Nucleic acid aptamer combined with Bst DNA polymerase and application thereof

Abstract

The invention relates to the technical field of biology, and discloses a nucleic acid aptamer combined with BstDNA polymerase and application of the nucleic acid aptamer. The nucleic acid aptamer provided by the invention has relatively high Bst enzyme affinity, can specifically recognize and bind to Bst enzyme, and can protect active sites of the Bst enzyme, so that the nucleic acid aptamer can be used as a hot start molecule of the Bst enzyme, the reaction activity of the Bst enzyme can be improved, and the preservation time of the Bst enzyme can be prolonged.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer combined with Bst DNA polymerase and an application thereof. Background Art

[0002] Bst DNA polymerase is a DNA polymerase derived from Bacillus stearothermophilus. It is widely used in isothermal amplification of DNA, such as loop-mediated isothermal amplification (LAMP), multiple displacement amplification (MDA) and whole genome amplification (WGA), due to its high thermal stability, strong strand displacement activity and strong dUTP tolerance. Moreover, Bst DNA polymerase has obvious advantages in polymerization speed, thermal stability, salt tolerance and dUTP tolerance in isothermal amplification, which makes it have broad application prospects.

[0003] However, in the actual isothermal amplification process, the purity of the amplified product will be reduced due to the occurrence of non-specific amplification. In addition, the high temperature activation of enzyme activity increases the time consumption of the reaction process and reduces the reaction efficiency. Summary of the invention

[0004] The purpose of the present invention is to overcome the above-mentioned problems existing in the prior art, and to provide a nucleic acid aptamer binding to Bst DNA polymerase and its application. The nucleic acid aptamer provided by the present invention has a high affinity for Bst DNA polymerase, can specifically recognize and bind to Bst DNA, and can be used as a hot start molecule and stabilizer for Bst DNA polymerase.

[0005] In order to achieve the above object, the present invention provides a nucleic acid aptamer that binds to Bst DNA polymerase, wherein the nucleotide sequence of the nucleic acid aptamer has at least 30% homology with the following sequence (1) and / or (2):

[0006] (1) the DNA sequence shown in SEQ ID NO: 1;

[0007] (2) The DNA sequence shown in SEQ ID NO:2.

[0008] The second aspect of the present invention provides an application of the nucleic acid aptamer described in the first aspect, wherein the application comprises at least one of the following:

[0009] (a) Application in detecting Bst DNA polymerase;

[0010] (b) Application in purification of Bst DNA polymerase;

[0011] (c) Application in prolonging the storage time of Bst DNA polymerase;

[0012] (d) Application as a hot start molecule for Bst DNA polymerase;

[0013] (e) Application in the preparation of drugs targeting Bst DNA polymerase.

[0014] The third aspect of the present invention provides a Bst DNA polymerase preparation, which comprises a nucleic acid aptamer and Bst DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer described in the first aspect.

[0015] The fourth aspect of the present invention provides the use of the nucleic acid aptamer described in the first aspect, or the preparation described in the third aspect in nucleic acid isothermal amplification and related reactions.

[0016] The fifth aspect of the present invention provides a method for in vitro isothermal nucleic acid amplification, which comprises using the preparation described in the third aspect as a nucleic acid amplification enzyme to perform in vitro isothermal nucleic acid amplification.

[0017] Through the above technical solution, the present invention can at least achieve the following beneficial effects:

[0018] (1) The nucleic acid aptamer provided by the present invention can recognize and bind to the Bst enzyme with high specificity and has a high affinity for the Bst enzyme.

[0019] (2) The nucleic acid aptamer provided by the present invention has a small molecular weight, stable chemical properties, and is easy to store and label. It can be used for the detection, purification, imaging, etc. of Bst enzymes, and can also be used to prepare drugs or reagents targeting Bst enzymes, and has good and broad application prospects.

[0020] (3) After the nucleic acid aptamer provided by the present invention specifically binds to the Bst enzyme, it can improve the stability of the Bst enzyme and prolong its storage time, especially the storage time at room temperature and non-frozen low temperature.

