). Panel (B) shows the fold change of fluorescence assay (10 6 Signals from NASBA amplicons were normalized to a NASBA no RNA control, and sRNA signals were normalized to a no RNA control).

[0106] General Definition

[0107] It must be noted that, as used herein, the singular forms "a", "an", and "the" include plural references unless the context clearly indicates otherwise. Furthermore, the term "at least" preceding a series of elements should be understood to refer to every element in the series unless otherwise indicated. Those skilled in the art will recognize or be able to ascertain using only routine experimentation many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed in the present invention.

[0108] When referring to a given amount or quantity, the term "about" is intended to include a deviation of plus or minus ten percent, preferably five percent.

[0109] As used herein, the connection term "and / or" between multiple referenced elements is understood to cover individual and combined options. For example, when two elements are connected by "and / or", the first option refers to the applicability of the first element without the second element. The second option refers to the applicability of the second element without the first element. The third option refers to the applicability of the first element and the second element together. Any of these options is understood to fall within this meaning and therefore meets the requirements of the term "and / or" as used herein. The simultaneous applicability of more than one option is also understood to fall within this meaning and therefore meets the requirements of the term "and / or".

[0110] Throughout the specification and claims, unless the context requires otherwise, the words "comprise, comprises and comprising" and variations will be understood to imply the inclusion of the stated integers or steps, or groups of integers or steps, but not the exclusion of any other integers or steps, or groups of integers or steps. When used herein, the term "comprising" may be replaced by the terms "containing" or "including", or sometimes when used herein, by the term "having". Any of the foregoing terms (comprising, containing, including, having), whenever used in the context of aspects or embodiments of the invention, may be replaced by the term "consisting of", although less preferred.

[0111] When "consisting of..." is used herein, any element, step or ingredient not specified in the claim elements is excluded. When used herein, "consisting essentially of..." does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0112] In the context of the present invention, reference is made to a "part," "region," "fragment," or "segment" of a nucleotide sequence. A "part," "region," "fragment," or "segment" herein refers to a specific nucleotide sequence that is optionally contained in a longer nucleotide sequence. Therefore, "part," "region," "fragment," or "segment" should be considered synonyms and can be used interchangeably to refer to a specific nucleotide sequence.

[0113] The terms "complementary" and "complementarity" are interchangeable and refer to the ability of polynucleotides to form base pairs with each other. Base pairs are usually formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide chains or regions. Complementary polynucleotide chains or regions can be base paired (e.g., A and T, A and U, C and G) in a Watson-Crick manner. 100% (or complete) complementarity refers to the situation where each nucleotide unit of a polynucleotide chain or region can form hydrogen bonds with each nucleotide unit of a second polynucleotide chain or region. Incomplete (or partial) complementarity refers to the situation where some (but not all) nucleotide units of two chains or two regions can form hydrogen bonds with each other, which can be expressed as a percentage. Please note that the term "complementary" used in the present invention also includes the term "substantially complementary". When the complementarity percentage between two regions is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 100%, the region is "substantially complementary" to the target region. A region is "substantially complementary" to another region if it hybridizes to the other region under low stringency conditions, preferably under medium stringency conditions, and most preferably under high stringency conditions. Similarly, when the term "non-complementary" is used herein, it is understood that the term also encompasses the term "substantially non-complementary". A region is "substantially non-complementary" to another region when the complementarity between the two regions is less than 40%, less than 30%, less than 20%, preferably less than 10%, most preferably less than 5%, or even most preferably 0%. A region is "substantially non-complementary" to another region if it does not hybridize to the other region under high stringency conditions, preferably under medium stringency conditions, and most preferably under low stringency conditions.

[0114] The "sequence identity percentage" of polynucleotides and polypeptides is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may include additions or deletions (i.e., gaps) compared to the reference sequence (not including additions or deletions) to achieve optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleobase or amino acid residue appears in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and then multiplying the result by 100 to obtain the sequence identity percentage. The optimal alignment of sequences for comparison can be performed by computer implementation of known algorithms (BLAST in the resources of the National Center for Biotechnology Information; CLUSTAL in the resources of the European Bioinformatics Institute; GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.) or by inspection. "Identity percentage" can be calculated based on a global alignment, the purpose of which is to align two or more sequences over their entire span. However, "identity percentage" is preferably calculated based on local alignment, i.e. based on the alignment of local similar regions between the nucleobase sequences. Preferably, "identity percentage" is calculated using a local alignment comparison algorithm, such as the BLAST tool.

[0115] The term "hybridization" is used to refer to the structure formed by two independent RNA strands that form a double-stranded structure by base pairing from one strand to the other. These base pairs are considered to be GC, AU / T and GU (A-adenine, C-cytosine, G-guanine, U-uracil, T-thymine). As with complementarity, hybridization can be complete or partial. In the context of the present invention, each uracil and thymine base can be optionally replaced by a thymine or uracil base, respectively.

[0116] Due to the complementarity of base pairing between nucleic acid polymers, a double-stranded DNA molecule will consist of two chains with sequences that are reverse complementary to each other. To help molecular biologists specifically identify each chain separately, the two chains are usually distinguished as "sense" and "antisense". If the nucleotide sequence of one DNA chain directly corresponds to the sequence of an RNA transcript that is translated or can be translated into an amino acid sequence (provided that any thymine bases in the DNA sequence are replaced by uracil bases in the RNA sequence), then this DNA chain is called sense (also called positive (+) or simply sense). The other chain of the double-stranded DNA molecule is called negative sense (also called negative (-) or antisense), which is reverse complementary to the sense chain and RNA transcript. In fact, the antisense chain is used as a template for RNA polymerase to build RNA transcripts, but the complementary base pairing that occurs in nucleic acid polymerization means that the sequence of the RNA transcript looks the same as the sense chain, except that the RNA transcript uses uracil instead of thymine. Therefore, the "reverse complementary sequence" of a DNA / RNA element or region (i.e., a promoter) refers herein to the reverse, complementary, or reverse complementary corresponding sequence of the sense. For example, the sense sequence of the T7 promoter is "TAATACGACTCACTATA", and its reverse complementary sequence is "TATAGTGAGTCGTATTA".

[0117] "Functional RNA promoter" or "functional double-stranded RNA polymerase promoter" refers herein to a sequence that is recognized by RNA polymerase and causes RNA synthesis in the presence of a suitable polymerase and reagent. The term "functional RNA promoter" or "functional double-stranded RNA polymerase promoter" includes the term "substantially functional", which for the purposes of the present invention can be defined as a nucleic acid complex having at least 20% or more (preferably at least 50%, more preferably at least 75%, and most preferably at least 90%) of the promoter activity of a fully double-stranded wild-type promoter sequence, the relative amount of promoter activity being measured by quantifying the amount of a given RNA transcript produced by the promoter in a given time under equivalent conditions (e.g., temperature and ribonucleotide triphosphate concentration).

[0118] "Probe" herein refers to a DNA or RNA nucleotide sequence, preferably single-stranded, used to search for and detect a target nucleic acid. The probe is placed in contact with a sample under conditions that allow the probe sequence to hybridize with the target nucleic acid.

[0119] A "functional RNA aptamer transcript" herein refers to an aptamer RNA sequence that is capable of emitting fluorescence upon addition of its corresponding fluorophore ligand.

[0120] The "three-way junction structure" or "3WJ structure" herein refers to a branched nucleic acid formed by hybridization of at least three partially complementary nucleotides, which form three double helical arms connected at the junction point, with a certain number of unpaired bases present or absent in one or more of the three different chains. The 3WJ structure is the simplest and most common branched nucleic acid. For further definition and examples of 3WJ structures, see, e.g., Wu, B., Girard, F., van Buuren, B., Schleucher, J., Tessari, M., & Wijmenga, S. (2004). Global structure of a DNA three-way junction by solution NMR: towards prediction of 3H fold. Nucleic acids research, 32(10), 3228–3239. https: / / doi.org / 10.1093 / nar / gkh645. The 3WJ structure may also be named 3H or HHH structure according to IUPAC nomenclature (see Lilley DM, Clegg RM, Diekmann S, Seeman NC, von Kitzing E, Hagerman P. Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB). A nomenclature of junctions and branch points in nucleic acids. Recommendations 1994. Eur J Biochem. 1995May 15;230(1):1-2.doi:10.1111 / j.1432-1033.1995.tb20526.x.PMID:7601087.).

[0121] The "3WJ structure of the present invention" herein refers to a 3WJ structure formed by hybridization of a first and a second nucleic acid probe target nucleic acid or a nucleic acid of interest as defined in the first and second aspects of the present invention or any of their embodiments below. The 3WJ structure of the present invention is characterized in that it comprises a first and a second probe or consists of a first and a second probe, wherein each probe comprises a foot region and an arm region, wherein the foot region of the first probe is located in the 5' region of the first probe and is complementary to and hybridizes with the first part of the target nucleic acid, and the arm region of the first probe is located in the 3' region of the first probe and is not complementary to the target nucleic acid but is complementary to the arm of the second probe; wherein the foot region of the second probe is located in the 3' region of the second probe and is complementary to and hybridizes with the second part of the target nucleic acid, and the arm region of the second probe is located in the 5' region of the second probe and is complementary to the arm region of the first probe, and preferably comprises in the 5' to 3' direction:

[0122] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0123] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0124] - a region of between 5 and 9 nucleotides, preferably between 6 and 8 nucleotides, which is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region of 5 to 9 nucleotides is fully or partially contained in the full-length reverse complementary sequence of a DNA-guided RNA polymerase promoter,

[0125] And wherein the first part and the second part are adjacent or substantially adjacent, preferably wherein the first part and the second part are separated by 0 to 10 nucleotides, more preferably 0 to 6 nucleotides, so that when the first and second probes hybridize with their foot regions to the target nucleic acid and hybridize with their arm regions to each other, the 3WJ structure of the present invention is formed. Figure 4 Representation of the 3WJ structure of the invention with exemplary sequences and target nucleic acids is reproduced. DETAILED DESCRIPTION

[0126] The SMART (Signal-Mediated RNA Amplification Technology) test offers advantages over PCR-based methods in that it is an isothermal method and simplifies the technology and protocols, thereby moving molecular diagnostics from centralized laboratories with specialized equipment and personnel to the point of care.

[0127] Typically, SMART assays involve the use of a first and a second probe that are capable of forming a so-called three-way junction (3WJ) structure in the presence of a target nucleic acid, such as Figure 4As shown. In addition, the SMART method includes a detection step, which usually means adding at least another probe (e.g., a molecular beacon) to detect the RNA transcripts produced after the 3WJ structure is formed. However, adding further probes usually sacrifices specificity and efficiency because they need to effectively hybridize with the target transcript before they can be detected. The authors of the present invention have found a method for improving the SMART assay detection step, namely by directly measuring the RNA transcripts produced during the method without adding more molecules hybridized therewith. This is achieved by including at least one RNA aptamer sequence in the arm of the second probe, which will produce functional RNA aptamer transcripts after transcription, and these transcripts will be directly detected after adding their corresponding fluorophore ligands. In this way, detection is direct detection, rather than detection based on intermediate molecules (e.g., molecular beacons).

[0128] The method disclosed herein is called the Apta-SMART method, as shown in Example 5, Fig. 9 and Fig.10 As shown, this method can more effectively detect low concentrations of target nucleic acid than using molecular beacon probes. In addition, it is also shown herein that this method can be implemented after an isothermal amplification method (e.g., the NASBA method). Fig.16 As shown in Example 11, the Mango-SMART assay after NASBA assay was able to detect up to 10 2 Finally, another advantage of this method is that it can be performed in one pot, as shown in Examples 17 to 20, which further increases the efficiency of the method and can be performed in a single tube.

[0129] In view of this, the first aspect of the present invention provides a structure formed by a hybridization reaction comprising three nucleic acid molecules, hereinafter referred to as a "three-way junction structure" or "3WJ structure". "3WJ structure" is defined herein as a branched nucleic acid structure comprising a target nucleic acid molecule and a first and a second nucleic acid probe molecule; wherein the first probe includes a foot region complementary to the first portion of the target and hybridized therewith, and an arm region that is not complementary to the target nucleic acid; wherein the second probe includes a foot region complementary to the second portion of the target, so that the foot region of the second probe hybridizes with a target adjacent to or substantially adjacent to the foot region of the first probe, and the second probe also includes an arm region that is not complementary to the target nucleic acid but complementary to and hybridized to the arm region of the first probe; and wherein the formation of the 3WJ structure results in the production of a functional double-stranded RNA polymerase promoter and at least one fluorescent aptamer in the presence of a DNA-guided DNA polymerase, one chain of the promoter being provided by the extended arm of the first probe, and the other chain being provided by the arm of the second probe. This structure is also referred to herein as the "3WJ structure of the present invention".

[0130] The "foot region" herein refers to the region present in the first and second probes that is complementary to the first and second portions of the target nucleic acid, respectively. The "arm region" herein refers to the region in the first and second probes that is not complementary to the target nucleic acid. For the sake of clarity, reference to the first and second probes may also be referred to as the "extension" probe and the "template" probe, respectively.

[0131] In the second aspect, the present invention provides a method for detecting the presence of a target nucleic acid molecule in a sample, the method comprising the following steps: contacting a sample containing a target nucleic acid with a first and a second probe, each probe comprising a foot region complementary to the corresponding first and second parts of the target, the first and second parts being adjacent or substantially adjacent; wherein the first and second probes each further comprise an arm region that is not complementary to the target, wherein at least a portion of the arm region of the first probe is complementary to at least a portion of the arm region of the second probe, so that the corresponding foot regions of the first and second probes hybridize with the target, thereby allowing the complementary portions of the arm regions of the first and second probes to hybridize; thereby generating the 3WJ structure of the present invention, after the arm of the first probe is extended by a DNA-guided DNA polymerase, the 3WJ structure comprises a functional double-stranded RNA polymerase promoter and at least one fluorescent aptamer, one chain of the promoter and at least one fluorescent aptamer is provided by the first probe, and the other chain is provided by the second probe; thereby causing RNA synthesis of at least one fluorescent aptamer to be initiated by the RNA promoter; and detecting the at least one fluorescent aptamer synthesized in this way. Hereinafter, the method of the second aspect is also referred to herein as "the method of the present invention" or "the SMART method of the present invention".

[0132] Therefore, the method of the second aspect is a method for detecting the presence of a nucleic acid sequence of interest in a sample; the method comprises the following steps: a hybridization step, comprising contacting the first and second probes defined in the present invention with the sample to form the 3WJ structure of the first aspect of the invention (the 3WJ structure of the present invention), wherein the target nucleic acid is a sequence of interest or is formed due to the presence of a sequence of interest in the sample; an extension step, comprising adding a DNA-guided DNA polymerase under appropriate conditions so that the DNA-guided DNA polymerase has enzymatic activity; a transcription step, comprising adding a DNA-guided RNA polymerase under appropriate conditions so that the DNA-guided RNA polymerase has enzymatic activity; and a detection step, comprising directly detecting an RNA transcript of at least one fluorescent aptamer comprising the template portion of the first probe by adding a suitable fluorophore ligand.

[0133] In a preferred embodiment, the method of the second aspect of the present invention comprises the following steps:

[0134] a) adding the first and second nucleic acid probes to a sample containing a target nucleic acid so as to form a three-way junction (3WJ) structure of the present invention by hybridization between the target nucleic acid molecule, the first and second nucleic acid probes (hybridization step),

[0135] b) adding a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe (extension step);

[0136] c) adding a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) to cause de novo synthesis of a single-stranded nucleic acid comprising at least one fluorescent aptamer (transcription step); and

[0137] d) adding at least one fluorophore ligand of the at least one fluorescent aptamer, thereby directly detecting the de novo synthesized single-stranded nucleic acid comprising the at least one fluorescent aptamer, wherein the detection of the nucleic acid comprising the at least one fluorescent aptamer indicates the presence of the target nucleic acid in the sample (detection step),

[0138] Optionally, the method further comprises an amplification step before step a), wherein the target nucleic acid is amplified.

[0139] Thus, the method of the second aspect of the invention results in the formation of the composite or 3WJ structure of the first aspect.Thus, all embodiments disclosed herein, in particular the structural embodiments describing the first and second probes and the 3WJ structure, are applicable to the first and second aspects of the invention.

[0140] Crucially, the first and second probes hybridize only in the presence of a target nucleic acid. Those skilled in the art will know how to select appropriate conditions, materials and sequences of probes to ensure that the 3WJ structure occurs in a target-dependent manner. Nevertheless, we describe below some preferred embodiments of the 3WJ structure and method of the present invention.

[0141] As described above, the first probe includes a foot region that is complementary (including substantially complementary) to the first portion of the target nucleic acid, and an arm region that is not complementary (including substantially non-complementary) to the target nucleic acid. In one embodiment, the foot region is located in the 5' region of the first probe, and the arm region is located in the 3' region of the first probe. "In the 5' region" and "in the 3' region" herein refer to that the foot region and the arm region of the first probe are positioned toward the 5' or 3' end of the first probe or are located near the 5' or 3' end of the first probe, respectively. In one embodiment, the foot region of the first probe is located at a position that is less than 50, 40, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides from the 5' end of the first probe. More preferably, the foot region of the first probe is located exactly at the 5' end of the first probe. In one embodiment, the arm region of the first probe is located at a position that is less than 50, 40, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides from the 3' end of the first probe. More preferably, the arm region of the first probe is located just at the 3' end of the first probe. In one embodiment, the first probe comprises Figure 4 The elements shown, wherein the nucleotide sequence of the first probe is adjusted / modified according to various circumstances to hybridize with the target nucleic acid and the second probe.

[0142] The second probe includes a foot region that is complementary (including substantially complementary) to the second portion of the target nucleic acid, and an arm region that is not complementary (including substantially not complementary) to the target nucleic acid but includes a region that is complementary (including substantially complementary) to the arm region of the first probe. In one embodiment, the foot region is located in the 3' region of the second probe, and the arm region is located in the 5' region of the second probe. "In the 5' region" and "in the 3' region" herein refer to that the foot region and the arm region of the second probe are positioned toward the 5' or 3' end of the first probe, respectively, or are located near the 5' or 3' end of the second probe. In one embodiment, the foot region of the second probe is located at a position less than 50, 40, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides from the 3' end of the second probe. More preferably, the foot region of the second probe is located exactly at the 3' end of the second probe. In one embodiment, the arm region of the second probe is located less than 50, 40, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides from the 5' end of the second probe. More preferably, the arm region of the second probe is located just at the 5' end of the probe. In one embodiment, the foot region of the second probe hybridizes to the target in a region adjacent or substantially adjacent to the hybridization position of the foot region of the first probe, as will be further explained below. In one embodiment, the second probe comprises Figure 4 The elements shown in , wherein the nucleotide sequence of the second probe is adjusted / modified according to various situations to hybridize with the target nucleic acid and the first probe.

[0143] The total number of nucleotides forming the arm regions of the first and second probes is not limited as long as the arm regions do not hybridize to each other in the absence of the target. In essence, the degree of complementarity between the arm regions of the first and second probes must be such that, under the conditions employed, they will not hybridize unless stabilized by hybridizing the respective foot regions of the first and second probes to the target, thereby ensuring that the 3WJ structure of the first aspect and method of the present invention can only be completed in the presence of the target nucleic acid. Therefore, the arm regions of the first and second probes hybridize to each other only when the foot regions of the first and second probes have hybridized to the first and second parts of the target nucleic acid, respectively. Therefore, the 3WJ structure of the present invention is formed between the first probe, the second probe and the target nucleic acid only when the target nucleic acid is present in the sample. In one embodiment, the 3WJ structure is Figure 4 The structure shown in , wherein the specific nucleotide sequences of the first and second probes are adjusted / modified according to various situations to hybridize with the target nucleic acid to be detected.

[0144] Thus, before the DNA-guided DNA polymerase extends the arm of the first probe, the number of complementary bases between the arm regions of the first and second probes is usually no more than 25, usually less than 15, optimally 5 to 13 bases, and preferably 5 to 10 bases, so that the arm regions will not hybridize to each other in the absence of the target (under the detection conditions employed). In a preferred embodiment, the total length of the arm of the first probe before extension is less than 15, 14, 13, 12, 11, 10, 9, 8 or 7 nucleotides. Preferably, the length of the arm of the first probe before extension is at least 5 or 6 nucleotides, preferably 5 to 10 nucleotides, more preferably 5 to 9 nucleotides, and most preferably 6 to 8 nucleotides (see Figure 4 and Figure 5 ).

[0145] In one embodiment, before the extension step occurs, the region in the arm of the second probe that is complementary to the arm region of the first probe has at least 5 or 6 nucleotides, preferably 5 to 9 nucleotides, more preferably 6 to 8 nucleotides. Preferably, before the extension step occurs, the length of the region in the second probe that is complementary to the arm region of the first probe is 5 to 10 nucleotides, preferably 6 to 8 nucleotides. In a preferred embodiment, the total length of the arm of the second probe is between 150 and 50 nucleotides, between 100 and 50 nucleotides, preferably between 75 and 50 nucleotides, between 100 and 60 nucleotides, between 100 and 70 nucleotides.

[0146] In one embodiment, the arm region of the first probe is shorter than the arm of the second probe because the arm of the second probe comprises the essential elements of the invention (promoter and at least one fluorescent aptamer) and its length may be limited, at least to some extent, by the size of the elements. In one embodiment, the first and second probes are DNA molecules.

[0147] In one embodiment, the arms of the second probe preferably comprise the following sequence in the 5' to 3' direction:

[0148] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0149] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter, and

[0150] - a region complementary to the arm region of the first probe, optionally wherein said region is fully or partially contained in the full-length reverse complementary sequence of the DNA-guided RNA polymerase promoter.

[0151] Preferably, the arm of the second probe contains at least one, preferably one, full-length reverse complementary sequence of a fluorescent aptamer in its 5' region, preferably at the 5' end. "Apptamers" herein refer to short single-stranded DNA or RNA (ssDNA or ssRNA) molecules that can selectively bind to specific targets (including proteins, peptides, carbohydrates, small molecules, toxins and even living cells). Although DNA or RNA aptamers themselves do not fluoresce, they can be designed so that they can bind to fluorophores (small fluorescent molecules) and enhance their fluorescence. In this case, the DNA or RNA aptamers are referred to as fluorescent aptamers or fluorescent aptamers, and emit light when a fluorophore is added. Therefore, "fluorescent aptamers or fluorescent aptamers" herein refer to aptamers that can combine with fluorophores and form complexes with them to enhance their fluorescence. In some embodiments, more than one fluorescent aptamer is included. Preferably, the arm of the second probe contains 1, 2, 3, 4, 5 or more than 5 full-length reverse complementary sequences of fluorescent aptamers.

[0152] Fluorescent aptamers are well known in the art, such as Spinach aptamers (DB entry 4kzd), Corn aptamers (PDB entry 5bjp), Mango I, Mango II, Mango III, Mango IV aptamers (see Autour, A., et al. Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs inmammalian cells. Nat Commun 9, 656 (2018)), Red DIR2s aptamers (PDB entry 6db8) or Broccoli aptamers (see Filonov, GS, et al. Broccoli: rapid selection of an RNA mimic of green fluorescent protein by fluorescence-based selection and directed evolution. J. Am. Chem. Soc. 136, 16299–16308), etc. In a preferred embodiment, at least one fluorescent aptamer is at least one RNA fluorescent aptamer. Preferably, the RNA fluorescent aptamer is a Mango aptamer or a Broccoli aptamer.

[0153] In a preferred embodiment, the RNA fluorescent aptamer is a Mango aptamer, and its sequence comprises or consists of SEQ ID NO: 3 or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 3. More preferably, the RNA fluorescent aptamer is a Mango aptamer and its sequence comprises, consists of or consists essentially of SEQ ID NO: 3. In a preferred embodiment, the RNA fluorescent aptamer is a Mango aptamer, and its reverse complementary sequence comprises or consists of SEQ ID NO: 60 or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 60. More preferably, the RNA fluorescent aptamer is a Mango aptamer, and its reverse complementary sequence comprises, consists of or consists essentially of SEQ ID NO:60.

[0154] In a preferred embodiment, the RNA fluorescent aptamer is a Broccoli aptamer, whose sequence comprises or consists of SEQ ID NO: 57 or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 57. More preferably, the RNA fluorescent aptamer is a Broccoli aptamer and whose sequence comprises, consists of, or consists essentially of SEQ ID NO: 57. In a preferred embodiment, the RNA fluorescent aptamer is a Broccoli aptamer, whose reverse complementary sequence comprises or consists of SEQ ID NO: 61 or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 61. More preferably, the RNA fluorescent aptamer is a Broccoli aptamer, and its reverse complementary sequence comprises, consists of, or consists essentially of SEQ ID NO:61.

[0155] Preferably, the region of the arm of the second probe that is complementary to the arm region of the first probe and thus hybridizes therewith is completely or partially contained in the reverse complementary sequence of the DNA-guided RNA polymerase promoter, so that the two regions overlap. Therefore, in one embodiment, the arm of the second probe preferably includes or consists of the following in the 5' to 3' direction: the full-length reverse complementary sequence of at least one fluorescent aptamer, followed by and operably connected to the full-length reverse complementary sequence of the DNA-guided RNA polymerase promoter, wherein the nucleotides in the arm of the second probe that are complementary to the arm of the first probe are partially or completely contained in the full-length reverse complementary sequence of the DNA-guided RNA polymerase promoter. That is, in one embodiment, the arm of the first probe is complementary or substantially complementary to the region of the reverse complementary sequence of the DNA-guided RNA polymerase promoter contained in the arm of the second probe.

[0156] In one embodiment, the first and second probes are DNA, and the 3' end of the first probe is extended by a DNA-guided DNA polymerase (also referred to herein as an extension step), thereby generating a double-stranded structure comprising a functional double-stranded RNA polymerase promoter and at least one fluorescent aptamer, wherein one chain of the double-stranded structure is provided by the extension arm of the first probe, and the other chain of the double-stranded structure is provided by the arm of the second probe. In this case, once the extension step occurs, the arm of the first probe is thus completely complementary (or substantially complementary) to the arm of the second probe. As described above, only when a 3WT structure is formed in the presence of a target nucleic acid, will the DNA-guided DNA polymerase extend. Therefore, the design of the first and second probes makes it possible to synthesize de novo RNA in the absence of a target nucleic acid, because a substantially functional double-stranded RNA promoter is not formed. In one embodiment, the situation in which the target nucleic acid is not present in the sample is that the first and second probes cannot provide at least 20%, 15%, more preferably 10%, or even more preferably 5% of the activity of a completely double-stranded wild-type RNA promoter in the absence of a target nucleic acid.

[0157] Therefore, one strand of the promoter is provided by the arm of the second probe in the form of a reverse complementary sequence, which will be the "antisense" (-) strand. In the method of the present invention, when the DNA-guided DNA polymerase extends the arm of the first probe to the end of the arm of the second probe, another strand of the promoter, i.e., the "sense" (+) strand, is produced, thereby producing a functional double-stranded RNA polymerase promoter. Therefore, generally, the second probe is longer than the first probe and can serve as a template for the extension of the first probe only when the target nucleic acid is present (and a 3WJ structure is formed) and the DNA-guided DNA polymerase is added. Once a functional double-stranded RNA polymerase promoter is produced after the extension step, at least one fluorescent aptamer sequence in the form of a double-stranded sequence will be transcribed after adding the DNA-guided RNA polymerase (also referred to herein as a transcription step). Therefore, the extended first probe contains a template portion of at least one fluorescent aptamer, which is transcribed into multiple RNA copies after forming a functional double-stranded RNA polymerase promoter.

[0158] Thus, the extended first probe will typically comprise a nucleic acid to be transcribed, wherein the nucleic acid comprises the sequence of at least one fluorescent aptamer sequence, and thus at least one fluorescent aptamer sequence is produced following the enzymatic activity of the DNA-guided DNA polymerase. Thus, the sequences of the DNA-guided RNA polymerase promoter and at least one fluorescent aptamer contained in the arm of the second probe are not positive strands, but reverse complements of the positive strands, so that once the extension of the arm of the first probe is completed, a functional double-stranded DNA-guided RNA polymerase promoter and double-stranded fluorescent aptamer are formed; wherein one strand (the extended first probe arm) comprises the positive strand sequence of at least one fluorescent aptamer, so that when transcribed, the transcript of at least one fluorescent aptamer will be in the correct 5'-3' direction, thereby emitting light in the presence of the corresponding fluorophore ligand. Therefore, it is preferred that the extended arm of the first probe is designed as a sense strand.

[0159] Therefore, it is also critical that the sequence of at least one fluorescent aptamer sequence is operably linked to and controlled by a DNA-guided RNA polymerase promoter. A sequence and a promoter are said to be operably linked when they are linked in a manner such that transcription of the sequence is influenced or controlled by the promoter. In this case, at least one fluorescent aptamer sequence is operably linked to a promoter nucleotide sequence such that the transcription level of at least one fluorescent aptamer sequence is regulated by the promoter.

[0160] In one embodiment, the DNA-guided RNA polymerase promoter is preferably a promoter recognized by a bacteriophage polymerase, preferably a promoter recognized by one of T3, T7 or SP6 polymerases. These promoters usually contain at least 15 or 16 bases. Preferably, the DNA-guided RNA polymerase promoter is a T7 promoter. Then, an efficient RNA polymerase (e.g., T7 polymerase) can produce a large amount of RNA (including the sequence of at least one fluorescent aptamer) from a chain of the double-stranded nucleic acid formed by the extended first probe and the second probe. Therefore, in one embodiment, both probes are DNA, and the extension of the arm of the first probe leads to the generation of newly synthesized double-stranded DNA (dsDNA), the dsDNA comprising a DNA-guided RNA polymerase promoter and a transcription start site for transcription by RNA polymerase, the dsDNA also comprising a double-stranded sequence of at least one fluorescent aptamer, the fluorescent aptamer being operably connected to the promoter and regulated by the promoter.

[0161] In a preferred embodiment, the DNA-guided RNA polymerase promoter is a T7 promoter and its reverse complement sequence comprises or consists of SEQ ID NO: 62 or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 62. More preferably, the DNA-guided RNA polymerase promoter is a T7 promoter and its reverse complement sequence comprises, consists of or consists essentially of SEQ ID NO: 62.

[0162] In another embodiment, the DNA-guided RNA polymerase promoter is an SP6 promoter. Thus, in a preferred embodiment, the DNA-guided RNA polymerase promoter is an SP6 promoter and its reverse complement sequence comprises or consists of SEQ ID NO: 75 or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 75. More preferably, the DNA-guided RNA polymerase promoter is an SP6 promoter and its reverse complement sequence comprises, consists of or consists essentially of SEQ ID NO: 75.

[0163] For the foot region, there is no upper limit to the size of the foot region of the first and second probes. Preferably, the foot region will contain at least 7 or at least 10 bases, preferably at least 15 or 20 bases, and more preferably at least 25 or at least 30 bases. Preferably, the foot region contains 8-20, 10-40, 15-35, preferably 15-30 or 15-25 bases. In fact, it is also preferred that the foot region contains no more than about 75 bases, and preferably no less than 7 bases.

[0164] In one embodiment, the target nucleic acid comprises a first portion and a second portion, wherein the first portion is located 3' to the second portion. In one embodiment, the first portion of the target nucleic acid is complementary (including substantially complementary) to the foot region of the first probe, and the second portion of the target nucleic acid is complementary (including substantially complementary) to the foot region of the second probe.

[0165] The basic feature of the present invention is that when the first and second probes are hybridized with the first and second parts of the target nucleic acid sequence respectively, they are adjacent to each other or substantially adjacent. The term "adjacent" used herein is intended to indicate that there are no remaining target sequence nucleotides (i.e., there are 0 nucleotides) that are not base-paired between the first and second parts of the target nucleic acid sequence that are base-paired with the complementary sequence of the probe. This proximity between the probes enables the complementary arm portion of the probe to anneal. It is easy for those skilled in the art to understand that by designing the probe to allow annealing to each other at a larger interval with the target sequence, a gap between the first and second parts of the target sequence can be introduced between the nucleotides hybridized at the foot of the probe. In this case, the probe is referred to as "substantially adjacent" because there may be some remaining target sequence nucleotides that are not base-paired between those parts of the target sequence that are base-paired with the probe. Preferably, the term "substantially adjacent" is intended to indicate that the remaining target sequence nucleotides that are not base-paired between the first and second parts of the target sequence that are base-paired with the complementary sequence of the probe are at most 15, preferably at most 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. Obviously, the number of unpaired nucleotides in the target sequence can vary according to the design of the probe. Thus, while it is preferred that the first and second probes hybridize so as to be adjacent, i.e., leaving 0 nucleotides between the first and second portions of the target sequence, the foot of each probe may be separated by up to 10, 9, 8, 7, or 6 nucleotides of the target sequence, and the term "substantially adjacent" in the present invention is intended to refer to the latter case.

[0166] In one embodiment, the first probe preferably comprises the following sequence in the 5' to 3' direction:

[0167] - a foot region that is complementary (including substantially complementary) to and hybridizes with the first portion of the target nucleic acid,

[0168] - is not complementary (including substantially not complementary) to the target nucleic acid and is complementary (including substantially complementary) to a portion of the arm of the second probe

[0169] arm area.

[0170] In the presence of a target nucleic acid, when the 3WJ structure is formed, but before the addition of a DNA-guided DNA polymerase (i.e., before the extension step occurs), the arm region of the first probe is complementary to the arm of the second probe only over preferably less than 9, 8, 7, 6 or 5 nucleotides. Preferably, before the arm of the first probe is extended, only 6 to 8 nucleotides on the arm of the first probe are complementary to the arm of the second probe, as described above.

[0171] However, in the presence of a target nucleic acid, when the 3WJ structure of the present invention is formed, after the activity of a DNA-guided DNA polymerase (i.e., after the extension step), the arm region of the first probe is extended, and thus the extended first probe preferably comprises in the 5' to 3' direction:

[0172] - a foot region that is complementary (including substantially complementary) to and hybridizes with the first portion of the target nucleic acid,

[0173] - an arm region that is non-complementary (including substantially non-complementary) to the target nucleic acid and complementary (including substantially complementary) to the arm of the second probe over its entire length, wherein the arm region preferably comprises the sense strand of a functional double-stranded RNA promoter and the sense strand of at least one fluorescent aptamer in the 5' to 3' direction, wherein at least one fluorescent aptamer sequence is operably linked to and controlled by the RNA promoter.

[0174] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 1, 7, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 26, 35, 40, 45, 46, 83 or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 1, 7, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 26, 35, 40, 45, 46 or 83. More preferably, the first probe comprises, consists of, or consists essentially of SEQ ID NO: 1, 7, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 26, 35, 40, 45, 46, or 83.

[0175] In one embodiment, the second probe preferably comprises the following sequence in the 5' to 3' direction:

[0176] - a full-length reverse complementary sequence of at least one fluorescent aptamer (preferably a Mango or Broccoli aptamer),

[0177] - the full-length reverse complement of a DNA-guided RNA polymerase promoter (preferably a T7 or SP6 promoter), wherein the reverse complement of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0178] - a region complementary to (including substantially complementary to) the arm region of the first probe and hybridizing thereto, wherein optionally, said region is completely or partially contained in the full-length reverse complementary sequence of the DNA-guided RNA polymerase promoter, and

[0179] - a foot region that is complementary (including substantially complementary) to and hybridizes to a second portion of the target nucleic acid.

[0180] In a preferred embodiment, the second probe comprises or consists of SEQ ID NO: 2, 8, 23, 24, 25, 27, 36, 41, 47, 48, 58, 59, 63-74, 76, 77, 78, 79, 81, 82, 84 or 85, or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 2, 8, 23, 24, 25, 27, 36, 41, 47, 48, 58, 59, 63-74, 76, 77, 78, 79, 81, 82, 84 or 85. More preferably, the second probe comprises, consists of, or consists essentially of SEQ ID NO: 8, 23, 24, 25, 27, 36, 41, 47, 48, 58, 59, 63-74, 76, 77, 78, 79, 81, 82, 84, or 85.

[0181] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 1 (Escherichia coli 23S rRNA), the second probe comprises or consists of SEQ ID NO: 2 or 63 (Escherichia coli 23S rRNA), and the target sequence comprises or consists of SEQ ID NO: 38; or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 1, 2, 63 or 38, respectively.

[0182] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21 or 12, the second probe comprises or consists of SEQ ID NO: 8, 23, 24, 58, 64, 65, 66 or 73, and the target sequence comprises or consists of SEQ ID NO: 9 or 13 (Escherichia coli 16S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21, 12, 8, 23, 24, 58, 64, 65, 66, 73, 9 or 13, respectively.

[0183] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 26, the second probe comprises or consists of SEQ ID NO: 27, 59, 68, 74, 78 or 79, and the target sequence comprises or consists of SEQ ID NO: 28 or 29 (SARS-CoV-2); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 26, 27, 59, 68, 74, 78, 79, 28 or 29, respectively.

[0184] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 35, the second probe comprises or consists of SEQ ID NO: 36, 69, 76, or 77, and the target sequence comprises or consists of SEQ ID NO: 37 or 39 (Escherichia coli 23S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 35, 36, 69, 76, 77, 37 or 39, respectively.

[0185] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 83, the second probe comprises or consists of SEQ ID NO: 84 or 85, and the target sequence comprises or consists of SEQ ID NO: 37 (Escherichia coli 23S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 83, 84, 85 or 37, respectively.

[0186] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 40, the second probe comprises or consists of SEQ ID NO: 41, 70, 81 or 82, and the target sequence comprises or consists of SEQ ID NO: 42 or 44 (Staphylococcus aureus mecA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 40, 41, 70, 81, 82, 42 or 44, respectively.

[0187] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 45, the second probe comprises or consists of SEQ ID NO: 47 or 71, and the target sequence comprises or consists of SEQ ID NO: 49 (influenza A); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 45, 47, 71 or 49, respectively.

[0188] In a preferred embodiment, the first probe comprises or consists of SEQ ID NO: 46, the second probe comprises or consists of SEQ ID NO: 48 or 72, and the target sequence comprises or consists of SEQ ID NO: 50 (influenza B); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 46, 48, 72 or 50, respectively.

[0189] Either the first or second probe may include DNA, peptide nucleic acid (PNA), locked nucleic acid (LNA), RNA or any combination thereof. However, it is generally desirable that the portion of the probe that constitutes the promoter comprises conventional DNA to ensure recognition by the relevant polymerase. Therefore, the terms "nucleic acid complex", "nucleic acid molecule" and "nucleic acid probe" should not be interpreted as being limited to complexes, molecules or probes consisting only of conventional nucleic acids (respectively), but also encompass complexes, molecules or probes comprising unconventional nucleic acids (e.g., PNA or LNA) or non-nucleic acid portions.

[0190] PNA is a synthetic nucleic acid analog in which the sugar / phosphate backbone is replaced by a peptide chain (usually composed of repeated N-(2-aminoethyl)-glycine units), and the base is connected to the peptide chain by a methylene carbonyl bond. Compared with double-stranded DNA molecules, PNA / DNA hybrids have high Tm values, because the highly negatively charged phosphate backbone in DNA causes electrostatic repulsion between the corresponding chains, while the PNA backbone is uncharged. Another feature of PNA is that single base mismatches are relatively more unstable than single base mismatches in heteroduplex DNA. Therefore, PNA is used to be included in the probe of the present invention because the resulting probe has a higher specificity than a probe composed entirely of DNA. The synthesis and use of PNA are known in the technical field of the present invention.

[0191] LNA is a synthetic nucleic acid analog comprising an "internally bridged" nucleoside analog. The synthesis and properties of LNA have been extensively described in the art.

[0192] In addition, a spacer molecule can be added between the foot region and the arm region of the first and / or second probe. "Spacer molecule" herein refers to any one or more molecules (including nucleotide sequences, organic and inorganic compounds, etc.) connecting the foot region of the probe and the arm region of the probe. Preferably, the spacer region is a non-nucleoside spacer region. Preferably, the spacer molecule is an organic compound containing 20-15, preferably 18 atoms. Preferably, the spacer molecule is an organic compound containing 18, 17, 16, 15, 14, 13, 12, 11, 10 or less than 10 carbon atoms. Preferably, the spacer molecule is an 18-atom hexaethylene glycol spacer (referred to herein as iSp18 spacer, see Figure 4 ).

[0193] In addition, the first and / or second probe can also be coupled to another compound or element at its 3' or 5' end. In one embodiment, the 3' end of the second probe is blocked so that its RNA polymerase-mediated extension is not possible from this end. In one embodiment, the blocking compound or element is coupled to the 3' end. Blocking of the 3' end can be conveniently achieved by providing a phosphate or propyl group to replace the -OH group on the 3' terminal nucleotide. Other methods of blocking the 3' end are well known to those skilled in the art. In a preferred embodiment, the compound or element coupled to the molecule (preferably coupled to the second probe) is a 3'-amino group, preferably NH3 (see Figure 4 In one embodiment, the compound or element coupled to the molecule (preferably coupled to the second probe) is a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0194] The target nucleic acid is the sequence of interest that is intended to be detected, or is formed as a result of the presence of the sequence of interest in the sample. Thus, according to the use of the invention, a "sequence of interest" or "target nucleic acid" can be very long (e.g., a whole gene) or can be quite short. Thus, the first and second probes defined previously can hybridize with the target sequence so that they are only linked to a small section of the sequence of interest, or they can be linked together so that some of the target sequence exceeds the strict sequence of interest.

[0195] The target can be DNA, RNA and / or hybrid DNA / RNA. The target sequence can be formed due to the presence of a sequence of interest in the sample (e.g., by PCR or any other amplification method). Preferably, the target nucleic acid is an infectious agent or is derived from an infectious agent. Preferably, the target nucleic acid is an RNA molecule derived from the genome of an infectious agent (e.g., a bacterium or a virus). Preferably, the infectious agent is a microorganism that causes human disease. In one embodiment, the target nucleic acid is a bacterial genome or is derived from a bacterial genome, preferably a bacterial 16S rRNA or 23S rRNA.

[0196] In one embodiment, the target nucleic acid is a viral genome or is derived from a viral genome, preferably a viral RNA genome. Preferably, the target nucleic acid is a genome of a positive-strand RNA virus or is derived from a genome of a positive-strand RNA virus, preferably a coronavirus or influenza virus genome. Preferably, the coronavirus is a SARS-CoV-2 virus. Preferably, the influenza virus is an influenza A virus or an influenza B virus.