[0021] (4) The nucleic acid aptamer provided by the present invention can reversibly bind to the Bst enzyme. At room temperature, the two combine, so that the Bst enzyme loses its activity. At high temperature (i.e., reaching the melting temperature of the nucleic acid aptamer), the secondary structure of the nucleic acid aptamer opens and the enzyme activity is restored. Thus, the nucleic acid aptamer provided by the present invention can control the release of the activity of the Bst enzyme by temperature, avoiding the occurrence of non-specific amplification in in vitro isothermal nucleic acid amplification processes such as LAMP.

[0022] (5) The nucleic acid aptamers provided by the present invention can be mass-produced in a short period of time through artificial synthesis, and have a single component, and the quality inspection and use costs are low. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the detection results of the recognition and binding ability of each round of screening products with the Bst enzyme by SPR during the aptamer screening process in Example 1.

[0024] Figure 2 This is a graph showing the affinity test results between aptamer XY01 and Bst enzyme in Example 2.

[0025] Figure 3 This is a graph showing the affinity test results between aptamer XY02 and Bst enzyme in Example 2.

[0026] Figure 4 This is a comparison chart of the detection results of loop-mediated isothermal amplification performed by the conjugate of aptamer XY01 and Bst enzyme and Bst enzyme as a DNA amplification enzyme in Example 3.

[0027] Figure 5 This is a comparison chart of the detection results of loop-mediated isothermal amplification in Example 4 using the Bst enzyme and the conjugate of the aptamer XY01 and the Bst enzyme placed at 4° C. for 3 days as a DNA amplification enzyme. DETAILED DESCRIPTION

[0028] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0029] In the present invention, unless otherwise specified, "Bst DNA polymerase", "Bst polymerase" and "Bst enzyme" have the same meaning and can be used interchangeably.

[0030] In the present invention, "KD value" is a characterization parameter used to describe the affinity between the nucleic acid aptamer and the Bst enzyme. The smaller the value, the higher the affinity between the nucleic acid aptamer and the Bst enzyme. The calculation formula of the KD value is as follows:

[0031] KD = Kd / Ka; Kd is the dissociation constant; Ka is the binding constant.

[0032] Usually, the KD value can be detected by methods such as surface plasmon resonance (usually the KD value test result can be directly read through the supporting software of the detection instrument).

[0033] In the present invention, unless otherwise specified, "non-freezing low temperature" refers to a temperature that does not reach the freezing condition but is lower than the normal room temperature, for example, it can be a conventional refrigeration temperature (for example, 1-10°C); "normal temperature" refers to a temperature lower than the melting temperature of the nucleic acid aptamer, usually room temperature, i.e., below 30°C (for example, 20-30°C); "high temperature" refers to a temperature that reaches or exceeds the temperature at which the secondary structure of the nucleic acid aptamer is opened so that the activity of the Bst enzyme bound thereto is restored (this process can also be called the "melting" of the nucleic acid aptamer), usually above 55°C, preferably 55-60°C.

[0034] The inventors of the present invention screened and obtained nucleic acid aptamers that can bind to the Bst enzyme and have high affinity during the research process. After further research, the inventors also found that the nucleic acid aptamer can bind to the active site of the Bst enzyme, so that when the two are combined, the Bst enzyme activity is lost; when the temperature rises to above the melting temperature of the nucleic acid aptamer, the aptamer melts and the Bst enzyme activity is restored. Therefore, when the nucleic acid aptamer is combined with the Bst enzyme for in vitro nucleic acid isothermal amplification methods such as LAMP, WGA, and MDA, the occurrence of non-specific amplification can be effectively avoided and the purity of the reaction product can be improved. Usually, enzymes and enzyme preparations need to be stored under freezing (such as -20°C) or ultra-low temperature freezing (such as -80°C) conditions to extend the storage time, but this makes it often that the enzyme solution will cause unstable activity or even loss of activity due to repeated freezing and thawing during use. Although the enzyme solution is stored at a refrigerated temperature to avoid the effect of repeated freezing and thawing on the enzyme activity, the enzyme activity decreases rapidly due to the relatively high storage temperature, so conventional enzyme solutions or enzyme preparations cannot be stored for a long time at non-frozen low temperatures (such as refrigerated temperatures). When the nucleic acid aptamer of the present invention is combined with the Bst enzyme, it can better protect the enzyme active site, so that it can be stored for a long time at room temperature or non-freezing low temperature.