[0197] Regarding samples, in one embodiment, the sample is an isolated biological sample. Exemplary biological samples include tissue samples (e.g., tissue sections and needle biopsies of tissues); cell samples (e.g., cytological smears (e.g., Pap smears or blood smears) or cell samples obtained by microdissection); samples of whole organisms (e.g., samples of yeast or bacteria); or cell fractions, fragments, or organelles (e.g., obtained by lysing cells and separating their components by centrifugation or other means). Other examples of biological samples include blood, serum, urine, semen, fecal matter, cerebrospinal fluid, interstitial fluid, mucus, tears, sweat, pus, biopsy tissue (e.g., obtained by surgical biopsy or needle biopsy), nipple aspirates, milk, vaginal secretions, saliva, swabs (e.g., oral swabs), or any material containing biomolecules from the biological sample. In some embodiments, the biological sample can be a body fluid, which can be a liquid separated from an individual's body. For example, "body fluid" may include blood, plasma, serum, mucus, bile, saliva, nasopharyngeal swab, urine, tears, sweat, or body cavity washings.

[0198] The biological sample can be obtained from the object to be analyzed. A "subject" can be a human (i.e., a male or female of any age, such as a pediatric subject (e.g., an infant, a child, or a teenager) or an adult subject (e.g., a young person, a middle-aged person, or an elderly person). Alternatively, the subject can be a non-human animal. In certain embodiments, the non-human animal is a mammal (e.g., a primate, such as a cynomolgus monkey or a rhesus monkey), a commercially relevant mammal (e.g., a cow, a pig, a horse, a sheep, a goat, a cat, or a dog), or a poultry (e.g., a commercially relevant poultry, such as a chicken, a duck, a goose, or a turkey). In other examples, the non-human animal is a fish, a reptile, or an amphibian. The non-human animal can be a transgenic animal or a genetically engineered animal. In some examples, the subject can also be a plant.

[0199] The step a) of the method of the second aspect comprises adding the first and second probes to a sample comprising a target nucleic acid to form a 3WJ structure. It is obvious to those skilled in the art that the order in which the probes are added in the step a) of the method is not critical: for example, the first probe can be mixed with the second first probe before adding the sample (which may contain the target nucleic acid to be detected). Alternatively, all probes can be mixed with a sample containing a target molecule at the same time.

[0200] The hybridization step is a hybridization step, which, if there is a target nucleic acid in the sample, leads to the formation of the 3WJ of the first aspect. Hybridization refers to the ability of complementary single-stranded DNA or RNA to form a complex. The hybridization step can be carried out under suitable hybridization conditions, which is within the knowledge of those skilled in the art. The hybridization conditions that cause a specific stringency will vary according to the composition and length of the properties of the hybridization method and the hybrid nucleic acid sequence. In general, the temperature of hybridization and the ionic strength of the hybridization buffer will determine the stringency of hybridization. Calculations of hybridization conditions that reach a specific stringency are routine and known in the art. The hybridization temperature can be determined according to various factors, such as the length of the complementary region between the probe and the target nucleic acid, the composition (such as G / C content) of the complementary region, the required stringency, etc., which are within the knowledge of those skilled in the art.

[0201] In one embodiment, the first and second probes are designed so that the appropriate hybridization of the two probes and the target nucleic acid occurs at substantially the same temperature. In this case, this step can be completed in a single step." suitable temperature " herein refers to the temperature at which the first and second probes form a 3D structure with high specificity with the target nucleic acid and form little complex or do not form complex with other nucleic acids (even if there is a nucleic acid with sequence homology to the target nucleic acid of interest). This suitable hybridization temperature can be determined according to multiple factors well known to those skilled in the art, such as the existence of homologous non-target nucleic acids in the melting temperature, ionic strength, length of the target nucleic acid or the same sample of capture probe and detection probe.

[0202] Step b) of the method of the second aspect, also referred to as the extension step, comprises adding or providing a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe.

[0203] DNA-guided DNA polymerase catalyzes DNA synthesis by adding deoxyribonucleotide units to the DNA chain using DNA as a template. In this case, the template is the arm of the second probe, and the addition of deoxyribonucleotide units occurs in the arm of the first probe, resulting in the extension of the arm, thereby increasing the number of complementary bases between the arms of the first and second probes. As explained above, the extension of the arm of the first probe produces a functional double-stranded RNA promoter and a positive strand of at least one fluorescent aptamer.

[0204] In one embodiment, the DNA-directed DNA polymerase is a prokaryotic polymerase, preferably type I. Preferably, the DNA-directed DNA polymerase is Bacillus stearothermophilus DNA polymerase I (Bst).

[0205] The extension step is carried out under suitable enzymatic conditions, which are within the knowledge of those skilled in the art and depend on the DNA-directed DNA polymerase chosen.

[0206] Step c) of the method, also referred to as the transcription step, comprises adding or providing a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) so as to cause de novo synthesis of multiple single-stranded nucleic acid copies comprising at least one fluorescent aptamer. In one embodiment, the DNA-guided RNA polymerase can be a T7, T3 or SP6 polymerase. A suitable DNA-guided RNA polymerase is added to produce RNA copies of the sense strand (in this case, the arm of the first probe), i.e., said RNA copies of the functional fluorescent aptamer.

[0207] The choice of RNA polymerase will depend on the reverse complementary sequence located on the arm of the second probe. Thus, if the arm of the second probe comprises the reverse complementary sequence of a T7 promoter, the DNA-guided RNA polymerase added in step c) of the method should be a T7 polymerase. Alternatively, if the arm of the second probe comprises the reverse complementary sequence of an SP6 promoter, the DNA-guided RNA polymerase added in step c) of the method should be an SP6 polymerase.

[0208] The transcription step can be carried out under suitable enzymatic conditions, which are within the knowledge of those skilled in the art and depend on the RNA polymerase selected.

[0209] Step d) of the method, also referred to as the detection step, comprises adding or providing at least one fluorophore ligand of at least one fluorescent aptamer, thereby directly detecting the de novo synthesized nucleic acid comprising at least one fluorescent aptamer, wherein the detection of said nucleic acid comprising at least one fluorescent aptamer indicates the presence of the target nucleic acid in the sample.

[0210] Therefore, step d) of the method means direct Detecting synthesized nucleic acids, thereby eliminating the need to further amplify the de novo synthesized nucleic acids or add any other oligonucleotides to detect the sequence. It will be appreciated by those skilled in the art that both the second probe and the target sequence need to at least partially hybridize with the first probe to form a 3WJ structure and a functional double-stranded RNA promoter. Therefore, the RNA transcript of the template portion of the first probe comprising at least one fluorescent aptamer indicates the presence of the target sequence in the sample. Therefore, the 3WJ structure of the present invention provides a basis for the determination of a nucleic acid sequence of interest in a sample including direct detection.

[0211] Similar to the above, the conditions for performing the detection step are within the knowledge of those skilled in the art.

[0212] Therefore, the method of the present invention provides a one-step method for detecting target nucleic acids. In a preferred embodiment, the present invention provides a method for generating a signal in a system in a target-dependent manner (i.e., creating a 3WJ structure and thus forming a functional promoter) and causing the signal to be amplified (producing multiple RNA transcripts under the control of the promoter, including at least one fluorescent aptamer), which only requires the use of two probes, two enzymes (DNA and RNA polymerases) and a fluorophore ligand, without the need for additional steps or reactivity or enzymes to achieve detection.

[0213] The fluorophore ligand to be added in the detection step depends on the one or more fluorescent aptamers contained in the arms of the second probe, as it needs to be compatible with the aptamer(s). For example, if a Mango aptamer is included, the fluorophore ligand should be a thiazole orange (TO1) derivative, such as a TO1 biotin fluorophore. If a Broccoli aptamer is included in the sequence of the second probe, the ligand to be added in step d) is 5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2,3-dimethyl-4H-imidazol-4-one (DFHBI) or (5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T).

[0214] When the RNA transcript comprising at least one fluorescent aptamer interacts with at least one fluorophore ligand, the fluorescence of the fluorophore is significantly increased compared to the fluorescence of the fluorophore that does not form a complex with at least one fluorescent aptamer. Therefore, in the optional step e) of the method (also referred to as the quantitative step), the fluorescence emitted by at least one fluorophore-aptamer complex is measured and quantified by fluorescence readings. In one embodiment, step e) of the method includes determining the level or concentration of the target nucleic acid present in the sample. Methods for measuring fluorescence are known in the art and can include the use of a fluorescent microplate reader.

[0215] In order to measure the level (concentration) of target nucleic acid in sample, a sample containing target nucleic acid molecules of known concentration can be used to formulate a calibration curve. The concentration of target nucleic acid in sample can be determined by comparing the measurement parameters with the calibration standard. In some cases, a calibration curve can be prepared, wherein the total measurement signal is determined for multiple samples of target nucleic acid containing known concentration using substantially similar assay forms. For example, the total intensity of the array can be compared with the calibration curve to determine the measured value of target nucleic acid concentration in sample. The calibration curve can be made by completing the method with standardized samples of multiple known concentrations under similar conditions to the test sample of unknown concentration being analyzed. The calibration curve can be used to associate the detection signal of the target nucleic acid (i.e., the fluorophore-aptamer formed when the target nucleic acid exists) complex with the known concentration of the target nucleic acid. Then the sample containing the target nucleic acid or fragment of unknown concentration can be determined, and the detected signal can be compared with the calibration curve (or the mathematical equation of the calibration curve fitting) to determine the measured value of target nucleic acid concentration in sample.

[0216] In view of the high sensitivity of the method of the present invention, the target nucleic acid may not need to be amplified in advance. However, in a preferred embodiment, the target nucleic acid is amplified before step a) of the method of the present invention. Therefore, in one embodiment, the method of the present invention also includes an amplification step before step a) or simultaneously or overlapping with step a), which includes amplifying the target nucleic acid to provide a plurality of molecules identical to the target nucleic acid or its reverse complementary sequence, wherein the plurality of molecules represent the target nucleic acid to be detected in the method steps a) to d), preferably a) to e) as defined above. The method of amplifying the target nucleic acid to provide a plurality of molecules identical to the target nucleic acid is known in the art. Preferably, the amplification method used is an isothermal amplification method, more preferably an isothermal amplification method selected from the group consisting of: loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), multiple displacement amplification (MDA), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA). Preferably, the method of the present invention includes an amplification step before step a), wherein the amplification step is performed by nucleic acid sequence-based amplification (NASBA).

[0217] In one embodiment, the amplification step is optionally followed by a step of degrading residual amplification primers and dephosphorylating excess dNTPs after amplification. In one embodiment, the step of degrading residual amplification primers and dephosphorylating excess dNTPs is performed by exonuclease digestion followed by a phosphatase reaction.

[0218] Therefore, in a preferred embodiment, the method of the present invention comprises the following steps:

[0219] a) amplifying the target nucleic acid, preferably using an isothermal amplification method, preferably the NASBA method, and subsequently, overlappingly or simultaneously, preferably subsequently, adding a first nucleic acid probe and a second nucleic acid probe to the sample, so as to form a three-way junction structure of the present invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe, wherein:

[0220] iv) the first probe comprises: a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing to the first portion of the target nucleic acid;

[0221] and an arm region located at the 3' region of the probe;

[0222] v) The second probe comprises:

[0223] (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing to the second portion of the target nucleic acid, and

[0224] (2) an arm region located at the 5' region of the probe, the arm region preferably including in the 5' to 3' direction:

[0225] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0226] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0227] - a region comprising 5 to 9, preferably 6 to 8 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region comprising 5 to 9, preferably 6 to 9 nucleotides is fully or partially contained in the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, and

[0228] vi) the target nucleic acid comprises: a first portion located at the 3' region of the target nucleic acid, the first portion being complementary to the foot region of the first probe; and a second portion located at the 5' region of the target nucleic acid, the second portion being complementary to the foot region of the second probe, wherein the first portion is adjacent to or substantially adjacent to the second portion, wherein when the target nucleic acid is present in the sample, a three-way junction structure is formed between the first probe, the second probe and the target nucleic acid, preferably, the first portion is separated from the second portion by 0 to 10 nucleotides, more preferably by 0 to 6 nucleotides, and

[0229] b) adding a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe;

[0230] c) adding a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) so as to cause de novo synthesis of a single-stranded nucleic acid comprising at least one fluorescent aptamer; and

[0231] d) adding at least one fluorophore ligand of the at least one fluorescent aptamer, thereby directly detecting, and optionally quantifying, de novo synthesized nucleic acids comprising the at least one fluorescent aptamer, wherein the detection, and optionally quantification, of the nucleic acids comprising the at least one fluorescent aptamer indicates the presence of the target nucleic acid in the sample.

[0232] Alternatively, other steps may be included between, before or after the above steps. Such other steps may be, for example, one or more washing steps. Further, preferably, some reagents and buffers used in the amplification step, for example deoxynucleotide triphosphates or ribonucleoside triphosphates are also used in the hybridization step of the method, thereby simplifying the method without affecting efficiency, saving reagents and time simultaneously.

[0233] It is obvious to those skilled in the art that the steps of the method of the second aspect or any embodiment thereof can be performed in order, i.e., from step a) to d), optionally from a) to e), or all steps can be performed simultaneously by adding the reagents defined in each of these steps to a sample containing the target molecule. Therefore, in one embodiment, the method is performed in the order of steps a) to d), optionally to e). In another embodiment, the method performs all steps a) to d), optionally to e) simultaneously.

[0234] Preferably, as shown in Examples 17 to 20, the method is carried out in a one-pot reaction. "One-pot reaction" herein refers to a method in which all steps of the method are carried out in a single vessel, container, tube or reactor. Preferably, the method is carried out in a one-pot reaction, wherein the amplification step (preferably NASBA amplification) is carried out before or simultaneously with the SMART method of the present invention. Preferably, the method is carried out in a one-pot reaction, wherein the method comprises the following steps:

[0235] a) amplifying the target nucleic acid, preferably using an isothermal amplification method, preferably the NASBA method, and subsequently, overlappingly or simultaneously, preferably subsequently, adding a first nucleic acid probe and a second nucleic acid probe to the sample, so as to form a three-way junction structure of the present invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe, wherein:

[0236] i) the first probe comprises: a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing with the first portion of the target nucleic acid; and an arm region located at the 3' region of the probe;

[0237] ii) The second probe comprises:

[0238] (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing to the second portion of the target nucleic acid, and

[0239] (2) an arm region located at the 5' region of the probe, the arm region preferably including in the 5' to 3' direction:

[0240] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0241] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0242] - a region comprising 5 to 9, preferably 6 to 8 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region comprising 5 to 9, preferably 6 to 9 nucleotides is fully or partially contained in the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, and

[0243] iii) the target nucleic acid comprises: a first portion located at the 3' region of the target nucleic acid, the first portion being complementary to the foot region of the first probe; and a second portion located at the 5' region of the target nucleic acid, the second portion being complementary to the foot region of the second probe, wherein the first portion is adjacent or substantially adjacent to the second portion, and wherein when the target nucleic acid is present in the sample, a three-way junction structure is formed between the first probe, the second probe and the target nucleic acid, and

[0244] e) adding a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe;

[0245] f) adding a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) so as to cause de novo synthesis of a single-stranded nucleic acid comprising at least one fluorescent aptamer; and

[0246] g) adding at least one fluorophore ligand of said at least one fluorescent aptamer, thereby directly detecting, and optionally quantifying, the de novo synthesized nucleic acid comprising at least one fluorescent aptamer, wherein the detection, and optionally quantification, of said nucleic acid comprising at least one fluorescent aptamer indicates the presence of a target nucleic acid in the sample,

[0247] Wherein, preferably, the promoter used for the amplification performed in step a) is different from the DNA-guided RNA polymerase promoter contained in the arm region of the second probe, preferably one of the promoters is a T7 promoter and the other promoter is an SP6 promoter, and wherein, preferably, the first part and the second part of the target nucleic acid are separated by 0 to 10 nucleotides, more preferably 0 to 6 nucleotides. Preferably, the reagents for implementing the method of the present invention (probe, DNA-guided DNA polymerase, DNA-guided RNA polymerase and fluorophore ligand) are added to the reaction vessel only after the amplification (preferably NASBA amplification) has been carried out for an appropriate time (preferably between 10-50 minutes, preferably 20-40 minutes, most preferably 30 minutes). Therefore, in a preferred embodiment, the method is carried out as a one-pot reaction and comprises:

[0248] - a first step, comprising amplification of the target nucleotide, preferably by using an isothermal amplification method, preferably the NASBA method, wherein amplification is performed by adding primers, buffers and enzymes suitable for said amplification (such as reverse transcriptase, RNAseH and polymerase) to a reaction vessel, and

[0249] - a second step, comprising adding the first and second nucleic acid probes, a DNA-guided DNA polymerase, and a DNA-guided RNA polymerase to a reaction vessel for performing a SMART reaction, and

[0250] - a third step, comprising adding at least one fluorophore ligand to the reaction vessel in order to detect at least one fluorescent aptamer produced in the second step,

[0251] Preferably, the second step is started after the first step has been carried out for at least 10 to 50 minutes, preferably 20 to 40 minutes, and most preferably 30 minutes.

[0252] In one embodiment, the method of the present invention is an isothermal method, so that all reactions described herein can be achieved at a single temperature, preferably between about 30°C and 45°C, more preferably between 35°C and 43°C, and most preferably between 37°C and 41°C. In a preferred embodiment, the method of the present invention is preceded by an amplification step, which is performed at a single temperature, preferably about 35°C to 40°C, more preferably 37°C, and the subsequent method of the present invention is performed at a different temperature, preferably between 40°C and 43°C, more preferably at 41°C. The person skilled in the art knows which enzymes are suitable for the method of the present invention to be performed isothermally, and what temperature to choose accordingly to obtain the best efficiency of the method.

[0253] The application of the method of the present invention includes detecting the presence of a target nucleic acid of interest in a suitable sample and / or measuring the level of a target nucleic acid of interest in a sample. In some embodiments, the sample may be a biological sample obtained from a subject, and the results obtained from the assay method described herein may be used for diagnostic and / or prognostic purposes. In other embodiments, the assay method described herein may be used in a research environment for detecting the presence of a target nucleic acid in a sample or measuring the level of a target nucleic acid of interest in a sample. The method may be applied in a diagnostic / prognostic environment to detect the presence of a nucleic acid biomarker associated with a target disease or to measure the level of a nucleic acid biomarker associated with a target disease. For example, the method may be used to detect the presence of an infectious agent associated with a specific disease (e.g., a new coronavirus or influenza) / measure the level of an infectious agent associated with a specific disease (e.g., a new coronavirus or influenza). The method may be used to detect such nucleic acid biomarkers in subjects without any disease symptoms for early diagnosis. The detection method may also be used to detect nucleic acids of microorganisms to determine whether a subject has been infected by such microorganisms (e.g., viruses (e.g., HBV, HCV, HPV, HIV, influenza, coronavirus)).

[0254] The methods described herein can be used to directly detect nucleic acids in a sample very sensitively and effectively. In addition, the methods described herein can also be used to detect several targets present in a sample, or to measure the levels of two or more targets in a sample (multiplex assay). In this case, the two or more target nucleic acids can be detected using different second probes containing different fluorescent aptamers, so that different signals are associated with each target nucleic acid (i.e., each fluorophore-aptamer complex). For example, in a sample suspected of containing three different target nucleic acids, the detection step may include: (i) measuring a first signal released from a first fluorophore-aptamer complex, and determining the presence or level of the first target nucleic acid in the sample based on the intensity of the first signal; (ii) measuring a second signal released from a second fluorophore-aptamer complex, and determining the presence or level of the second target nucleic acid in the sample based on the intensity of the second signal; and (iii) measuring a third signal released from a third fluorophore-aptamer complex, and determining the presence or level of the third target nucleic acid in the sample based on the intensity of the third signal. It is worth noting that multiplex assays also include the possibility of detecting a given target nucleic acid by performing the method of the present invention several times over the length of the target nucleic acid. For example, in a sample suspected of containing a target nucleic acid, two or more first and second probes that hybridize at different regions of the target nucleic acid can be designed to form two or more three-way junction structures on the target nucleic acid, wherein the detection step includes: (i) measuring the first, second or subsequent signal released from the first, second or subsequent fluorophore-aptamer complex, and (ii) determining the presence or level of the target nucleic acid in the sample based on the intensity of all detected signals. Example 21 illustrates this multiplex method.

[0255] In a third aspect, the present invention relates to a computer-implemented method for designing a pair of probes, preferably the first and second probes as defined above, for use in the method of the present invention. In one embodiment, the method of the third aspect comprises the following steps:

[0256] i) reading the target nucleic acid,

[0257] ii) obtaining or generating at least one pair of probe sequences, characterized in that one of them comprises or consists of the sequence of the first probe as defined above, and the other comprises or consists of the sequence of the second probe as defined above, and further characterized in that they are capable of forming the three-way junction structure of the present invention by hybridizing with the target nucleic acid molecule, and

[0258] iii) Optionally, providing as output the sequence obtained or generated in step ii).

[0259] In a preferred embodiment of the third aspect, the computer-implemented method comprises the following steps:

[0260] i) reading the target nucleic acid,

[0261] ii) obtaining or generating a sequence of at least one pair of probes, wherein each probe comprises a foot region and an arm region, wherein:

[0262] The foot region of the first probe is located at the 5' region of the probe and is complementary to and hybridizes with the first portion of the target nucleic acid, the arm region of the first probe is located at the 3' region of the probe and is not complementary to the target nucleic acid, and wherein

[0263] The foot region of the second probe is located in the 3' region of the probe and is complementary to and hybridizes with the second portion of the target nucleic acid, and the arm region of the second probe is located in the 5' region of the probe and preferably comprises in the 5' to 3' direction:

[0264] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0265] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0266] - a region of 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region of 5 to 9 nucleotides is fully or partially contained within the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter.

[0267] wherein the first and second probes are capable of forming a three-way junction structure of the present invention by hybridizing with a target nucleic acid molecule, wherein the first portion and the second portion are adjacent or substantially adjacent, preferably, wherein the first portion and the second portion are separated by 0 to 10 nucleotides, more preferably, 0 to 6 nucleotides, and

[0268] iii) Optionally, providing as output the sequence obtained or generated in step ii).

[0269] In one embodiment, the target nucleic acid read in step i) is retrieved from a database. In another embodiment, the target nucleic acid read in step i) may be provided by a user.

[0270] In one embodiment, step ii) of the method of the third aspect further comprises the following steps:

[0271] a) obtaining a foot region of a first probe by selecting a first portion of nucleotides contained in the target nucleic acid and generating a complementary sequence thereof,

[0272] b) obtaining the foot region of the second probe by selecting a second portion of nucleotides contained in the target nucleic acid and generating a complementary sequence thereof, wherein the first portion and the second portion are adjacent or substantially adjacent, preferably separated by 0 to 10 nucleotides, more preferably separated by 0 to 6 nucleotides,

[0273] c) obtaining the arm region of the second probe by selecting a nucleotide sequence comprising the full-length sequence of a DNA-guided RNA polymerase promoter and the full-length reverse complement sequence of at least one fluorescent aptamer, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter, and

[0274] d) obtaining the arm region of the first probe by selecting 5 to 9 nucleotides, preferably 6 to 8 nucleotides complementary to a region located at the 3' region of the arm region of the second probe obtained in step c).

[0275] In one embodiment, the output of step iii) is provided in a readable format, such as a .txt or html file.

[0276] Note that the steps of the computer-implemented method may be performed in any order.

[0277] In a fourth aspect, the present invention also provides a kit for detecting the presence of a target nucleic acid in a sample or for implementing the second aspect or any embodiment thereof. Preferably, the kit includes the first and / or second nucleic acid probes defined in the first aspect and / or second aspect of the present invention, and optionally includes instructions for using them to perform the method of the second aspect or any embodiment thereof. In one embodiment, the kit may also include one or more containers containing components for performing the methods described herein and optional instructions for use. Specifically, such a kit may include one or more reagents as described herein (e.g., the first and second probes as described herein), optionally together with instructions for describing the intended application and proper use of these reagents, including instructions for designing the first or second probes (if they are not provided as reagents in the kit). Preferably, the kit includes one or more containers or vials, which contain the first or second probes, preferably together with reagents required for implementing the method of the second aspect, and optionally also include reagents for performing the previous amplification step.

[0278] Therefore, in one embodiment, the kit may include at least one of the following: (i) a DNA-guided DNA polymerase, preferably a Bst polymerase, (ii) at least one DNA-guided RNA polymerase, preferably a T7 RNA polymerase, and / or (iii) at least one suitable fluorophore ligand of at least one fluorescent aptamer for detecting the presence of a target nucleotide. Preferably, the kit comprises all of (i) to (iii). Preferably, the kit comprises: the first and second probes defined in the first aspect and / or the second aspect of the present invention, which are suitable for implementing the method of the second aspect and forming the structure of the first aspect; and reagents (i) to (iii). Other elements that may be included in the kit are spermidine, dNTPs and / or a suitable buffer for the enzymes and reagents used in the method to function properly. A "suitable" buffer refers to a buffer that, when it comes into contact with the reaction mixture, provides sufficient working conditions for the DNA-guided RNA polymerase and / or any other enzyme present in the reaction (e.g., a DNA-guided DNA polymerase). A suitable buffer is, for example, a buffer comprising Tris-HCl, such as:

[0279] -40 mM Tris-HCl, 6 mM MgCl2 and 10 mM NaCl, or

[0280] -40mM Tris-HCl, pH8.0, 13.2mM MgCl2, 75mM KCl, 10mM DTT and 15% μL DMSO,

[0281] or any suitable buffer that allows the DNA-guided RNA polymerase and / or DNA-guided DNA polymerase to function properly.

[0282] In one embodiment, a kit for detecting the presence of a target nucleic acid in a sample may include at least one of the following, preferably all of the following:

[0283] a) at least one DNA-guided DNA polymerase, preferably Bst polymerase,

[0284] b) at least one DNA-guided RNA polymerase, preferably T7 RNA polymerase,

[0285] c) at least one suitable fluorophore ligand of at least one fluorescent aptamer,

[0286] d) spermidine,

[0287] e) nucleoside triphosphates, including ribonucleoside triphosphates (NTPs, including ATP, GTP, UTP and CTP) or deoxynucleotide triphosphates (dNTPs, including dATP, dGTP, dTTP and dCTP), or any combination thereof,

[0288] f) a suitable buffer for carrying out the method of the second aspect or any embodiment thereof,

[0289] g) optionally, reverse transcriptase, RNAse and at least one exonuclease and phosphatase (to perform the previous amplification step,

[0290] NASBA test is preferred),

[0291] Therein, elements a) to g) are contained in different containers or are grouped in one or more containers.

[0292] Such kits can be designed to be suitable for diagnostic use or other purposes, such as research use. For example, the kit can include an instrument for collecting samples from a patient, and / or reagents for detecting diseases associated with nucleic acid molecules. Kits for research purposes can include components in appropriate concentrations or quantities to perform various experiments.

[0293] In one embodiment, a computer-readable storage medium is provided, wherein the computer-readable storage medium contains instructions stored therein, wherein when a computer executes the instructions, the instructions are configured to enable a processor of the computer to perform the method of the third aspect to provide and / or design a first and second probe. In one embodiment, a device is provided, wherein the device is used to provide and / or design a first and second probe nucleic acid sequence data set, wherein the device includes a computer processor and a computer-readable storage medium coupled to the computer processor. In one embodiment, a computer program is provided, wherein the computer program is stored in a computer-readable storage medium, wherein when a computer executes the program, the program is configured to enable a processor of the computer to perform the method of the third aspect.

[0294] In a fifth aspect, the present invention also provides a method for detecting the presence of a target nucleic acid in a sample as defined in the second aspect of the present invention, wherein the method uses the kit as defined in the fourth aspect of the present invention.

[0295] In a sixth aspect, the present invention also provides a system for detecting the presence of a target nucleic acid in a sample, the system comprising the first probe and the second probe defined in the first aspect and / or the second aspect of the present invention.

[0296] Sequence Listing:

[0297] SEQ ID NO1:

[0298] > Escherichia coli 23S rRNA SMART-first probe (DNA form from Wharam et al. Nucl Acids Res, 2001)

[0299] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0300] GCATTTAGCTACCGGGCAGTGCCATT TTCGAAAT

[0301] SEQ ID NO2:

[0302] > Escherichia coli 23S rRNA SMART-Mango secondary probe (designed based on Wharam et al. Nucl Acids Res, 2001)

[0303] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0304]

[0305] SEQ ID NO3:

[0306] >Mango-III(A10U) RNA aptamer (45-nt, Trachman et al. Nat Chem Biol, 2019)

[0307] The aptamer core is shown in lowercase letters and the nucleotides forming the stem structure are shown in Underline show

[0308] GGCACGUACGAA ggaagguuuguaugugguaua UUCGUACGUGCC

[0309] SEQ ID NO4:

[0310] >5' primer for NASBA amplification of E. coli 16S rRNA (OV2, Kao et al. Anal Letters, 2010)

[0311] GGAGGCAGCAGTGGGGAATA

[0312] SEQ ID NO5:

[0313] >3' primer for NASBA amplification of E. coli 16S rRNA (OV3, Kao et al. Anal Letters, 2010)

[0314] The T7 promoter is shown in bold

[0315]

[0316] SEQ ID NO6:

[0317] >NR 024570.1 Escherichia coli strain U 5 / 41 16S ribosomal RNA, partial sequence

[0318]

[0319] SEQ ID NO7:

[0320] >E. coli 16S rRNA SMART-First Probe (29-nt hybridization)

[0321]

[0322] SEQ ID NO8:

[0323] > E. coli 16S rRNA SMART-Mango Secondary Probe (29-nt hybridization)

[0324] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0325]

[0326] SEQ ID NO9:

[0327] >Reverse complementary RNA sequence of E. coli 16S, NASBA product (191-nt)

[0328] The 3'NASBA primer is in italics, the target region recognized by the second probe is in lowercase letters, the target region recognized by the first probe is in bold, and the RC of the 5'NASBA primer is in Underline use_

[0329]

[0330] SEQ ID NO10:

[0331] >E. coli 16S rRNA SMART-first probe, 2-complementary (3WJ) nucleotides

[0332] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0333]

[0334] SEQ ID NO11:

[0335] >E. coli 16S rRNA SMART-first probe, 4-complementary (3WJ) nucleotides

[0336] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0337]

[0338] SEQ ID NO12:

[0339] > E. coli 16S rRNA SMART-first probe, 6-complementary (3WJ) nucleotides

[0340] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0341]

[0342] SEQ ID NO13:

[0343] >Synthetic RNA target of Escherichia coli 16S ribosomal RNA (75-nt, positions 357-432, reverse complement)

[0344] The target region recognized by the second probe is shown in lowercase letters, and the target region recognized by the first probe is shown in bold.

[0345]

[0346] SEQ ID NO14:

[0347] >E. coli 16S rRNA SMART-first probe, 10-complementary (3WJ) nucleotides

[0348] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0349]

[0350] SEQ ID NO15:

[0351] >E. coli 16S rRNA SMART-first probe, 15-complementary (3WJ) nucleotides

[0352] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0353]

[0354] SEQ ID NO16:

[0355] > E. coli 16S rRNA SMART - first probe, 1-nt interval between the hybridization region of the second probe

[0356] Target specific region UnderlineThe complementary sequence of the second probe is shown in italics

[0357]

[0358] SEQ ID NO17:

[0359] > E. coli 16S rRNA SMART - first probe, 2-nt interval between the hybridization region of the second probe

[0360] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0361]

[0362] SEQ ID NO18:

[0363] > E. coli 16S rRNA SMART - first probe, 4-nt interval between the second probe hybridization region

[0364] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0365]

[0366] SEQ ID NO19:

[0367] > E. coli 16S rRNA SMART-first probe, 6-nt interval between the hybridization region of the second probe

[0368] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0369]

[0370] SEQ ID NO20:

[0371] >E. coli 16S rRNA SMART-first probe (22-nt hybridization)

[0372] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0373]

[0374] SEQ ID NO21:

[0375] >E. coli 16S rRNA SMART-First Probe (15-nt hybridization)

[0376] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0377]

[0378] SEQ ID NO22:

[0379] >E. coli 16S rRNA SMART-First Probe (7-nt hybridization)

[0380] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0381]

[0382] SEQ ID NO23:

[0383] > Escherichia coli 16S rRNA SMART-Mango Secondary Probe (22-nt hybridization)

[0384] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0385]

[0386] SEQ ID NO24:

[0387] > Escherichia coli 16S rRNA SMART-Mango Secondary Probe (15-nt hybridization)

[0388] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0389]

[0390] SEQ ID NO25:

[0391] > Escherichia coli 16S rRNA SMART-Mango Secondary Probe (7-nt Hybridization)

[0392] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0393]

[0394] SEQ ID NO26:

[0395] >SARS-CoV-2 T3 SMART-First Probe

[0396] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0397]

[0398] SEQ ID NO27:

[0399] >SARS-CoV-2 T3 SMART-Mango Second Probe

[0400] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0401]

[0402] SEQ ID NO28:

[0403] >Synthetic RNA target of SARS-CoV-2 S “spike” RNA (30-nt, positions 21766-21795, reverse complement)

[0404] The target region recognized by the second probe is shown in lowercase letters, and the target region recognized by the first probe is shown in bold.

[0405]

[0406] SEQ ID NO 29:

[0407] >Reverse complementary RNA sequence of SARS-CoV-2 product of NASBA (189-nt, S “spike” RNA)

[0408] The 3'NASBA primer is in italics, the target region recognized by the second probe is in lowercase letters, the target region recognized by the first probe is in bold, and the RC of the 5'NASBA primer is in Underline use

[0409]

[0410] SEQ ID NO30:

[0411] >SARS-CoV-2 T3 SMART - Second probe for molecular beacon detection

[0412] The molecular beacon reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0413]

[0414] SEQ ID NO31:

[0415] >Molecular beacon oligonucleotide probe (Grm neg 16S MB, Zhao et al. J Clin Microbiol, 2009)

[0416] Complementary 5' and 3' bands Underline ;56-FAM=5'-6-FAM; 3DAb=3'-Dabcyl.

[0417] / 56-FAM / CGAGCT TGAAGAAGGCCTTCGGGTTGTAAAG AGCTCG / 3DAb /

[0418] SEQ ID NO32:

[0419] >S “spike” surface glycoprotein RNA (CDS); NC_045512.2:21563-25384 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1 (SARS-CoV-2), complete genome

[0420]

[0421] SEQ ID NO33:

[0422] >5' Primer for SARS-CoV-2 NASBA Amplification

[0423] CACGTGGTGTTTATTACCCTGACA

[0424] SEQ ID NO34:

[0425] >3' Primer for SARS-CoV-2 NASBA Amplification

[0426] The T7 promoter is shown in bold

[0427]

[0428] SEQ ID NO35:

[0429] >E. coli 23S rRNA SMART-First Probe

[0430] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0431]

[0432] SEQ ID NO36:

[0433] > E. coli 23S rRNA SMART-Mango Secondary Probe

[0434] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0435]

[0436] SEQ ID NO37:

[0437] >Reverse complementary RNA sequence of Escherichia coli 23S rRNA, NASBA product (256-nt)

[0438] The 3'NASBA primer is in italics, the target region recognized by the second probe is in lowercase letters, the target region recognized by the first probe is in bold, and the RC of the 5'NASBA primer is in Underline use

[0439]

[0440] SEQ ID NO38:

[0441] >NR_103073.1 Escherichia coli strain K-12 23S ribosomal RNA gene, complete sequence

[0442]

[0443] SEQ ID NO39:

[0444] >Synthetic RNA target of 23S ribosomal RNA (79-nt, positions 2393-2468, reverse complement)

[0445] The target region recognized by the second probe is shown in lowercase letters, and the target region recognized by the first probe is shown in bold.

[0446]

[0447] SEQ ID NO40:

[0448] >Staphylococcus aureus mecA SMART-First Probe

[0449] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0450]

[0451] SEQ ID NO41:

[0452] >Staphylococcus aureus mecA SMART-Mango Second Probe

[0453] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0454]

[0455] SEQ ID NO42:

[0456] >Reverse complementary RNA sequence of the mecA gene of Staphylococcus aureus, NASBA product (98-nt)

[0457] The 3'NASBA primer is in italics, the target region recognized by the second probe is in lowercase letters, the target region recognized by the first probe is in bold, and the RC of the 5'NASBA primer is in Underline use

[0458]

[0459] SEQ ID NO43:

[0460] >KX639010.1 Staphylococcus aureus strain SQ5 methicillin resistance protein subunit A (mecA) gene, partial cds

[0461] TGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCGACTTAAAACAAGGGATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAAAAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGCCATTATCCATTTTATAGGGCTCAAATTTCAAACAAAAAT TTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAATCTATAGCGCATTAGAAGGTAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAAAATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATA

[0462] SEQ ID NO44:

[0463] >Synthetic RNA target of Staphylococcus aureus mecA RNA (98-nt, positions 268-362, reverse complement)

[0464] The target region recognized by the second probe is shown in lowercase letters, the target region recognized by the first probe is shown in bold, and the RC of the 5'NASBA primer is shown in Underline use

[0465]

[0466] SEQ ID NO45:

[0467] >Influenza A PB1 gene SMART-first probe (15-nt target hybridization region)

[0468] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0469]

[0470] SEQ ID NO46:

[0471] >Influenza B PA gene SMART-first probe (15-nt target hybridization region)

[0472] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0473]

[0474] SEQ ID NO47:

[0475] >Influenza A PB1 gene SMART-secondary probe (15-nt target hybridization region)

[0476] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0478]

[0479] SEQ ID NO48:

[0480] >Influenza B PA gene SMART-secondary probe (15-nt target hybridization region)

[0481] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0482]

[0483] SEQ ID NO49:

[0484] >Synthetic RNA target of influenza A PB1 gene (30-nt)

[0485] The target region recognized by the second probe is shown in lowercase letters, and the target region recognized by the first probe is shown in bold.

[0486]

[0487] SEQ ID NO50:

[0488] >Synthetic RNA target of influenza B virus PA gene (30-nt)

[0489] The target region recognized by the second probe is shown in lowercase letters, and the target region recognized by the first probe is shown in bold.

[0490]

[0491] SEQ ID NO51:

[0492] >MK185298.1 influenza A virus (A / swine / South Dakota / A02016893 / 2018(H1N1)) segment 2 polymerase PB1 (PB1) and PB1-F2 protein (PB1-F2) genes, complete cds

[0493]

[0494] SEQ ID NO52:

[0495] >MT637912.1 Influenza B virus (B / Texas / 9813 / 2019) segment 3 polymerase PA (PA) gene, complete cds

[0496]

[0497] SEQ ID NO53:

[0498] >5' Primer for NASBA amplification of E. coli 23S rRNA

[0499] GGCATAAGCCAGCTTGACTG

[0500] SEQ ID NO54:

[0501] >3' Primer for NASBA amplification of E. coli 23S rRNA

[0502] The T7 promoter is shown in bold

[0503]

[0504] SEQ ID NO55:

[0505] >5' primer for Staphylococcus aureus mecA+NASBA amplification reaction

[0506] GGTTACGGACAAGGTGAAAT

[0507] SEQ ID NO56:

[0508] >3' primer for Staphylococcus aureus mecA+NASBA amplification reaction

[0509] The T7 promoter is shown in bold

[0510]

[0511] SEQ ID NO57:

[0512] >Broccoli RNA aptamer (49-nt, Filonov et al. JACS, 2014)

[0513] The variable regions are shown in lowercase letters, the conserved bases involved in base pairing are shown in bold, and the conserved bases are shown in raised letters. Underline show

[0514]

[0515] SEQ ID NO58:

[0516] > E. coli 16S rRNA SMART-Broccoli Secondary Probe

[0517] The Broccoli reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0518]

[0519] SEQ ID NO59:

[0520] >SARS-CoV-2 T3 SMART-Broccoli Second Probe

[0521] The Broccoli reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0522]

[0523] SEQ ID NO60:

[0524] >Mango aptamer (reverse complementary sequence)

[0525] GGCACGTACGAATATACCACATACCAAACCTTCCTTCGTACGTGCC

[0526] SEQ ID NO61:

[0527] >Broccoli aptamer (reverse complementary sequence)

[0528] GAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTC

[0529] SEQ ID NO62:

[0530] >T7 promoter (reverse complementary sequence)

[0531] TATAGTGAGTCGTATTA

[0532] SEQ ID NO63: (similar to SEQ ID NO: 2, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules):

[0533] > Escherichia coli 23S rRNA SMART-Mango secondary probe (designed based on Wharam et al. Nucl Acids Res, 2001)

[0534] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0535]

[0536] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0537] SEQ ID NO64: (similar to SEQ ID NO: 8, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0538] > E. coli 16S rRNA SMART-Mango Secondary Probe (29-nt hybridization)

[0539] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0540]

[0541] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0542] SEQ ID NO65: (similar to SEQ ID NO: 23, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0543] > Escherichia coli 16S rRNA SMART-Mango Secondary Probe (22-nt hybridization)

[0544] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0545]

[0546] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0547] SEQ ID NO66: (similar to SEQ ID NO: 24, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0548] > Escherichia coli 16S rRNA SMART-Mango Secondary Probe (15-nt hybridization)

[0549] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0550]

[0551] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0552] SEQ ID NO 67: (Similar to SEQ ID NO: 25, but with iSp18 replacing any spacer and optionally 3' end contains any blocking molecules)

[0553] > Escherichia coli 16S rRNA SMART-Mango Secondary Probe (7-nt Hybridization)

[0554] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0555]

[0556] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0557] SEQ ID NO68: (similar to SEQ ID NO: 27, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0558] >SARS-CoV-2 T3 SMART-Mango Second Probe

[0559] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0560]

[0561] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0562] SEQ ID NO69: (similar to SEQ ID NO:36, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0563] > E. coli 23S rRNA SMART-Mango Secondary Probe

[0564] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0565]

[0566] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0567] SEQ ID NO70: (similar to SEQ ID NO: 41, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0568] >Staphylococcus aureus mecA SMART-Mango Second Probe

[0569] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0570]

[0571] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0572] SEQ ID NO71: (similar to SEQ ID NO: 47, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0573] >Influenza A PB1 gene SMART-secondary probe (15-nt target hybridization region)

[0574] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0575]

[0576] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0577] SEQ ID NO72: (similar to SEQ ID NO: 48, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0578] >Influenza B PA gene SMART-secondary probe (15-nt target hybridization region)

[0579] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0580]

[0581] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0582] SEQ ID NO73: (similar to SEQ ID NO: 58, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0583] > E. coli 16S rRNA SMART-Broccoli Secondary Probe

[0584] The Broccoli reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0585]

[0586] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0587] SEQ ID NO74: (similar to SEQ ID NO:59, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0588] >SARS-CoV-2 T3 SMART-Broccoli Second Probe

[0589] The Broccoli reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underlineshow

[0590]

[0591] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0592] SEQ ID NO75:

[0593] >Sp6 promoter (reverse complementary sequence)

[0594] TATAGTGTCACCTAAAT

[0595] SEQ ID NO76:

[0596] > E. coli 23S rRNA SMART-Mango Secondary Probe for One-Pot NASBA-Apta-SMART Assay

[0597] The Mango reverse complement sequence is shown in lowercase letters, the Sp6 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0598]

[0599] SEQ ID NO77: (similar to SEQ ID NO: 76, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0600] > E. coli 23S rRNA SMART-Mango Secondary Probe for One-Pot NASBA-Apta-SMART Assay

[0601] The Mango reverse complement sequence is shown in lowercase letters, the Sp6 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0602]

[0603] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0604] SEQ ID NO 78:

[0605] >SARS-CoV-2 T3 SMART-Mango Second Probe for One-Pot NASBA-Apta-SMART Assay

[0606] The Mango reverse complement sequence is shown in lowercase letters, the Sp6 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0607]

[0608] SEQ ID NO79: (similar to SEQ ID NO:78, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0609] >SARS-CoV-2 T3 SMART-Mango Second Probe for One-Pot NASBA-Apta-SMART Assay

[0610] The Mango reverse complement sequence is shown in lowercase letters, the Sp6 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0611]

[0612] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0613] SEQ ID NO80:

[0614] >Modified 3' primer for NASBA amplification of E. coli 23S rRNA, Sp6 promoter

[0615] The Sp6 promoter is shown in bold

[0616]

[0617] SEQ ID NO81:

[0618] >Staphylococcus aureus mecA SMART-Mango second probe for one-pot NASBA-Apta-SMART assay

[0619] The Mango reverse complement sequence is shown in lowercase letters, the Sp6 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0620]

[0621] SEQ ID NO82: (similar to SEQ ID NO: 81, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0622] >Staphylococcus aureus mecA SMART-Mango second probe for one-pot NASBA-Apta-SMART assay

[0623] The Mango reverse complement sequence is shown in lowercase letters, the Sp6 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0624]

[0625] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0626] SEQ ID NO83:

[0627] >E. coli 23S rRNA SMART-first probe for region 2 (R2) detection in the duplex Apta-SMART assay.