[0035] Based on this, the first aspect of the present invention provides a nucleic acid aptamer that binds to Bst DNA polymerase, wherein the nucleotide sequence of the nucleic acid aptamer has at least 30% homology with the following sequence (1) and / or (2):

[0036] (1) the DNA sequence shown in SEQ ID NO: 1;

[0037] (2) The DNA sequence shown in SEQ ID NO:2.

[0038] GCACGGACACAAGAACAAAGAGCGGTCAAGGGAATGTTGGCCGT AATCAAACCGTGCTTGTGCTGCCTTTGTTCTG (SEQ ID NO: 1)

[0039] GCACGGACACAAGAACAAAGCAGGTGCCGTGTCCGCCGTACCAG CCGGTCTGTAACCTTGTGCTGCCTTTGTTCTG (SEQ ID NO: 2)

[0040] In the present invention, "having at least x% homology" means that the nucleotide sequence of the nucleic acid aptamer is identical to the specified sequence, i.e., at least x% of the above sequence (1) and / or (2). For example, the nucleotide sequence of the nucleic acid aptamer may contain additional nucleotides at the 3' end and / or the 5' end on the basis of the specified sequence, or the nucleotide sequence of the nucleic acid aptamer may be a nucleotide sequence lacking some nucleotides at one or some sites on the basis of the specified sequence (for example, in some cases, it may be a partial continuous sequence intercepted on the basis of the specified sequence, preferably, the partial continuous sequence intercepted on the basis of the specified sequence includes at least 15 continuous nucleotides in the specified sequence, for example, it may be 15-20 continuous nucleotides), or the nucleotide sequence of the nucleic acid aptamer may be a nucleotide sequence substitution at one or some sites on the basis of the specified sequence, or the nucleotide sequence of the nucleic acid aptamer may also have a combination of the above-mentioned situations.

[0041] The nucleotide sequence of the nucleic acid aptamer provided by the present invention can be a sequence having at least 30% homology with any one of the sequences in (1) and (2), or a combination of sequences having at least 30% homology with both sequences in (1) and (2).

[0042] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer has at least 50% homology with the sequence of (1) and / or (2), preferably at least 80% homology.

[0043] For example, there can be 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 100% homology.

[0044] Preferably, the nucleotide sequence of the nucleic acid aptamer includes the sequence of (1) and / or (2). That is, the nucleotide sequence of the nucleic acid aptamer may be a sequence that contains several nucleotides additionally on the basis of the sequence of (1) and / or (2), and has the homology therewith as described above.

[0045] Preferably, the KD value between the nucleic acid aptamer and Bst DNA polymerase is no more than 10 nM, preferably 0.5 nM-7 nM.

[0046] For example, the KD value of the nucleic acid aptamer and Bst DNA polymerase can be 0.5nM, 1nM, 1.5nM, 2nM, 2.5nM, 3nM, 3.5nM, 4nM, 4.5nM, 5nM, 5.5nM, 6nM, 6.5nM, 7nM, or a range consisting of any two of the above values, or any intermediate value in the range.

[0047] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:1.

[0048] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:2.

[0049] According to a preferred embodiment of the present invention, the nucleic acid aptamer may be modified or remodeled. In the present invention, the modification or remodeling may be conventional modification or remodeling of nucleic acid sequences, especially nucleic acid aptamers, in the art.

[0050] Preferably, the modification or transformation includes: chemical modification or skeleton transformation based on the nucleic acid aptamer.

[0051] For example, the backbone modification may include modifying the backbone of the nucleic acid aptamer by at least one of phosphorylation, methylation, amination, sulfhydrylation, replacing oxygen with sulfur, replacing oxygen with selenium, and isotopes.

[0052] For another example, the backbone modification may be to modify the nucleotide sequence backbone of the nucleic acid aptamer into a phosphorothioate backbone or a peptide nucleic acid.

[0053] Preferably, the modification or transformation includes: connecting a chemical modification group on the basis of the nucleic acid aptamer. Any chemical group commonly used for nucleic acid modification in the art can be used to modify the nucleic acid aptamer of the present invention.

[0054] It should be understood that in the aptamers provided by the present invention, the above-mentioned modification or transformation methods may exist in only one manner or in multiple manners. For example, in the aptamer, only a chemical modification group may be connected, or only a skeleton modification may be performed; for another example, in the aptamer, a skeleton modification and a modification group may be simultaneously performed.