[0628] Target specific region Underline The complementary sequence of the second probe is shown in italics

[0629] GAGTTCATATCGACGGCGGTGTTTGGCACTTCGAAAT

[0630] SEQ ID NO84:

[0631] > E. coli 23S rRNA SMART-Mango Secondary Probe for region 2 (R2) detection in the Duplex Apta-SMART Assay.

[0632] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0633] ggcacgtacgaatataccacataccaaaccttccttcgtacgtgccCCCTATAGTGAGTCGTATTAATTTCGAA / iSp18 / CTCGATGTCGGCTCATCACATCCTGGGGC / 3AmMO /

[0634] SEQ ID NO85: (similar to SEQ ID NO: 84, but with iSp18 replacing any spacer and optionally at the 3' end contains any blocking molecules)

[0635] > E. coli 23S rRNA SMART-Mango Secondary Probe for region 2 (R2) detection in the Duplex Apta-SMART Assay.

[0636] The Mango reverse complement sequence is shown in lowercase letters, the T7 promoter is shown in bold, the complementary sequence of the first probe is shown in italics, and the target-specific region is shown in Underline show

[0637] ggcacgtacgaatataccacataccaaaccttccttcgtacgtgccCCCTATAGTGAGTCGTATTAATTTCGAA / Spacer / CTCGATGTCGGCTCATCACATCCTGGGGC /

[0638] Wherein, preferably, the 3' end of the molecule is blocked to prevent extension by a DNA-guided DNA polymerase, preferably wherein the 3' end of the molecule is blocked by conjugating or coupling the 3' end of the molecule to a 3' amino modifier (also referred to herein as / 3AmMO / ).

[0639] The present invention also includes the following clauses:

[0640] 1. A method for detecting the presence of a target nucleic acid in a sample, the method comprising the following steps:

[0641] a) adding a first nucleic acid probe and a second nucleic acid probe to a sample containing a target nucleic acid so that the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe hybridize to form a three-way junction structure, wherein:

[0642] i) the first probe comprises: a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing with the first portion of the target nucleic acid; and an arm region located at the 3' region of the probe;

[0643] ii) The second probe comprises:

[0644] (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing to the second portion of the target nucleic acid, and

[0645] (2) an arm region located at the 5' region of the probe, the arm region including in the 5' to 3' direction:

[0646] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0647] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0648] - a region of 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region of 5 to 9 nucleotides is fully or partially contained within the full-length reverse complement sequence of the DNA-guided RNA polymerase promoter, and

[0649] iii) the target nucleic acid comprises: a first portion located at the 3' region of the target nucleic acid, the first portion being complementary to the foot region of the first probe; and a second portion located at the 5' region of the target nucleic acid, the second portion being complementary to the foot region of the second probe, wherein the first portion is adjacent or substantially adjacent to the second portion, preferably wherein the first portion and the second portion are separated by 0 to 6 nucleotides, and wherein when the target nucleic acid is present in the sample, a three-way junction structure is formed between the first probe, the second probe and the target nucleic acid, and

[0650] b) adding a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe;

[0651] c) adding a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) so as to cause de novo synthesis of a single-stranded nucleic acid comprising at least one fluorescent aptamer; and

[0652] d) adding at least one fluorophore ligand of said at least one fluorescent aptamer, thereby directly detecting the de novo synthesized nucleic acid comprising at least one fluorescent aptamer, wherein the detection of said nucleic acid comprising at least one fluorescent aptamer indicates the presence of the target nucleic acid in the sample, wherein, optionally, the method further comprises an amplification step before step a), wherein the target nucleic acid is amplified.

[0653] 2. The method according to clause 1, wherein the double-stranded RNA promoter formed in step b) is a T7 RNA polymerase promoter, and wherein the DNA-guided RNA polymerase added in step c) is a T7 RNA polymerase, or wherein the double-stranded RNA promoter formed in step b) is a SP6 RNA polymerase promoter, and wherein the DNA-guided RNA polymerase added in step c) is an SP6 RNA polymerase.

[0654] 3. The method according to any one of clauses 1 or 2, wherein the DNA-guided DNA polymerase added in step b) is Bacillus stearothermophilus DNA polymerase I.

[0655] 4. The method according to any one of items 1 to 3, wherein the foot region of the first probe and / or the second probe is at least 15 nucleotides in length.

[0656] 5. The method according to any one of clauses 1 to 4, wherein at least one fluorescent aptamer is a Mango aptamer or a Broccoli aptamer.

[0657] 6. The method according to clause 5, wherein if at least one fluorescent aptamer contained in the arm of the second probe is a Mango aptamer, then at least one fluorescent ligand added in step d) is a TO1 biotin fluorophore, or wherein if at least one fluorescent aptamer contained in the arm of the second probe is a Broccoli aptamer, then at least one fluorescent ligand added in step d) is a DFHBI or DFHBI-1T fluorophore.

[0658] 7. A method according to any one of clauses 1 to 6, wherein the method further comprises an amplification step before step a), wherein the amplification step comprises amplifying the target nucleic acid to provide a plurality of molecules identical to the target nucleic acid or its reverse complementary sequence, wherein the plurality of molecules represent the target nucleic acid in subsequent steps a) to d), and wherein the amplification step is optionally followed by a step of post-amplification degradation of residual amplification primers and dephosphorylation of excess dNTPs.

[0659] 8. The method according to clause 7, wherein the amplification step is performed by nucleic acid sequence based amplification (NASBA).

[0660] 9. A method according to any one of clauses 1 to 8, wherein the target nucleic acid is an RNA molecule, preferably derived from the genome of an infectious agent such as a bacterium or a virus.

[0661] 10. A computer-implemented method for designing at least one pair of probes suitable for implementing the method as defined in any one of clauses 1 to 9, the method comprising the steps of:

[0662] i) reading the target nucleic acid,

[0663] ii) obtaining or generating a sequence of at least one pair of probes, wherein each probe comprises a foot region and an arm region, wherein:

[0664] The foot region of the first probe is located at the 5' region of the probe and is complementary to and hybridizes with the first portion of the target nucleic acid, and the arm region of the first probe is located at the 3' region of the probe and is not complementary to the target nucleic acid, wherein

[0665] The foot region of the second probe is located in the 3' region of the probe and is complementary to and hybridizes with the second portion of the target nucleic acid, and the arm region of the second probe is located in the 5' region of the probe and comprises in the 5' to 3' direction:

[0666] - at least one full-length reverse complementary sequence of a fluorescent aptamer,

[0667] - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0668] - a region of 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region of 5 to 9 nucleotides is fully or partially contained within the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter,

[0669] wherein the first and second portions of the target nucleic acid are separated by 0 to 6 nucleotides,

[0670] wherein the first probe and the second probe are capable of forming a three-way junction structure by hybridizing with the target nucleic acid molecule, and

[0671] iii) Optionally, providing as output the sequence obtained or generated in step ii).

[0672] 11. The computer-implemented method according to clause 10, wherein step ii) comprises the following steps:

[0673] a) obtaining a foot region of a first probe by selecting a first portion of nucleotides contained in the target nucleic acid and providing a complementary sequence thereof,

[0674] b) obtaining a foot region of a second probe by selecting a second portion of nucleotides contained in the target nucleic acid and providing a complementary sequence thereof, wherein the first portion and the second portion are separated by 0 to 6 nucleotides,

[0675] c) obtaining the arm region of the second probe by selecting a nucleotide sequence comprising the full-length sequence of a DNA-guided RNA polymerase promoter and the full-length reverse complement sequence of at least one fluorescent aptamer, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter,

[0676] d) obtaining the arm region of the first probe by selecting 5 to 9 nucleotides complementary to a region located at the 3' region of the arm region of the second probe obtained in step c), and

[0677] e) Optionally, synthesizing the designed first probe and second probe.

[0678] 12. A kit for detecting the presence of a target nucleic acid in a sample, comprising the following elements:

[0679] a) at least one DNA-guided DNA polymerase, preferably Bst polymerase,

[0680] b) at least one DNA-guided RNA polymerase, preferably T7 RNA polymerase or SP6 RNA polymerase,

[0681] c) at least one suitable fluorophore ligand of at least one fluorescent aptamer,

[0682] d) spermidine,

[0683] e) nucleoside triphosphates, including deoxynucleoside triphosphates and / or ribonucleoside triphosphates,

[0684] f) a suitable buffer,

[0685] g) optionally, a reverse transcriptase, an RNAse, at least one exonuclease and a phosphatase,

[0686] Therein, elements a) to g) are contained in different containers or are grouped in one or more containers.

[0687] 13. A system for detecting the presence of a target nucleic acid in a sample, comprising a first probe and a second probe, wherein the first probe comprises a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing to a first portion of the target nucleic acid, and an arm region located at the 3' region of the probe; and wherein the second probe comprises:

[0688] (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing to the second portion of the target nucleic acid, and

[0689] (2) an arm region, which includes, from the 5' to the 3' direction:

[0690] i. the full-length reverse complementary sequence of at least one fluorescent aptamer,

[0691] ii. the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the RNA polymerase promoter,

[0692] iii. a region comprising 5 to 9 nucleotides that is complementary to and hybridizes with the arm region of the first probe, wherein the region comprising 5 to 9 nucleotides may be a region included in the full-length reverse complementary sequence of a DNA-guided RNA polymerase promoter.

[0693] The present invention is described below by the following examples, but these examples should be regarded as illustrative only and do not limit the scope of the present invention in any way.

[0694] Example

[0695] Example 1: Apta-SMART probe design

[0696] The Aptamer-SMART ("apta-SMART") assay is a detection method that relies on the hybridization of two DNA probes with regions complementary to a target nucleic acid (DNA or RNA). The two probes (first and second probes) are able to hybridize to adjacent regions of the sequence of interest, and only in this case can the complementary arm-specific sequences in the two probes anneal to form a three-way junction (3WJ) structure. After the 3WJ is formed, Bst DNA polymerase extends the first probe sequence from 5' to 3' and creates a functional double-stranded RNA polymerase promoter, which in the presence of a specific RNA polymerase (T7, T3 or SP6) allows the transcription of the aptamer sequence (i.e., Mango, Broccoli, etc.) using the second probe as a template to produce multiple copies of the RNA aptamer, which can be detected by a fluorescent readout after the addition of a fluorescent substrate (e.g., TO1-biotin or TO3-biotin for Mango).

[0697] Based on this concept, we show here how to design a pair of apta-SMART probes to detect E. coli-23S rRNA ( Figure 4 ). The design of the probes was based on the previously published SMART probes for detecting the 23S DNA region of E. coli K12 (Wharam et al. Nucl Acids Res, 2001). Each probe includes a region that can hybridize with the target and another shorter region that can hybridize with another probe. These probes are designed so that they can anneal to each other only in the presence of a specific target, thus forming a 3WJ structure. Probes for detecting different rRNA target sequences are designed in the same way, only by changing the target hybridization region.

[0698] The first E. coli 23S rRNA probe (SEQ ID NO: 1) comprises a target-specific region of 30 nucleotides that specifically hybridizes to the target sequence, and a non-target complementary region (contiguous with the target-specific region) of 8 fixed nucleotides (TTCGAAAT) that are complementary to the second probe forming 3WJ.

[0699] The second E. coli 23S rRNA probe (SEQ ID NO: 2) also contains a target-specific region of 30 nucleotides that hybridizes to the target sequence (located adjacent to the target region recognized by the first probe) and an 8-nucleotide fixed sequence (reverse complement) for annealing to the first probe. The second probe also contains a non-functional (reverse complementary) single-stranded RNA polymerase promoter sequence, followed by a reverse complementary RNA aptamer sequence, namely the Mango-III (A10U) aptamer (SEQ ID NO: 3, Trachman et al. Nat Chem Biol, 2019). The 3' end of the second probe is blocked by an amino group to avoid being mediated by RNA polymerase first. In addition, in order to reduce nonspecific background signals, a non-nucleoside linker (in this case an 18-atom hexaethylene glycol spacer) was included before 3WJ (in Figure 4 denoted as iSp18 in .

[0700] Example 2: Hybridization region between probes forming 3WJ (non-target complementary region).

[0701] Based on the previously published primers (OV2 and OV3: SEQ ID NOs: 4 and 5, respectively) for NASBA detection of Escherichia coli 16S rRNA (SEQ ID NO: 6) (Kao et al. Anal Letters, 2010), we designed an E. coli 16S rRNA first probe (SEQ ID NO: 7) and a modified second probe containing a T7 promoter and a Mango aptamer (SEQ ID NO: 8) to detect the previously reported reverse complementary sequence (RC) region of the E. coli 16S rRNA (SEQ ID NO: 9) (Kao et al. Anal Letters, 2010).

[0702] The preferred size of the non-target complementary region is 8 nucleotides (8-nt, TTCGAAAT) complementary to the arms of the second probe. In this example, we tested whether 8-nt hybridization and formation of 3WJ as our standard in the first and second probes (SEQ ID NOs: 7 and 8), and whether using fewer (2-nt, 4-nt, 6-nt, respectively; SEQ ID NOs: 10, 11, 12) hybridizing nucleotides in the first probe is sufficient to perform SMART detection with a high signal-to-noise ratio using a synthetic RNA target (sRNA, SEQ ID NO: 13) of Escherichia coli 16S rRNA. To test this, we used the sequences TT, TTCG, and TTCGAA as 3WJs formed between the probes (as shown in SEQ ID NOs: 10, 11, 12). The complementary sequences in the second probe are (from 5' to 3' direction): ATTTCGAA is the standard 8-nt, while AA, CGAA, and TTCGAA are 2-nt, 4-nt, and 6-nt. In addition, we used more than 8-nt (specifically, 10-nt and 15-nt; SEQ ID NO: 14 and 15) to decipher whether hybridization between probes becomes non-specific, causing the reaction to occur in the absence of sRNA. To this end, we used the sequences TTCGAAATTA and TTCGAAATTAATACG (as shown in SEQ ID NO: 14 and 15). The complementary sequences in the second probe were (from 5' to 3' direction): 10-nt and 15-nt complementary sequences were TAATTTCGAA and CGTATTAATTTCGAA, respectively.

[0703] Using the E. coli 16S rRNA standard first probe (SEQ ID NO: 7) and first probes with 2-nt, 4-nt, 6-nt, 10-nt and 15-nt (SEQ ID NO: 10, 11, 12, 14 and 15, respectively) and a standard second probe containing a Mango aptamer (SEQ ID NO: 8) for detecting the reverse complementary RNA sequence (synthetic RNA, sRNA) (SEQ ID NO: 13) of the E. coli 16S rRNA (SEQ ID NO: 6), we ran the apta-SMART reaction as detailed below: The first and second probes (840 and 700 fmols, respectively) were mixed with 17.5 nM sRNA (SEQ ID NO: 13) in 1X transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 2 mM spermidine and 10 mM NaCl) (from T7 RNA, pol, Promega) supplemented with 1 mM spermidine (Sigma). NO: 13) reaction mixture, which was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. Afterwards, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2U Bst DNA-pol and 25UT7 RNA pol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths in a black bottom 384-well plate (Nunc) using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader).

[0704] like Figure 5 As shown, when the hybridization region (3WJ) contained 8-nt and 6-nt (SEQ ID NO: 7 and SEQ ID NO: 12), the apta-SMART detection of 17.5 nM sRNA (SEQ ID NO: 13) was the best, with the fold changes of sRNA detection being 4.6-fold and 3.6-fold, respectively, compared with no sRNA ( Figure 5B), while the detection was invalid when the region forming 3WJ contained 4-nt or less nucleotides (SEQ ID NO: 10 and SEQ ID NO: 11). When 10-nt and 15-nt hybridizations were tested, high nonspecific signals from the no-sRNA control were found, indicating that interaction can also occur in the absence of RNA target. The lowest sRNA amount tested, 1.75nM, was specifically detected by the optimal 8-hybridization nucleotide construct, with a 1.4-fold change compared to no sRNA. It is worth noting that 2 or 5 residues of the 10-nt and 15-nt probes, respectively, can interact with the T7 promoter sequence in the second probe region and form dsDNA, which may lead to "promiscuous" activity of T7 RNA polymerase. To rule out this situation, we performed the detection without Bst polymerase. As Figure 5 As shown in C and 5D, if there is no Bst polymerase activity, the apta-SMART signal is empty. These results confirm that 8-nt hybridization between the first and second probes is the optimal size for target specificity, because 10 complementary nucleotides have already undergone non-specific hybridization in the absence of RNA target (sRNA in the embodiment).

[0705] Example 3: Spacing between hybridization zones (target-probe)

[0706] As detailed, the first and second probes each have a 30-nucleotide target-specific region that hybridizes to a 60-nucleotide region target sequence. These 30-nt regions are adjacent to each other in the target, so that after target hybridization, they are continuous.

[0707] Here, we tested whether the first probe could anneal to the RNA target region (SEQ ID NO: 13) with a hybridization interval of 1, 2, 4 or 6 nucleotides (SEQ ID NO: 16, 17, 18 and 19) to the second probe region and still form a 3WJ and produce an optimal SMART reaction and signal.

[0708] Using the E. coli 16S rRNA second probe (SEQ ID NO: 8) and the first probe with 0- (standard, SEQ ID NO: 7), 1-, 2-, 4- and 6-nucleotide intervals (SEQ ID NOs: 16, 17, 18 and 19), we ran the apta-SMART reaction as detailed below: the reaction mixture containing the first and second probes (840 and 700 fmols, respectively) and 17.5 nM sRNA (SEQ ID NO: 13) in 1X transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 2 mM spermidine and 10 mM NaCl) (from T7 RNA, pol, Promega) with the addition of 1 mM spermidine (Sigma) was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. After that, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNApol and 25 U T7 RNApol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths in a black bottom 384-well plate (Nunc) using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader).

[0709] Figure 6 Detection of sRNA by Mango-SMART using "on-target" contiguous probes and probes with 1-nt to 6-nt gaps between target hybridization regions is shown. All conditions optimally detected 17.5 nM sRNA, showing a fold change of >4.0 ( Figure 6 B).

[0710] Example 4: Minimum hybridization region length between probe and target.

[0711] To elucidate whether probes with hybridization regions shorter than the standard 29-nt (SEQ ID NOs: 7 and 8) to the target are still optimal for the apta-SMART reaction, we performed experiments using (1) E. coli 16S sRNA (SEQ ID NO: 13) as target and (2) NASBA products of the E. coli 16S rRNA region, using 22-nt, 15-nt, and 7-nt hybridization regions in the first probe (SEQ ID NOs: 20, 21, and 22) and the second probe (SEQ ID NOs: 23, 24, and 25). All probes contained the standard 8-nt 3WJ region and were detected by the Mango aptamer as in the previous two examples.

[0712] 4.1. Apta-SMART detection of Escherichia coli 16S synthetic RNA target with probes of different lengths

[0713] Using the 29-nucleotide (-nt) E. coli 16S rRNA standard first and second probes (SEQ ID NOs: 7 and 8) containing the Mango aptamer and the 22-nt, 15-nt and 7-nt first (SEQ ID NOs: 20, 21 and 22) and second (SEQ ID NOs: 23, 24 and 25) probes for detecting the reverse complementary RNA sequence (synthetic target) (SEQ ID NO: 13) of the E. coli 16S rRNA (SEQ ID NO: 6), we ran the apta-SMART reaction as detailed below: The first and second probes (840 and 700 fmols, respectively) containing the first and second probes (from T7 RNA, pol, Promega) were incubated with 17.5 nM sRNA (SEQ ID NO: 13) in 1X transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 2 mM spermidine and 10 mM NaCl) supplemented with 1 mM spermidine (Sigma). NO: 13) reaction mixture, which was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. Afterwards, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2U Bst DNA pol and 25UT7 RNA pol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths in a black bottom 384-well plate (Nunc) using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader).

[0714] 4.2. Apta-SMART detection of E. coli 16S RNA region with probes of different lengths after NASBA reaction

[0715] Based on the previously published primers (OV2 and OV3: SEQ ID NOs: 4 and 5, respectively) for NASBA detection of Escherichia coli 16S rRNA (SEQ ID NO: 6) (Kao et al. Anal Letters, 2010), we designed an E. coli 16S rRNA first probe (SEQ ID NO: 7) and a modified second probe containing a T7 promoter and a Mango aptamer (SEQ ID NO: 8) to detect the previously reported reverse complementary sequence (RC) region of the E. coli 16S rRNA (SEQ ID NO: 9) (Kao et al. Anal Letters, 2010).

[0716] Step 1: NASBA.

[0717] We used a 5' primer (SEQ ID NO: 4) and a 3' primer containing a T7 promoter (SEQ ID NO: 5) that was previously published for isothermal amplification of a region (SEQ ID NO: 9) of the E. coli 16S rRNA (SEQ ID NO: 6) (Kao et al. Anal Letters, 2010). NASBA consisted of a reaction (final volume of 15 μL) containing 2 μL of E. coli culture and 500 nM NASBA primer in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - equivalent to 3 μL reaction mixture) with an initial denaturation step of 2 minutes at 95°C and 2 minutes at 37°C. Then, 5 μL of enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37° C. for 90 minutes. The resulting amplified fragment was the reverse complementary sequence (RC) region (SEQ ID NO: 9) of the 191-nt region of E. coli 16S rRNA (SEQ ID NO: 6), which was used as a template for the Mango-SMART reaction (step 2).

[0718] Step 2: Mango-SMART detection.

[0719] Using 29-nt, 22-nt, 15-nt and 7-nt E. coli 16S rRNA first probes (SEQ ID NOs: 7, 20, 21 and 22) and a second probe containing a Mango aptamer (SEQ ID NOs: 8, 23, 24 and 25) to detect the reverse complementary RNA sequence of E. coli 16S RNA (SEQ ID NO: 6), we ran the Mango-SMART reaction as detailed below: the reaction mixture containing the first and second probes (840 and 700 fmols, respectively) was reacted with 1 μL NASBA in 1X transcription buffer (see composition above, from T7 RNA, pol, Promega) supplemented with 1 mM spermidine (Sigma), which was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. After that, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA pol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader) in a black bottom 384-well plate (Nunc).

[0720] like Figure 7 As shown in Figure 2, Mango-SMART signal was optimal when using sRNA as target with a hybridization region as low as 15-nt per probe, but the reaction was completely ineffective when using probes with only a 7-nt hybridization region ( Figure 7 A). Thus, the 7-nt hybridization showed no signal (compared to no RNA), while the 15-nt, 22-nt, and 29-nt probes showed an increase of 6.1 to 7.7-fold compared to no RNA ( Figure 7 B). When using NASBA amplicons as targets, for sRNA, the reactions showed positive Mango-TO1 signal results for the standard 29-nt hybridization region length down to 15-nt (per probe), but no signal was detected for the 7-nt hybridization region ( Figure 7 C). When the data were normalized to the NASBA no-RNA data point ( Figure 7 D), 29-nt, 22-nt, and 15-nt probes showed fold changes > 1.5, indicating positivity.

[0721] Example 5: Comparison of Molecular Beacon (MB) and apta-SMART Assays

[0722] In this example, we compared the detection of newly synthesized RNA using molecular beacons with our apta-SMART (using Mango aptamers) detection method. For comparison, the SARS-CoV-2 first and second probes (SEQ ID NOs: 26 and 27, respectively) were used to detect the reverse complement (RC) of the region of the SARS-CoV-2 S "spike" ssRNA that encodes the spike-S glycoprotein-; hereinafter referred to as S "spike" RNA), the sequence of which was the same as the result of the NASBA reaction. We tested the SMART reaction using: (1) a synthetic RNA consisting of a 30-nucleotide interaction region (SEQ ID NO: 28) and (2) the RC RNA sequence produced by the NASBA reaction (SEQ ID NO: 29).

[0723] For the Mango-SMART assay, we used a SARS-CoV-2 first probe (SEQ ID NO: 26) and a second probe containing a Mango aptamer (SEQ ID NO: 27).

[0724] To detect the same region of SARS-CoV-2 using molecular beacon (MB) detection (see Figure 8 We designed a new SARS-CoV-2 second probe (SEQ ID No: 30) containing a 25-nt RNA sequence identical to the internal loop of the molecular beacon oligonucleotide probe (instead of the Mango-aptamer sequence). The molecular beacon oligonucleotide probe used for detection (SEQ ID NO: 31) (Zhao et al. J Clin Microbiol, 2009) contains a sequence derived from Escherichia coli with complementary 5' and 3' ends.

[0725] 4.1. Apta-SMART detection of synthetic targets

[0726] Using a SARS-CoV-2 first probe (SEQ ID NO: 26) and a SARS-CoV-2 second probe (SEQ ID NO: 27) containing a Mango aptamer to detect the reverse complementary RNA sequence (synthetic target) (SEQ ID NO: 28) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32), we ran the apta-SMART reaction as detailed below (using Mango as the fluorescent aptamer): the reaction mixture containing the first and second probes (840 and 700 fmols, respectively) and 1.75, 17.5 or 175 nM synthetic RNA in 1X transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 2 mM spermidine and 10 mM NaCl) (from T7 RNA, pol, Promega) with 1 mM spermidine (Sigma) was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. After that, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNApol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader) in a black bottom 384-well plate (Nunc).

[0727] 4.2. Apta-SMART detection of genomic regions after NASBA

[0728] Step 1: NASBA.

[0729] We designed a 5' primer (SEQ ID NO: 33) and a 3' primer containing a T7 promoter (SEQ ID NO: 34) that isothermally amplified a 189 nucleotide region (SEQ ID NO: 29) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32). The NASBA reaction consisted of a reaction (final volume of 15 μL) containing 2 μL of previously isolated SARS-CoV-RNA (with a known Ct value assessed by qPCR) and 500 nM NASBA primers in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - equivalent to 3 μL reaction mixture) with an initial denaturation step of 2 minutes at 95°C and then 2 minutes at 37°C. Then 5 μL of enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37°C for 90 minutes. The resulting amplified fragment (SEQ ID NO: 29) is the reverse complementary sequence (RC) region of the S "spike" RNA (SEQ ID NO: 32) and is used as a template for the Mango-SMART reaction (step 2).

[0730] Step 2a: Mango-SMART detection.

[0731] Using a SARS-CoV-2 first probe (SEQ ID NO: 26) and a SARS-CoV-2 second probe (SEQ ID NO: 27) containing a Mango aptamer to detect the RC RNA sequence (result of a NASBA reaction) (SEQ ID NO: 29) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32), we ran the Mango-SMART reaction as detailed below: a reaction mixture containing the first and second probes (840 and 700 fmols, respectively) with 1 μL of NASBA reaction or 1.75, 17.5, or 175 nM synthetic RNA in 1X transcription buffer (as described above; from T7 RNA pol, Promega) supplemented with 1 mM spermidine (Sigma) was denatured at 65°C for 5 min, followed by a pre-incubation step at 41°C for 60 min. After that, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U of DNApol and 25 U of T7 RNApol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths in a black bottom 384-well plate (Nunc) using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader).

[0732] 4.3. Molecular beacon (MB) detection analysis

[0733] MB detection of synthetic RNA

[0734] Using the SARS-CoV-2 first probe (SEQ ID NO: 26) and the SARS-CoV-2 second probe (SEQ ID NO: 30), which contains a 25-nt RNA sequence identical to the internal loop of the MB oligonucleotide probe (SEQ ID NO: 31, Zhao et al. J Clin Microbiol. 2009) and a RC RNA sequence (synthetic target) (SEQ ID NO: 28) for detecting the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32) region, we ran the SMART reaction as detailed below: a reaction mixture containing the first and second probes (840 and 700 fmols, respectively) with 1 μL NASBA reaction or 1.75, 17.5 or 175 nM synthetic RNA in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma) was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. Afterwards, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA pol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of MB oligonucleotide probe (SEQ ID NO: 31, Zhao et al. J Clin Microbiol. 2009) containing 5'-6-FAM (reporter gene) and 3'-Dabcyl (quencher) was added (at 3 different final concentrations: 300 nM, 100 nM and 10 nM) and incubated at room temperature in the dark for 60 minutes. The fluorescence signal from the hybridization beacon / target was read at 495 nm (excitation) and 520 nm (emission) wavelengths using a BioTek microplate reader (Synergy H1 hybrid multi-mode microplate reader) in a black bottom 384-well plate (Nunc).

[0735] MB detection in genomic regions after NASBA

[0736] Using the SARS-CoV-2 first probe (SEQ ID NO: 26) and the SARS-CoV-2 second probe (SEQ ID NO: 30), which contains a 25-nt RNA sequence identical to the internal loop of the MB oligonucleotide probe (SEQ ID NO: 31, Zhao et al. J Clin Microbiol. 2009) and is used to detect the RC RNA sequence (result of the NASBA reaction) (SEQ ID NO: 29) in the region of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32), we ran the SMART reaction as detailed below: a reaction mixture containing the first and second probes (840 and 700 fmols, respectively) with 1 μL NASBA reaction or 1.75, 17.5 or 175 nM synthetic RNA in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma) was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. Afterwards, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA pol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of MB oligonucleotide probe (SEQ ID NO: 31) (at 3 different final concentrations: 300 nM, 100 nM and 10 nM) was added and incubated at room temperature in the dark for 60 minutes. The fluorescence signal from the hybridization beacon / target was read at 495 nm (excitation) and 520 nm (emission) wavelengths using a BioTek microplate reader (Synergy H1 hybrid multi-mode microplate reader) in a black bottom 384-well plate (Nunc).

[0737] 4.4. Comparison of MB with apta-SMART using sRNA and NASBA products

[0738] exist Fig. 9 In the figure, we can see that, although there is some variability between experiments, Mango-TO1 is optimal for detection of 175 and 17.5nM sRNA concentrations, with fold changes approaching 4-fold compared to the no RNA control. 1.75nM sRNA was also detected, but with lower sensitivity (fold change did not reach 2-fold). However, when MB was used for detection, sensitivity was completely lost even at higher sRNA and MB concentrations (175nM and 300nM, respectively). All conditions failed to detect the sRNA concentrations tested. These results show the clear advantage of Mango-SMART over MB detection.

[0739] Fig.10Comparison of fluorescence detection of NASBA products from the SARS-CoV-2 "spike" S RNA region is shown. For sRNA, the Mango-SMART method was sensitive to detect NASBA products from the three SARS-CoV-2 RNA samples tested (Ct values ​​ranged from 13.23 to 22.66), with a change of ≥1.5-fold compared to NASBA no RNA (control). In contrast, MB was unable to detect any samples, confirming the lower range of detection sensitivity for SARS-CoV-2 RNA samples.

[0740] Example 6: Apta-SMART detection of synthetic RNA targets of E. coli 16S rRNA

[0741] Based on previously published primers for NASBA detection of the E. coli 16S rRNA region (SEQ ID NO: 6) (OV2 and OV3: SEQ ID NO: 4 and 5, respectively) (Kao et al. Anal Letters, 2010), we designed an E. coli 16S rRNA first probe (SEQ ID NO: 7) and a modified second probe containing a Mango aptamer (SEQ ID NO: 8) to detect the previously reported reverse complement sequence (RC) region of the E. coli 16S rRNA (SEQ ID NO: 9) (Kao et al. Anal Letters, 2010). Our detection of each bacterial species tested included a SMART reaction using sRNA of a 75-nucleotide region (SEQ ID NO: 13) that encompassed the hybridization region of the E. coli 16S rRNA first probe (SEQ ID NO: 7) and the second probe (SEQ ID NO: 8). The SMART reaction started with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes for the reaction mixture, which contained the first and second probes (840 and 700 fmol, respectively) and 17.5 nM synthetic RNA target in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma), made up to 7 μL. Then, 3 μL of dNTPs / NTPs and enzyme mix (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA-pol and 25 U T7 RNA pol) was added and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) was added (480 nM final concentration), followed by fluorescence reading at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black-bottom 384-well plate (Nunc).

[0742] like Fig.11 As shown, the Mango-SMART detection of E. coli 16S rRNA reached an optimal level at 17.5 nM sRNA, with a fold change of 6.0 compared to the no sRNA control. Using the no sRNA control as background fluorescence, an average of about 10.500 RFU was shown.

[0743] Example 7: Apta-SMART detection of synthetic RNA targets of E. coli 23S rRNA

[0744] We designed a first probe of E. coli 23S rRNA (SEQ ID NO: 35) and a second probe containing a Mango aptamer (SEQ ID NO: 36) to detect the reverse complementary sequence (RC) (SEQ ID NO: 37) of the RNA region of E. coli 23S rRNA (SEQ ID NO: 38). We tested the SMART reaction using an sRNA (SEQ ID NO: 39) containing a 58-nucleotide region that interacts with the first and second probes of E. coli 23S. The SMART reaction first began with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes for the reaction mixture, which contained the first and second probes (420 and 350 fmol, respectively) and 17.5 nM synthetic RNA target in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma), made up to 7 μL. Then, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA pol) was added and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader) in a black bottom 384-well plate (Nunc).

[0745] like Fig.12 As shown, Mango-SMART detection of E. coli 23S rRNA was optimal using 17.5 nM sRNA, with a signal increase of 8.7 times (about 98.500 RFU) compared to the no sRNA control, while the average fluorescence value of the sRNA control was about 11.750 RFU.

[0746] Example 8: Apta-SMART detection of synthetic RNA targets of the methicillin resistance protein subunit A gene (mecA) of Staphylococcus aureus (S. aureus).

[0747] We designed a mecA first probe (SEQ ID NO: 40) and a mecA second probe (SEQ ID NO: 41) containing a Mango aptamer to detect the reverse complement (RC) of the RNA region (SEQ ID NO: 42) of the S. aureus mecA gene (SEQ ID NO: 43). We tested the SMART reaction using a synthetic RNA (SEQ ID NO: 44) containing a 98-nucleotide region of the 60-nt target-probe that interacts with the mecA first and second probes. The SMART reaction began with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes for the reaction mixture, which contained the first and second probes (420 and 350 fmol, respectively) and 17.5 nM synthetic RNA target in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma), made up to 7 μL. Then, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA pol) was added and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader) in a black bottom 384-well plate (Nunc).

[0748] Fig.13 Mango-SMART detection of the Staphylococcus aureus mecA gene using 17.5 nM sRNA is shown. The results show that the best detection change of sRNA is 9.1 times (about 79500 RFU) compared to the no sRNA control. Using the no sRNA control as background fluorescence, an average of about 8900 RFU is shown.

[0749] Example 9: Apta-SMART detection of synthetic RNA targets in the SARS-CoV-2S “spike” RNA region

[0750] We designed a SARS-CoV-2 first probe (SEQ ID NO: 26) and a second probe containing a Mango aptamer (SEQ ID NO: 27) to detect the reverse complement (RC) (SEQ ID NO: 29) of the 189-nt RNA region of the SARS-CoV-2 S "spike" RNA (SEQ ID No: 32). We tested the SMART reaction using a synthetic RNA (SEQ ID NO: 28) consisting of a 30-nucleotide region that interacts with the SARS-CoV-2 first and second probes. The SMART reaction began with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes for the reaction mixture, which contained the first and second probes (840 and 700 fmol, respectively) and 17.5 nM synthetic RNA target in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma), made up to 7 μL. Then, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA pol) was added and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader) in a black bottom 384-well plate (Nunc).

[0751] like Fig.14 As shown, the Mango-SMART detection of SARS-CoV-2S "spike" RNA using 17.5nM is optimal, although the fold change (about 4.1) is lower than the previous example. Using the no sRNA control as background fluorescence, the average RFU shown is slightly higher than the previous example (about 16400).

[0752] Example 10: Mango-SMART detection of synthetic RNA targets of influenza A and B viruses

[0753] We designed specific first probes (SEQ ID NOs: 45 and 46) and second probes containing Mango aptamers (SEQ ID NOs: 47 and 48) to detect highly specific RNA regions of influenza A and influenza B viruses (SEQ ID NOs: 49 and 50), respectively. For influenza A, this region corresponds to segment 2 of the polymerase PB1 (PB1) gene (SEQ ID NO: 51), while for influenza B, this region corresponds to segment 3 of the polymerase PA (PA) gene (SEQ ID NO: 52). We tested the SMART reaction using 30-nt long synthetic RNAs corresponding to 15-nt hybridizing nucleotides for each probe (first and second) against influenza A and influenza B viruses (SEQ ID NOs: 49 and 50, respectively). The SMART reaction started with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes for the reaction mixture, which contained the first and second probes (840 and 700 fmol, respectively) and 17.5 nM synthetic RNA target in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma), made up to 7 μL. Then, 3 μL of dNTPs / NTPs and enzyme mix (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA-pol) was added and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) was added (480 nM final concentration), followed by fluorescence reading at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black-bottom 384-well plate (Nunc).

[0754] like Fig.15 As shown, Mango-SMART detection of influenza A RNA region (corresponding to PB1 gene) and influenza B RNA region (corresponding to PA gene) using 17.5nM is optimal, wherein the RFU of influenza A and influenza B exceeds 30,000 units, and the fold changes are about 5.0 and about 2.4, respectively. The reading of the no sRNA control (background fluorescence) of influenza A virus is about 6700RFU, and the reading of the no sRNA control (background fluorescence) of influenza B virus is about 13200RFU.

[0755] Example 11: Apta-SMART detection of E. coli 16S rRNA after NASBA amplification

[0756] Step 1: NASBA

[0757] We used a 5' primer (SEQ ID NO: 4) and a 3' primer containing a T7 promoter (SEQ ID NO: 5), which was previously reported by Kao et al. (Anal Letters, 2010) to isothermally amplify a 191-nucleotide region (SEQ ID NO: 9) of the E. coli 16S rRNA (SEQ ID NO: 6). The NASBA reaction consisted of a mixture (final volume of 15 μL) containing 2 μL of previously isolated E. coli RNA and 1 μM NASBA primers in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - equivalent to 3 μL reaction mixture) with an initial denaturation step of 2 minutes at 95°C and 2 minutes at 37°C. Then, 5 μL of enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated for 90 minutes at 37° C. The resulting amplified region (SEQ ID NO: 9) is the reverse complementary sequence (RC) of the E. coli 16S rRNA fragment used as a template for the Mango-SMART reaction (step 2).

[0758] Step 1.1. ExoCIP treatment (optional)

[0759] In the assay using ExoCIP ( Fig.16 Figures B and D in Figure 3 ), immediately after NASBA amplification, 0.5 μL ExoCIP solution A and 0.5 μL ExoCIP solution B (New England Biolabs) were added to 2.5 uL NASBA product and incubated at 37° C. for 4 minutes. To inactivate the enzyme, the mixture was heated at 80° C. for 1 minute and then immediately subjected to apta-SMART.

[0760] Step 2: Mango-SMART.

[0761] Using the E. coli 16S first probe (SEQ ID NO: 7) and the second probe containing the Mango aptamer (SEQ ID NO: 8) in the previous example to detect the RC RNA sequence (NASBA reaction product) (SEQ ID NO: 9) of the E. coli 16S rRNA (SEQ ID NO: 6), we ran the Mango-SMART reaction as detailed below: the reaction mixture containing the first and second probes (840 and 700 fmols, respectively) and 1 μL NASBA reaction or 1.4 μL ExoCIP-treated NASBA product in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma) was made up to a volume of 7 μL, which was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. Afterwards, 3 μL of dNTPs / NTPs and enzyme mix (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNApol, and 25 U UT7 RNApol) was added to a final volume of 10 μL and incubated for another 60 min in the same buffer ( Fig.16 In addition, in the absence of dNTP (displayed as "-dNTP", Fig.16 ), that is, only the enzyme mixture (2mM NTP, 2U Bst DNApol and 25UT7 RNA-pol) was added to a final volume of 10μL, and the same reaction was performed. Finally, 1μL of 4.8μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480nM final concentration) was added, followed by reading the fluorescence at 510nm (excitation) and 535nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black bottom 384-well plate (Nunc).