[0055] The term "phosphorothioate backbone" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA nucleic acid aptamers can be replaced by one or two sulfur atoms to produce a phosphorothioate backbone with phosphorothioate or phosphorodithioate bonds, respectively.

[0056] The term "peptide nucleic acid" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to an artificially synthesized DNA molecule analog, first reported by Nielsen et al. in 1991. As shown in the following formula (I) and formula (II), N-2-(aminoethyl)-glycine units are used to replace the sugar-phosphate backbone as a repeating structural unit, and oligonucleotide mimics connected by peptide bonds are synthesized, which are called peptide nucleic acids.

[0057]

[0058] Preferably, after modification and / or transformation, the nucleic acid aptamer is still able to bind to the Bst enzyme, and its affinity is not less than 85% of the affinity of the nucleic acid aptamer to the Bst enzyme before modification and / or transformation.

[0059] Preferably, after modification and / or transformation, the stability of the nucleic acid aptamer is not less than 90% of the stability of the nucleic acid aptamer before modification and / or transformation.

[0060] Preferably, after modification and / or transformation, the resistance of the nucleic acid aptamer to nuclease degradation is not less than 90% of the resistance of the nucleic acid aptamer before modification and / or transformation.

[0061] According to a preferred embodiment of the present invention, the nucleic acid aptamer is further connected to a marker. In the present invention, the "marker" can be a substance commonly used in the art to label nucleic acids for the purpose of treatment, detection, research, etc.

[0062] Preferably, the marker comprises at least one of a fluorescent marker, a radioactive marker, siRNA, a nanoluminescent marker, a chemiluminescent marker, an enzyme marker and a drug.

[0063] For example, the marker can be a fluorescent group (such as FAM, ROX, VIC, etc.), a radioactive isotope, a drug (such as biotin, digoxin), a nanomaterial (such as upconversion particles, MOF, nanogold, etc.), a small peptide (such as His-tag, etc.), siRNA or an enzyme marker, etc.

[0064] Preferably, after connecting the marker, the nucleic acid aptamer is still able to bind to the Bst enzyme, and its affinity is not less than 85% of the affinity of the nucleic acid aptamer and the Bst enzyme before connecting the marker, preferably not less than 90%.

[0065] Preferably, after the label is linked, the stability of the nucleic acid aptamer is not less than 90% of the stability of the nucleic acid aptamer before the label is linked.

[0066] Preferably, after the label is attached, the resistance of the nucleic acid aptamer to nuclease degradation is not less than 90% of the resistance of the nucleic acid aptamer before the label is attached.

[0067] The second aspect of the present invention provides an application of the nucleic acid aptamer described in the first aspect, wherein the application comprises at least one of the following:

[0068] (a) Application in detecting Bst DNA polymerase;

[0069] (b) Application in purification of Bst DNA polymerase;

[0070] (c) Application in prolonging the storage time of Bst DNA polymerase (especially application in prolonging the storage time of Bst DNA polymerase at room temperature or non-refrigerated low temperature);

[0071] (d) Application as a hot start molecule for Bst DNA polymerase;

[0072] (e) Application in the preparation of drugs targeting Bst DNA polymerase;

[0073] According to a preferred embodiment of the present invention, application (a) can be to use the nucleic acid aptamer provided by the present invention to detect the sample to be tested, and to perform quantitative or qualitative detection of the Bst enzyme in the sample.

[0074] According to a preferred embodiment of the present invention, application (b) can be to mix the nucleic acid aptamer provided by the present invention with a sample containing the Bst enzyme, and purify the Bst enzyme by utilizing the property that the nucleic acid aptamer can specifically bind to the Bst enzyme.

[0075] According to a preferred embodiment of the present invention, application (c) may include adding the nucleic acid aptamer provided by the present invention to a solution sample containing the Bst enzyme. Through the specific binding of the nucleic acid aptamer to the active site of the Bst enzyme and the protective effect on the active site of the enzyme, the Bst enzyme after adding the nucleic acid aptamer can be stored for a long time at room temperature or at a non-frozen low temperature. For example, after adding the nucleic acid aptamer of the present invention, the storage time of the Bst enzyme (solution) at 25°C or 4°C can reach more than twice the storage time before addition, preferably 3-5 times. The storage time refers to the time taken for the enzyme activity of the solution sample containing the Bst enzyme to decrease to 90% of the enzyme activity when freshly prepared.

[0076] According to a preferred embodiment of the present invention, application (c) may also include mixing the nucleic acid aptamer provided by the present invention with the Bst enzyme in a solution and drying (e.g., freeze drying) after specifically binding to the mixture. The Bst enzyme in the obtained freeze-dried preparation is similar to the solution sample and can also be stored for a long time at room temperature or non-frozen low temperature. For example, after binding with the nucleic acid aptamer of the present invention, the storage time of the Bst enzyme (lyophilized agent) at 25°C or 4°C can reach more than twice the storage time of the Bst enzyme not bound to the nucleic acid aptamer, preferably 3-5 times. The storage time refers to the time taken for the enzyme activity in the solution obtained when the Bst enzyme lyophilized agent or the lyophilized agent of the combination of the Bst enzyme and the nucleic acid aptamer is re-dissolved in the same amount to be reduced to 90% of the enzyme activity of the freshly prepared lyophilized agent when it is re-dissolved in the same amount.

[0077] According to a preferred embodiment of the present invention, application (d) may include combining the nucleic acid aptamer provided by the present invention with the Bst enzyme, controlling the structural change of the nucleic acid aptamer by temperature, and thereby controlling the release and shutdown of the Bst enzyme activity.

[0078] Preferably, application (d) may include using the aptamer-Bst enzyme conjugate as a nucleic acid amplification enzyme in a nucleic acid isothermal amplification reaction to perform nucleic acid amplification.

[0079] Preferably, application (d) may also include using the aptamer of the present invention (at room temperature) to inhibit the activity of the Bst enzyme (ie, using the aptamer of the present invention as a Bst enzyme inhibitor).

[0080] According to a preferred embodiment of the present invention, application (e) may include connecting the nucleic acid aptamer provided by the present invention to a drug molecule, and using the nucleic acid aptamer's ability to specifically recognize and bind to the Bst enzyme to target the drug molecule to the Bst enzyme. For example, it can be used in research work to explore the effects of certain drug molecules on the Bst enzyme, or drugs known to have specific transformation or modification functions for the Bst enzyme can be targeted to the Bst enzyme.

[0081] The third aspect of the present invention provides a Bst DNA polymerase preparation, which comprises a nucleic acid aptamer and Bst DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer described in the first aspect.

[0082] According to a preferred embodiment of the present invention, in the preparation, the content of nucleic acid aptamer relative to 1U of Bst DNA polymerase is 1-20nM. For example, relative to 1U of Bst DNA polymerase, the content of nucleic acid aptamer can be 1nM, 2nM, 3nM, 4nM, 5nM, 6nM, 7nM, 8nM, 9nM, 10nM, 11nM, 12nM, 13nM, 14nM, 15nM, 16nM, 17nM, 18nM, 19nM, 20nM, or a range consisting of any two of the above values, or any intermediate value in the range, preferably 5-15nM.

[0083] According to a preferred embodiment of the present invention, the preparation may be a liquid preparation or a solid preparation.

[0084] Preferably, the liquid preparation comprises water and / or TE buffer. That is, the liquid preparation is prepared with water or TE buffer. The water used to prepare the liquid preparation in the present invention can be any water commonly used in the preparation of nucleic acid liquid preparations in the art, for example, ultrapure water, deionized water, sterile water, etc. In order to avoid degradation of nucleic acid aptamers in the liquid preparation, it is preferred that the water and TE buffer used to prepare the liquid preparation do not contain nuclease. TE buffer is a buffer solution prepared with Tris and EDTA, which can be used to stably store nucleic acids. The present invention has no particular restrictions on the specific source of the TE buffer used in the liquid preparation, which can be a commercial product directly purchased through commercial channels, or it can be prepared by itself according to the prior art.

[0085] According to a preferred embodiment of the present invention, the Bst enzyme and the nucleic acid aptamer in the preparation can be packaged after mixing, or can be packaged separately.