[0762] Fig.16 Results of the Mango-SMART assay for E. coli 16S rRNA under different conditions tested are shown. As shown in Panel A (RFU) and Panel C (fold change), all cultured E. coli samples after NASBA amplification without ExoCIP treatment were detected with a fluorescence fold change >2.0 relative to the NASBA no RNA control. The differences between the addition and non-addition of dNTPs in the SMART assay step were not significant. Although there were some differences between the experiments performed in triplicate (-dNTPs) or quintuple (+dNTPs), the results were consistent even for the lowest bacterial concentration tested (10 2 Panels B (RFU) and D (fold change) show that the same samples tested with an ExoCIP cleanup step after NASBA amplification showed a slight improvement in detection: for the 106 (from 3.9 to 4.2) and 10 2 CFU / mL (approximately 2.2), lower changes resulted in tighter fold changes. For samples not treated with ExoCIP, the difference between -dNTPs and +dNTPs in the SMART assay did not affect the assay sensitivity.

[0763] Example 12: Apta-SMART detection of E. coli 23S rRNA after NASBA amplification

[0764] Step 1: NASBA

[0765] We designed a 5' primer (SEQ ID NO: 53) and a 3' primer containing a T7 promoter (SEQ ID NO: 54) that isothermally amplified a 256-nucleotide region (SEQ ID NO: 37) of the E. coli 23S rRNA (SEQ ID NO: 38). The NASBA reaction consisted of a mixture (final volume of 15 μL) containing 2 μL of previously isolated E. coli RNA and 1 μM NASBA primer in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - equivalent to 3 μL reaction mixture) with an initial denaturation step of 2 minutes at 95°C and 2 minutes at 37°C. Then, 5 μL of enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated for 90 minutes at 37° C. The resulting amplified RNA region (SEQ ID NO: 37) is the reverse complementary sequence (RC) of the E. coli 23S rRNA fragment used as a template for the Mango-SMART reaction (step 2).

[0766] Step 2: Mango-SMART.

[0767] Using the E. coli 23S rRNA first probe (SEQ ID NO: 35) and the second probe containing the Mango aptamer (SEQ ID NO: 36) in the previous example to detect the RC RNA sequence (NASBA reaction product) (SEQ ID NO: 37) of the E. coli 23S rRNA (SEQ ID NO: 38), we ran the Mango-SMART reaction as detailed below: The reaction mixture containing the first and second probes (840 and 700 fmols, respectively) and 1 μL NASBA reaction in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma) was made up to a volume of 7 μL, which was denatured at 65° C. for 5 minutes, followed by a pre-incubation step at 41° C. for 60 minutes. Afterwards, 3 μL dNTPs / NTPs and enzyme mix (containing 5 μM dNTPs, 2 mM NTPs, 2U BstDNA pol and 25U T7 RNApol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) was added (480 nM final concentration), followed by fluorescence reading at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black-bottom 384-well plate (Nunc).

[0768] exist Fig.17 We can see that for both culture samples, 10 4 and 10 6 Detection of the 23S rRNA region of E. coli was optimal, showing fold changes of 3.60 (31150 RFU) and 6.70 (64360 RFU) respectively compared to the NASBA no RNA control. Data were normalized to the NASBA no RNA control, with an average RFU of 9825.

[0769] Example 13: NASBA and apta-SMART detection of mecA Staphylococcus aureus.

[0770] Step 1: NASBA

[0771] We designed a 5' primer (SEQ ID NO: 55) and a 3' primer containing a T7 promoter (SEQ ID NO: 56) that isothermally amplified a 98-nucleotide region (SEQ ID NO: 42) of the mecA gene (SEQ ID NO: 43) of Staphylococcus aureus. The NASBA reaction consisted of a mixture (final volume of 15 μL) containing 2 μL of previously isolated mecA S. aureus RNA and 1 μM NASBA primer in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - equivalent to 3 μL reaction mixture) with an initial denaturation step of 2 minutes at 95°C and 2 minutes at 37°C. Then, 5 μL of enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37° C. for 90 minutes. The resulting amplified RNA region (SEQ ID NO: 42) was the reverse complement (RC) of the mecA S. aureus RNA fragment used as a template in the Mango-SMART reaction (step 2).

[0772] Step 2: Mango-SMART.

[0773] Using a mecA first probe (SEQ ID NO: 40) and a mecA second probe (SEQ ID NO: 41) comprising a Mango aptamer to detect the reverse complement (RC) (SEQ ID NO: 42) of the mecA RNA region (SEQ ID NO: 43) of S. aureus, we ran the Mango-SMART reaction as detailed below: The reaction mixture containing the first and second probes (420 and 350 fmols, respectively) reacted with 1 μL NASBA in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma) was made up to a volume of 7 μL, which was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. Afterwards, 3 μL dNTPs / NTPs and enzyme mix (containing 5 μM dNTPs, 2 mM NTPs, 2U Bst DNA-pol and 25U T7 RNApol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) was added (480 nM final concentration), followed by reading fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black-bottom 384-well plate (Nunc).

[0774] Fig.18 Showing 10 6 Optimal Mango-SMART assay for the mecA gene region of S. aureus cultures at CFU / mL. Across six independent replicates, the fold change for NASBA-amplified samples was 5.17 (64930 RFU vs. 13087 RFU) relative to the no RNA NASBA control.

[0775] Example 14: NASBA and apta-SMART detection of SARS-CoV-2S “spike” RNA

[0776] Step 1: NASBA

[0777] We designed a 5' primer (SEQ ID NO: 33) and a 3' primer containing a T7 promoter (SEQ ID NO: 34) that isothermally amplified a 189-nucleotide region (SEQ ID NO: 29) of the S "spike" RNA (SEQ ID NO: 32) of SARS-CoV-2. The NASBA reaction consisted of a mixture (final volume of 15 μL) containing 2 μL of previously isolated SARS-CoV-RNA (with a known Ct value assessed by qPCR) and 500 nM NASBA primers in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - equivalent to 3 μL reaction mixture) with an initial denaturation step of 2 minutes at 95°C and 2 minutes at 37°C. Then 5 μL of enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37°C for 90 minutes. The resulting amplified region (SEQ ID NO: 29) is the reverse complement (RC) of the S "spike" RNA fragment used as template in the Mango-SMART reaction (step 2).

[0778] Step 2: Mango-SMART.

[0779] Using the SARS-CoV-2 first probe (SEQ ID NO: 26) of the previous example and the SARS-CoV-2 second probe (SEQ ID NO: 27) comprising a Mango aptamer to detect the RCRNA sequence (result of the NASBA reaction) (SEQ ID NO: 29) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32), we ran the Mango-SMART reaction as detailed below: a reaction mixture containing the first and second probes (840 and 700 fmols, respectively) and 1 μL of NASBA reaction (instead of synthetic RNA) in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma) was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes. After that, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA-pol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths in a black bottom 384-well plate (Nunc) using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader).

[0780] exist Fig.19 We can see that the Mango-SMART detection of SARS-CoV-2 S "spike" RNA is the best for the three samples tested, with higher fold change values ​​for NASBA samples #3 and #7 (average of six independent experiments, 3.44 and 3.26 for samples #3 and #7, and 2.04 for sample #1). In this example, the Mango-TO1 RFU background for the No RNA or NASBA No RNA samples ranged from 15,375 to 18,000 RFU.

[0781] Example 15: Broccoli-SMART detection of synthetic RNA targets of E. coli 16S rRNA.

[0782] Based on the E. coli 16S rRNA first probe (SEQ ID NO: 7) and the second probe containing the Mango aptamer (SEQ ID NO: 8) used in Examples 2 and 6, we designed a modified second probe for detecting the same reverse complementary sequence (RC) region of the E. coli 16S rRNA (Kao et al. Anal Letters, 2010), but using the Broccoli RNA aptamer (SEQ ID NO: 57, Filonov et al. JACS, 2014) instead of Mango-III (A10U) (SEQID NO: 3, Trachman et al. Nat Chem Biol, 2019).

[0783] Our test included a SMART reaction using a synthetic RNA (SEQ ID NO: 13) of a 75-nucleotide region that interacts with the E. coli 16S rRNA first probe (SEQ ID NO: 7) and the Broccoli second probe (SEQ ID NO: 58). The SMART reaction first began with a denaturation step of the reaction mixture at 65°C for 5 minutes, followed by a pre-incubation step of the reaction mixture at 41°C for 60 minutes, the reaction mixture containing the first and second probes (840 and 700 fmol, respectively) and the synthetic RNA target (17.5 nM final concentration) in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma), made up to 7 μL. Then, 3 μL of dNTPs / NTPs and enzyme mix (containing 5 μM dNTPs, 2 mM NTPs, 2U Bst DNApol and 25U T7 RNA pol) was added and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 10 μM DFHBI or DFHBI-1T biotin fluorophore (MedChemExpress, #HY-110250 and #HY-110251, respectively) was added (1 μM final concentration), followed by fluorescence reading at 472 nm (excitation) and 507 nm (emission) wavelengths in a black-bottom 384-well plate (Nunc) using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader).

[0784] Fig. 20Shown is a comparison of Mango versus Broccoli aptamer detection of a 75-nt fragment of E. coli 16S rRNA synthetic RNA using the TO1-biotin ("TO1" in the figure) fluorophore (for Mango) and the DFHBI and DFHBI-1T fluorophore substrates (for Broccoli). The results show a clear advantage of Mango-TO1 over Broccoli (plus DFHBI or DFHBI-1T) in detecting this E. coli RNA fragment: Mango-TO1 showed a fold change of about 3.0 for sRNA compared to no RNA, while neither Broccoli-DFHBI nor Broccoli-DFHBI-1T reached 2.2-fold.

[0785] Example 16: SMART-Broccoli detection of synthetic RNA targets of SARS-CoV-2 S “spike” RNA.

[0786] Based on the SARS-CoV-2 first probe (SEQ ID NO: 26) and the second probe containing the Mango aptamer (SEQ ID NO: 27), we designed a modified second probe (SEQ ID NO: 59) to detect the same reverse complementary sequence (RC) (SEQ ID NO: 29) of the region of the SARS-CoV-2S "spike" RNA (SEQ ID NO: 32) using the Broccoli RNA aptamer (SEQ ID NO: 57) instead of Mango-III (A10U) (SEQ ID NO: 3).

[0787] We tested the SMART reaction using a synthetic RNA (SEQ ID NO: 28) consisting of a 30-nucleotide region that interacts with the SARS-CoV-2 first probe (SEQ ID NO: 26) and the second probe (SEQ ID NO: 59). The SMART reaction was subjected to a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes for the reaction mixture, which contained the first and second probes (840 and 700 fmol, respectively) and the synthetic RNA target (17.5 nM final concentration) in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma), made up to 7 μL. Then, 3 μL of dNTPs / NTPs and enzyme mix (containing 5 μM dNTPs, 2 mM NTPs, 2U Bst DNA pol, and 25U T7 RNApol) was added and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 10 μM DFHBI or DFHBI-1T biotin fluorophore (MedChemExpress, #HY-110250 and #HY-110251, respectively) was added (1 μM final concentration), followed by fluorescence reading at 472 nm (excitation) and 507 nm (emission) wavelengths in a black-bottom 384-well plate (Nunc) using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader).

[0788] exist Fig.21 As we can see, a comparison of Mango versus Broccoli aptamer detection was also performed on a 30-nucleotide synthetic RNA fragment of the S "spike" RNA of SARS-CoV-2, as shown in Example 14, which used TO1-biotin (for Mango) and DFHBI and DFHBI-1T (for Broccoli). The results again show that Mango-TO1 has a clear advantage over Broccoli (using DFHBI or DFHBI-1T) in detecting SARS-CoV-2 RNA. The fold change of sRNA for Mango-TO1 relative to no RNA was about 5.0, while the fold change of sRNA for Broccoli-DFHBI and Broccoli-DFHBI-1T was only 2.5-fold and 3.3-fold, respectively. Nevertheless, these are the best fold changes (>2.0), confirming that Broccoli and its fluorophore substrate can be used as an alternative aptamer to replace Mango (if necessary) for apta-SMART detection.

[0789] Example 17: One-pot NASBA-Apta-SMART detection of E. coli 23S rRNA

[0790] As a strategy to improve the efficiency of the method described in this patent, a one-pot NASBA-Apta-SMART reaction was developed. This strategy allows the detection of E. coli 23S rRNA by performing consecutive NASBA and Apta-SMART reactions by combining the reagents and enzymes of the two steps in only one test tube.

[0791] In the first step, we used the 5' primer (SEQ ID NO: 53) and the 3' primer (SEQ ID NO: 54) containing the T7 promoter in the previous Example 12, which isothermally amplified the 256-nucleotide region (SEQ ID NO: 37) of the E. coli 23S rRNA (SEQ ID NO: 38). In the second step, the resulting NASBA amplicon (RC RNA sequence; SEQ ID NO: 37) of the E. coli 23S rRNA (SEQ ID NO: 38) was detected by using the E. coli 23S rRNA first probe (SEQ ID NO: 35) in the previous example and a modified second probe (SEQ ID NO: 76) containing the reverse complementary sequence of the SP6 RNA polymerase promoter (SEQ ID NO: 75; instead of the T7 promoter sequence) and the Mango aptamer. We used a synthetic RNA (SEQ ID NO: 39) containing a 58-nucleotide region that interacts with the first and second probes as a positive control for the SMART reaction.

[0792] We ran NASBA-Apta-SMART reactions as detailed below: the mixture containing 2 μL of previously isolated E. coli RNA (25 nM synthetic RNA target was used for positive control) and 0.5 μM NASBA primer (final volume 15 μM) in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 10% uL DMSO - equivalent to 2 μL reaction mixture) was subjected to an initial denaturation step at 65°C for 5 minutes and 37°C for 2 minutes. Then, 1.5 μL of NASBA enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32UT7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated for 30 minutes at 37° C. Then, 3.5 μL of Apta-SMART probe and enzyme mixture (containing 420 nM first probe, 350 nM second probe, 1 mM spermidine, 2 U Bst DNA pol and 25 U SP6 RNA-pol) was added to a final volume of 20 μL and incubated for another 30, 60 and 90 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) was added to 10 μL of NASBA-Apta-SMART sample (480 nM final concentration), followed by reading fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black-bottom 384-well plate (Nunc).

[0793] exist Fig.23 We can see that for the two replicate samples, for 10 6 The detection of the 23S rRNA region of E. coli CFU / mL was optimal, showing the highest fold change 1.5 hours after the start of the reaction compared to the no RNA control (3.05-19207 RFU and 2.75-17319 RFU, respectively). The data were normalized to the no RNA control, with an average RFU of 6291.

[0794] Example 18: NASBA-Apta-SMART one-pot detection of SARS-CoV-2S “spike” RNA

[0795] The same one-pot strategy used in the previous examples was optimized for the detection of SARS-CoV-2 S "spike" RNA. In the first step, we used the 5' primer (SEQ ID NO: 33) and the 3' primer containing the T7 promoter (SEQ ID NO: 34) in the previous Example 14, which isothermally amplified the 189-nucleotide region (SEQ ID NO: 29) of the S "spike" RNA of SARS-CoV-2 (SEQ ID NO: 32). In the second step, the resulting NASBA amplicon (RCRNA sequence; SEQ ID NO: 29) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32) was detected by using the SARS-CoV-2 first probe (SEQ ID NO: 26) in the previous example and a modified second probe (SEQ ID NO: 78) containing the reverse complement sequence of the SP6 RNA polymerase promoter (SEQ ID NO: 75; instead of the T7 promoter sequence) and the Mango aptamer. We used a synthetic RNA (SEQ ID NO: 28) containing a 30-nucleotide region that interacts with the first and second probes as a positive control for the SMART reaction.

[0796] We ran NASBA-Apta-SMART reactions as detailed below: a mixture containing 2 μL of previously isolated SARS-CoV-2 RNA (25 nM synthetic RNA target was used for positive control) and 0.5 μM NASBA primer (final volume 15 μM) in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 10% uL DMSO - equivalent to 2 μL reaction mixture) was subjected to an initial denaturation step of 5 min at 65°C and 2 min at 37°C. Then, 1.5 μL of NASBA enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32UT7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated for 30 minutes at 37° C. Then, 3.5 μL of Apta-SMART probe and enzyme mixture (containing 420 nM first probe, 350 nM second probe, 1 mM spermidine, 2 U Bst DNA pol and 25 U SP6 RNA-pol) was added to a final volume of 20 μL and incubated for another 30, 60 and 90 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) was added to 10 μL of NASBA-Apta-SMART sample (480 nM final concentration), followed by reading fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black-bottom 384-well plate (Nunc).

[0797] exist Fig.24 We can see that for both RNA samples tested, detection of the SARS-CoV-2S “spike” RNA was optimal, showing the highest fold change 1 hour after the start of the reaction compared to the no RNA control (4.02 - 27661 RFU for RNA#1 and 3.99 - 27470 RFU for RNA#2). The data were normalized by the no RNA control, with an average RFU of 6889.

[0798] Example 19: One-pot NASBA-Apta-SMART detection of E. coli 23S rRNA (exchange RNA polymerase)

[0799] To confirm that any DNA-guided RNA polymerase could be used in both steps of the one-pot NASBA-Apta-SMART reaction, we tested swapping RNA polymerases. In this experiment, we used SP6 RNA polymerase in the NASBA reaction and T7 RNA polymerase in the Apta-SMART assay step.

[0800] In the first step, we used the 5' primer (SEQ ID NO: 53) in the previous example and a modified 3' primer (SEQ ID NO: 80) containing the Sp6 promoter (instead of the T7 promoter sequence), which isothermally amplified the same 256-nucleotide region (SEQ ID NO: 37) of the E. coli 23S rRNA (SEQ ID NO: 38). In the second step, the resulting NASBA amplicon (RC RNA sequence; SEQ ID NO: 37) of the E. coli 23S rRNA (SEQ ID NO: 38) was detected by using the E. coli 23S rRNA first probe (SEQ ID NO: 35) of the previous example and a second probe containing the T7RC promoter sequence and the Mango aptamer (SEQ ID NO: 36). We used a synthetic RNA (SEQ ID NO: 39) containing a 58-nucleotide region that interacts with the first and second probes as a positive control for the SMART reaction.

[0801] As in the previous example, we ran the NASBA-Apta-SMART reaction as detailed below: the mixture containing 2 μL of previously isolated E. coli RNA (250 nM synthetic RNA target was used for positive control) and 0.5 μM NASBA primer (final volume 15 μM) in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 10% uL DMSO - equivalent to 2 μL reaction mixture) was subjected to an initial denaturation step at 65°C for 5 minutes and 37°C for 2 minutes. Then, 1.5 μL of NASBA enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32 U Sp6 RNA polymerase, and 120 μg / mL BSA in water) was added and incubated for 30 minutes at 37° C. Then, 3.5 μL of Appta-SMART probe and enzyme mixture (containing 420 nM first probe, 350 nM second probe, 1 mM spermidine, 2 U Bst DNA pol, and 25 U T7 RNA-pol) was added to a final volume of 20 μL and incubated for another 30, 60, and 90 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) was added to 10 μL of NASBA-Apta-SMART sample (480 nM final concentration), followed by fluorescence reading at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black-bottom 384-well plate (Nunc).

[0802] exist Fig.25 We can see that for the two replicate samples, for 10 6 The detection of the 23S rRNA region of CFU / mL E. coli was also optimal, showing the highest fold change at 1.5 hours after the start of the reaction compared to the no RNA control (2.46-25169 RFU and 2.52-25804 RFU, respectively). The data were normalized to the no RNA control, with an average RFU of 10221. This experiment confirms that any DNA-guided RNA phage polymerase (preferably one of T3, T7 or SP6 polymerases) can be used in each step of the one-pot NASBA-Apta-SMART reaction, i.e., using a different RNA polymerase at each step.

[0803] Example 20: One-pot NASBA-Apta-SMART detection of mecA Staphylococcus aureus

[0804] The same one-pot strategy used in the previous example was optimized for the detection of the methicillin resistance protein subunit A gene (mecA) of the Staphylococcus aureus rRNA. In the first step, we used the 5' primer (SEQ ID NO: 55) and the 3' primer containing the T7 promoter (SEQ ID NO: 56) in the previous example 13, which isothermally amplified a 98-nucleotide region (SEQ ID NO: 42) of the mecA gene (SEQ ID NO: 43) of Staphylococcus aureus. In the second step, the resulting NASBA amplicon (RC RNA sequence; SEQ ID NO: 42) of Staphylococcus aureus mecA (SEQ ID NO: 43) was detected by using the mecA first probe (SEQ ID NO: 40) in the previous example and a modified second probe containing the reverse complement sequence of the SP6 RNA polymerase promoter (SEQ ID NO: 75; instead of the T7 promoter sequence) and the Mango aptamer (SEQ ID NO: 81). We used a synthetic RNA (SEQ ID NO: 44) consisting of a 98-nucleotide region encompassing 60-nt that interacts with the first and second probes as a positive control for the SMART reaction.

[0805] We ran NASBA-Apta-SMART reactions as detailed below: a mixture containing 2 μL of previously isolated mecA S. aureus (250 nM synthetic RNA target was used for positive control) and 0.5 μM NASBA primer (final volume 15 μM) in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 10% uL DMSO - equivalent to 2 μL reaction mixture) was subjected to an initial denaturation step at 65°C for 5 minutes and 37°C for 2 minutes. Then, 1.5 μL of NASBA enzyme mixture (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated for 30 minutes at 37° C. Then, 3.5 μL of Apta-SMART probe and enzyme mixture (containing 420 nM first probe, 350 nM second probe, 1 mM spermidine, 2 U Bst DNA pol and 25 U Sp6 RNA pol) was added to a final volume of 20 μL and incubated for another 30, 60 and 90 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) was added to 10 μL of NASBA-Apta-SMART sample (480 nM final concentration), followed by reading fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths using a Bio Tek microplate reader (Synergy H1 Hybrid Multimode Microplate Reader) in a black-bottom 384-well plate (Nunc).

[0806] exist Fig.26 We can see that for the two replicate samples, for 10 6 The detection of the region of the mecA gene in the culture of S. aureus at CFU / mL was optimal, showing the highest fold change 1 hour after the start of the reaction compared to the no RNA control (10.29-51816 RFU and 9.76-49120 RFU, respectively). The data were normalized to the no RNA control, with an average RFU of 5034.

[0807] Example 21: Multiplex Apta-SMART Detection of E. coli 23S rRNA after NASBA Amplification

[0808] This example shows the possibility of detecting the E. coli 23S rRNA target by performing two Mango-Apta-SMART methods over the length of the above target. For this purpose, a second pair of first and second probes that hybridize in adjacent regions of the E. coli 23S rRNA target (SEQ ID NO: 37) detected in the previous example were designed. The second pair of probes (SEQ ID NOs: 83 and 84) were used together with the aforementioned first and second probes (SEQ ID NOs: 35 and 36, respectively) for detecting the E. coli 23S rRNA target (SEQ ID NO: 37). Each pair of probes forms a three-way junction structure, and each probe is capable of generating multiple copies of the Mango RNA aptamer for detection by fluorescence readout after adding a fluorophore substrate.

[0809] Step 1: NASBA.

[0810] For E. coli RNA amplification, we used the 5' primer (SEQ ID NO: 53) and the 3' primer containing the T7 promoter (SEQ ID NO: 54) from the previous Example 12, which isothermally amplified a 256-nucleotide region (SEQ ID NO: 37) of the E. coli 23S rRNA (SEQ ID NO: 38). The NASBA reaction consisted of a mixture (final volume of 15 μL) containing 2 μL of previously isolated E. coli RNA and 500 mM NASBA primers in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTPs, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - equivalent to 3 μL reaction mixture) with an initial denaturation step of 5 minutes at 65°C and 2 minutes at 37°C. Then add 5 μL of enzyme mixture (6.8U AMV-RT, 0.08U RNAse H, 32U T7 RNA polymerase and 120μg / mL BSA in water) and incubate at 37°C for 90 minutes. The resulting amplified RNA region (SEQ ID NO: 37) is the reverse complementary sequence (RC) of the E. coli 23S rRNA fragment used as a template for the Mango-SMART reaction (step 2).

[0811] Step 2: Mango-SMART.

[0812] Using the E. coli 23S rRNA first probe (SEQ ID NO: 35) and the second probe (SEQ ID NO: 36) containing the Mango aptamer for detecting the RC RNA sequence (NASBA reaction product) (SEQ ID NO: 37) of region 1 (R1) of the E. coli 23S rRNA (SEQ ID NO: 38) in the previous example, as well as the newly designed first probe (SEQ ID NO: 83) hybridizing to region 2 (R2) of the same target (SEQ ID NO: 37) and the second probe (SEQ ID NO: 84) also containing the Mango aptamer, we ran the Mango-SMART reaction as detailed below: The reaction mixture containing the first and second probes (840 fmols of each first probe and 700 fmols of each second probe) and 1 μL of NASBA reaction in 1X transcription buffer (Promega) supplemented with 1 mM spermidine (Sigma) was made up to a volume of 7 μL, which was denatured at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 30 minutes. Afterwards, 3 μL of dNTPs / NTPs and enzyme mixture (containing 5 μM dNTPs, 2 mM NTPs, 2 U Bst DNA pol and 25 U T7 RNA-pol) was added to a final volume of 10 μL and incubated for another 60 minutes in the same buffer. Finally, 1 μL of 4.8 μM TO1-biotin fluorophore (BioCat, Cat#: G955-ABM) (480 nM final concentration) was added, followed by reading the fluorescence at 510 nm (excitation) and 535 nm (emission) wavelengths in a black-bottom 384-well plate (Nunc) using a Bio Tek microplate reader (Synergy H1 hybrid multi-mode microplate reader). Each pair of first and second probes was also tested separately to confirm the formation of a three-way junction and the generation of multiple MangoRNA aptamer copies of the two pairs of probes.

[0813] exist Fig. 27 As we can see, using two different pairs of probes (which hybridize to two different regions of the NASBA amplicon target) to detect 10 6 The 23S rRNA region of E. coli was optimal for detection, showing a fold change of 4.71 (25126 RFU) compared to the NASBA no RNA control. Data were normalized to the NASBA no RNA control (5335 RFU). 6Detection of CFU / mL E. coli was also optimal, with fold changes of 2.38 (9915 RFU) and 1.92 (10390 RFU) for regions R1 and R2, respectively, compared to the NASBA no RNA control. Data were normalized to the NASBA no RNA control (4158 and 5424, respectively). When the two probe pairs were used together, an increase in the intensity of the fluorescence signal of the Mango-substrate complex was detected.

[0814] References

[0815] ●Filonov et al. Broccoli: Rapid Selection of an RNA Mimic of GreenFluorescent Protein by Fluorescence-Based Selection and DirectedEvolution. Journal of the American Chemical Society, 136(46), 16299-16308(2014).

[0816] ●Kao et al. Detection of Escherichia coli Using Nucleic AcidSequence-Based Amplification and Oligonucleotide Probes for 16S RibosomalRNA. Analytical Letters, 43, 1756-1769 (2010).

[0817] ●Trachman et al. Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nature Chemical Biology, 15, 472-479 (2019).

[0818] ●Wharam et al.Specific detection of DNA and RNA targets using anovel isothermal nucleic acid amplification assay based on the formation of athree-way junction structure.Nucleic Acids Research,29(11),e54(2001).

[0819] ●Zhao et al.Rapid Real-Time Nucleic Acid Sequence-BasedAmplification-Molecular Beacon Platform to Detect Fungal and BacterialBloodstream Infections.Journal of Clinical Microbiology,47(7),2067-2078(2009).

Claims

1. A method for detecting the presence of a target nucleic acid in a sample, the method comprising the following steps: a) adding a first nucleic acid probe and a second nucleic acid probe to a sample containing the target nucleic acid, so that the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe are hybridized to form a three-way junction structure, wherein: i) the first probe comprises: a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing with the first portion of the target nucleic acid; and an arm region located at the 3' region of the probe; ii) the second probe comprises: (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing with the second portion of the target nucleic acid, and (2) an arm region located at the 5' region of the probe, the arm region including in the 5' to 3' direction: - at least one full-length reverse complementary sequence of a fluorescent aptamer, - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter, - a region of 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region of 5 to 9 nucleotides is fully or partially contained within the full-length reverse complement sequence of the DNA-guided RNA polymerase promoter, and iii) the target nucleic acid comprises: a first portion located at the 3' region of the target nucleic acid, the first portion being complementary to the foot region of the first probe; and a second portion located at the 5' region of the target nucleic acid, the second portion being complementary to the foot region of the second probe, wherein the first portion is adjacent or substantially adjacent to the second portion, and wherein when the target nucleic acid is present in the sample, a three-way junction structure is formed between the first probe, the second probe and the target nucleic acid, and b) adding a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe; c) adding a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) so as to cause de novo synthesis of a single-stranded nucleic acid comprising the at least one fluorescent aptamer; and d) adding at least one fluorophore ligand of the at least one fluorescent aptamer, thereby directly detecting the de novo synthesized nucleic acid comprising the at least one fluorescent aptamer, wherein the detection of the nucleic acid comprising the at least one fluorescent aptamer indicates the presence of the target nucleic acid in the sample, wherein, optionally, the method further comprises an amplification step before step a), wherein the target nucleic acid is amplified.

2. The method according to claim 1, wherein: - the double-stranded RNA promoter formed in step b) is a T7 RNA polymerase promoter, and wherein the DNA-guided RNA polymerase added in step c) is T7 RNA polymerase, or - the double-stranded RNA promoter formed in step b) is an SP6 RNA polymerase promoter, and wherein the DNA-guided RNA polymerase added in step c) is an SP6 RNA polymerase, or - the double-stranded RNA promoter formed in step b) is a T3 RNA polymerase promoter, and wherein said DNA-guided RNA polymerase added in step c) is T3 RNA polymerase.

3. The method according to any one of claims 1 or 2, wherein the DNA-guided DNA polymerase added in step b) is Bacillus stearothermophilus DNA polymerase I. 4 . The method according to claim 1 , wherein the foot region of the first probe and / or the second probe is at least 15 nucleotides in length. 5 . The method according to any one of claims 1 to 4 , wherein the at least one fluorescent aptamer is a Mango aptamer or a Broccoli aptamer.

6. The method according to claim 5, wherein if the at least one fluorescent aptamer contained in the arm of the second probe is a Mango aptamer, the at least one fluorescent ligand added in step d) is a TO1 biotin fluorophore, or wherein if the at least one fluorescent aptamer contained in the arm of the second probe is a Broccoli aptamer, the at least one fluorescent ligand added in step d) is a DFHBI or DFHBI-1T fluorophore.

7. The method according to any one of claims 1 to 6, wherein the method further comprises an amplification step prior to step a), the amplification step comprising amplifying the target nucleic acid to provide a plurality of molecules identical to the target nucleic acid or its reverse complementary sequence, wherein the plurality of molecules represent the target nucleic acid in subsequent steps a) to d), and wherein the amplification step is optionally followed by a step of post-amplification degradation of residual amplification primers and dephosphorylation of excess dNTPs.

8. The method of claim 7, wherein the amplification step is performed by nucleic acid sequence based amplification (NASBA).

9. The method according to any one of claims 1 to 8, wherein the target nucleic acid is an RNA molecule, preferably derived from the genome of an infectious agent such as a bacterium or a virus.

10. The process according to any one of claims 1 to 9, wherein the process is performed as a one-pot reaction.

11. The method according to any one of claims 1 to 10, wherein the method comprises the following steps: a) amplifying the target nucleic acid, preferably using an amplification method, preferably the NASBA method, and subsequently or overlappingly or simultaneously, preferably subsequently, adding a first nucleic acid probe and a second nucleic acid probe to the sample so as to form a three-way junction structure of the present invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe, wherein: i) the first probe comprises: a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing with the first portion of the target nucleic acid; and an arm region located at the 3' region of the probe; ii) the second probe comprises: (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing with the second portion of the target nucleic acid, and (2) an arm region located at the 5' region of the probe, the arm region preferably including in the 5' to 3' direction: - at least one full-length reverse complementary sequence of a fluorescent aptamer, - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter, - a region comprising 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region comprising 5 to 9 nucleotides is fully or partially contained in the full-length reverse complement sequence of the DNA-guided RNA polymerase promoter, and iii) the target nucleic acid comprises: a first portion located at the 3' region of the target nucleic acid, the first portion being complementary to the foot region of the first probe; and a second portion located at the 5' region of the target nucleic acid, the second portion being complementary to the foot region of the second probe, wherein the first portion is adjacent or substantially adjacent to the second portion, and wherein when the target nucleic acid is present in the sample, a three-way junction structure is formed between the first probe, the second probe and the target nucleic acid, and e) adding a DNA-guided DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, thereby generating a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescent aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe; f) adding a DNA-guided RNA polymerase that recognizes the double-stranded promoter formed in step b) so as to cause de novo synthesis of a single-stranded nucleic acid comprising the at least one fluorescent aptamer; and g) adding at least one fluorophore ligand of the at least one fluorescent aptamer, thereby directly detecting, optionally quantifying, de novo synthesized nucleic acids comprising the at least one fluorescent aptamer, wherein detection, optionally quantifying, of the nucleic acids comprising the at least one fluorescent aptamer indicates the presence of the target nucleic acid in the sample.

12. The method according to claim 11, wherein the promoter used for the amplification performed in step a) is different from the DNA-guided RNA polymerase promoter contained in the arm region of the second probe, preferably one of the promoters is a T7 promoter and the other promoter is an SP6 promoter.

13. The method according to any one of claims 1 to 12, wherein: - the first probe comprises or consists of SEQ ID NO: 1 (E. coli 23S rRNA), the second probe comprises or consists of SEQ ID NO: 2 or 63 (E. coli 23S rRNA), the target sequence comprises or consists of SEQ ID NO: 38; or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 1, 2, 63 or 38, respectively, or - the first probe comprises or consists of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21 or 12, the second probe comprises or consists of SEQ ID NO: 8, 23, 24, 58, 64, 65, 66 or 73, the target sequence comprises or consists of SEQ ID NO: 9 or 13 (Escherichia coli 16S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21, 12, 8, 23, 24, 58, 64, 65, 66, 73, 9 or 13, respectively, or - the first probe comprises or consists of SEQ ID NO: 26, the second probe comprises or consists of SEQ ID NO: 27, 59, 68, 74, 78 or 79, and the target sequence comprises or consists of SEQ ID NO: 28 or 29 (SARS-CoV-2); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 26, 27, 59, 68, 74, 78, 79, 28 or 29, respectively, or - the first probe comprises or consists of SEQ ID NO: 35, the second probe comprises or consists of SEQ ID NO: 36, 69, 76, or 77, the target sequence comprises or consists of SEQ ID NO: 37 or 39 (Escherichia coli 23S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 35, 36, 69, 76, 77, 37 or 39, respectively, or - the first probe comprises or consists of SEQ ID NO: 83, the second probe comprises or consists of SEQ ID NO: 84 or 85, the target sequence comprises or consists of SEQ ID NO: 37 (Escherichia coli 23S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 83, 84, 85 or 37, respectively, or - the first probe comprises or consists of SEQ ID NO:40, the second probe comprises or consists of SEQ ID NO:41, 70, 81, or 82, the target sequence comprises or consists of SEQ ID NO:42 or 44 (Staphylococcus aureus mecA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO:40, 41, 70, 81, 82, 42, or 44, respectively, or - the first probe comprises or consists of SEQ ID NO: 45, the second probe comprises or consists of SEQ ID NO: 47 or 71, the target sequence comprises or consists of SEQ ID NO: 49 (influenza A); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 45, 47, 71 or 49, respectively, or -The first probe comprises or consists of SEQ ID NO: 46, the second probe comprises or consists of SEQ ID NO: 48 or 72, and the target sequence comprises or consists of SEQ ID NO: 50 (influenza B); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 46, 48, 72 or 50, respectively.

14. A computer-implemented method for designing at least one pair of probes suitable for implementing the method defined in any one of claims 1 to 13, the method comprising the steps of: i) reading the target nucleic acid, ii) obtaining or generating a sequence of at least one pair of probes, wherein each probe comprises a foot region and an arm region, wherein: The foot region of the first probe is located in the 5' region of the probe and is complementary to and hybridizes with the first portion of the target nucleic acid, and the arm region of the first probe is located in the 3' region of the probe and is not complementary to the target nucleic acid, wherein The foot region of the second probe is located in the 3' region of the probe and is complementary to and hybridizes with the second portion of the target nucleic acid, and the arm region of the second probe is located in the 5' region of the probe and comprises in the 5' to 3' direction: - at least one full-length reverse complementary sequence of a fluorescent aptamer, - a full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of the at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter, - a region of 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region of 5 to 9 nucleotides is fully or partially contained within the full-length reverse complement sequence of the DNA-guided RNA polymerase promoter, and wherein the first probe and the second probe are capable of forming a three-way junction structure by hybridizing with a target nucleic acid molecule, and iii) Optionally, providing as output the sequence obtained or generated in step ii).

15. The computer-implemented method of claim 14, wherein step ii) comprises the following steps: a) obtaining the foot region of the first probe by selecting a first part of nucleotides contained in the target nucleic acid and providing a complementary sequence thereof, b) obtaining the foot region of the second probe by selecting a second portion of nucleotides contained in the target nucleic acid and providing a complementary sequence thereof, wherein the first portion and the second portion are preferably separated by 0 to 6 nucleotides, c) obtaining the arm region of the second probe by selecting a nucleotide sequence comprising the full-length sequence of a DNA-guided RNA polymerase promoter and the full-length reverse complement sequence of at least one fluorescent aptamer, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the DNA-guided RNA polymerase promoter, d) obtaining the arm region of the first probe by selecting 5 to 9 nucleotides complementary to a region located at the 3' region of the arm region of the second probe obtained in step c), and e) Optionally, synthesizing the designed first probe and second probe.

16. A system for detecting the presence of a target nucleic acid in a sample, comprising a first probe and a second probe, wherein the first probe comprises a foot region located at the 5' region of the probe, the foot region being complementary to and hybridizing to a first portion of the target nucleic acid, and an arm region located at the 3' region of the probe; and wherein the second probe comprises: (1) a foot region located at the 3' region of the probe, the foot region being complementary to and hybridizing with the second portion of the target nucleic acid, and (2) an arm region, the arm region comprising in the 5' to 3' direction: i. the full-length reverse complementary sequence of at least one fluorescent aptamer, ii. the full-length reverse complement sequence of a DNA-guided RNA polymerase promoter, wherein the reverse complement sequence of at least one fluorescent aptamer is operably linked to the RNA polymerase promoter, iii. a region comprising 5 to 9 nucleotides that is complementary to and hybridizes with the arm region of the first probe, wherein the region comprising 5 to 9 nucleotides may be a region included in the full-length reverse complementary sequence of a DNA-guided RNA polymerase promoter.

17. The system of claim 16, wherein: - the first probe comprises or consists of SEQ ID NO: 1 (E. coli 23S rRNA), the second probe comprises or consists of SEQ ID NO: 2 or 63 (E. coli 23S rRNA), the target sequence comprises or consists of SEQ ID NO: 38; or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 1, 2, 63 or 38, respectively, or - the first probe comprises or consists of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21 or 12, the second probe comprises or consists of SEQ ID NO: 8, 23, 24, 58, 64, 65, 66 or 73, the target sequence comprises or consists of SEQ ID NO: 9 or 13 (Escherichia coli 16S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21, 12, 8, 23, 24, 58, 64, 65, 66, 73, 9 or 13, respectively, or - the first probe comprises or consists of SEQ ID NO: 26, the second probe comprises or consists of SEQ ID NO: 27, 59, 68, 74, 78 or 79, and the target sequence comprises or consists of SEQ ID NO: 28 or 29 (SARS-CoV-2); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 26, 27, 59, 68, 74, 78, 79, 28 or 29, respectively, or - the first probe comprises or consists of SEQ ID NO: 35, the second probe comprises or consists of SEQ ID NO: 36, 69, 76, or 77, the target sequence comprises or consists of SEQ ID NO: 37 or 39 (Escherichia coli 23S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 35, 36, 69, 76, 77, 37 or 39, respectively, or - the first probe comprises or consists of SEQ ID NO: 83, the second probe comprises or consists of SEQ ID NO: 84 or 85, the target sequence comprises or consists of SEQ ID NO: 37 (Escherichia coli 23S rRNA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 83, 84, 85 or 37, respectively, or - the first probe comprises or consists of SEQ ID NO:40, the second probe comprises or consists of SEQ ID NO:41, 70, 81, or 82, the target sequence comprises or consists of SEQ ID NO:42 or 44 (Staphylococcus aureus mecA); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO:40, 41, 70, 81, 82, 42, or 44, respectively, or - the first probe comprises or consists of SEQ ID NO: 45, the second probe comprises or consists of SEQ ID NO: 47 or 71, the target sequence comprises or consists of SEQ ID NO: 49 (influenza A); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 45, 47, 71 or 49, respectively, or -The first probe comprises or consists of SEQ ID NO: 46, the second probe comprises or consists of SEQ ID NO: 48 or 72, and the target sequence comprises or consists of SEQ ID NO: 50 (influenza B); or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical to the full length of SEQ ID NO: 46, 48, 72 or 50, respectively.

18. A kit for detecting the presence of a target nucleic acid in a sample, comprising a first probe and a second probe as defined in any one of claims 16 or 17, and further comprising the following elements: a) at least one DNA-guided DNA polymerase, preferably Bst polymerase, b) at least one DNA-guided RNA polymerase, preferably T7 RNA polymerase or SP6 RNA polymerase, c) at least one suitable fluorophore ligand of at least one fluorescent aptamer, d) spermidine, e) nucleoside triphosphates, including deoxynucleoside triphosphates and / or ribonucleoside triphosphates, f) a suitable buffer for carrying out the method according to any one of claims 1 to 12, g) Optionally, a reverse transcriptase, an RNAse, at least one exonuclease and a phosphatase, wherein elements a) to g) are contained in different containers or are grouped in one or more containers.

Images