[0086] For example, the preparation can be a liquid preparation in which a conjugate of Bst enzyme and nucleic acid aptamer is dissolved in water / buffer; it can be a buffer solution kit in which Bst enzyme and nucleic acid aptamer are dissolved in water / buffer respectively and stored separately; it can also be a reagent kit in which powdered Bst enzyme and water / buffer solution containing nucleic acid aptamer are stored separately; it can also be a solid preparation (lyophilized powder) obtained by freeze-drying a liquid preparation in which a conjugate of Bst enzyme and nucleic acid aptamer is dissolved in water / buffer; it can also be a solid reagent kit in which powdered Bst enzyme and nucleic acid aptamer are separately stored after freeze-drying; it can also be a mixed solid (powder) reagent in which powdered Bst enzyme and nucleic acid aptamer are mixed and packaged after freeze-drying.

[0087] In order to simplify the operation during use and reduce the packaging cost, according to some preferred embodiments of the present invention, the nucleic acid aptamer and the Bst DNA polymerase in the preparation are mixed and packaged, and the nucleic acid aptamer and the Bst DNA polymerase are combined in the preparation.

[0088] The above-mentioned preparation provided by the present invention can replace Bst enzyme as an amplification enzyme in in vitro nucleic acid isothermal amplification reactions such as loop-mediated isothermal amplification (LAMP), whole genome amplification (WGA), and multiple strand displacement amplification (MDA). When the preparation is used, since the nucleic acid aptamer in the preparation is combined with the Bst enzyme, and the Bst enzyme activity can be closed and released under the influence of temperature, non-specific amplification in the reaction process can be effectively avoided compared with the use of Bst enzyme alone, and the purity of the reaction product can be improved.

[0089] The fourth aspect of the present invention provides the use of the nucleic acid aptamer described in the first aspect, or the preparation described in the third aspect in nucleic acid isothermal amplification reaction and related reactions.

[0090] According to a preferred embodiment of the present invention, the related reactions include at least one of whole genome amplification (WGA), multiple strand displacement amplification (MDA), helicase-dependent amplification (HDA), rolling circle amplification (RCA) and loop-mediated isothermal amplification (LAMP).

[0091] The present invention further provides the nucleic acid aptamer described in the first aspect, or the use of the preparation described in the third aspect in improving the purity of the reaction products of nucleic acid isothermal amplification and related reactions (such as WGA, MDA, HAD, RCA, LAMP, etc.). After the nucleic acid aptamer provided by the present invention is combined with the Bst enzyme, when the temperature reaches the melting temperature of the aptamer, the Bst enzyme can exert its activity as an isothermal amplification enzyme without the need for enzyme activation, thereby shortening the overall reaction time.

[0092] The present invention further provides the use of the nucleic acid aptamer described in the first aspect, or the preparation described in the third aspect, in shortening the reaction time of nucleic acid isothermal amplification reaction and related reactions (or improving the reaction efficiency of nucleic acid isothermal reaction and related reactions).

[0093] The fifth aspect of the present invention provides a method for in vitro isothermal nucleic acid amplification, which comprises using the preparation described in the third aspect as a nucleic acid amplification enzyme to perform in vitro isothermal nucleic acid amplification.

[0094] According to a preferred embodiment of the present invention, the in vitro nucleic acid isothermal amplification includes at least one of LAMP, WGA, MDA, RCA, and HDA.

[0095] According to a preferred embodiment of the present invention, the starting temperature of the in vitro nucleic acid amplification is above 50° C., preferably 50-55° C. When the extension is performed at this temperature, the nucleic acid aptamer in the preparation is unzipped, and the Bst enzyme activity is released, thereby achieving amplification of the target nucleic acid.

[0096] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0097] In the following examples, unless otherwise specified, the reagents and materials used were all commercial products purchased from regular chemical or biological reagent / material suppliers, and the purity of the reagents was analytical grade.

[0098] Example 1

[0099] This example is used to illustrate the screening of nucleic acid aptamers provided by the present invention.

[0100] The method for screening a ssDNA nucleic acid aptamer that binds to Bst DNA polymerase in this embodiment comprises the following steps:

[0101] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequence:

[0102] The DNA library was synthesized by Shanghai Sangon Biotechnology Co., Ltd., and the primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0103] Random single-stranded DNA library: composed of the nucleotide sequence shown in SEQ ID NO: 3, the 36N sequence and the nucleotide sequence shown in SEQ ID NO: 4 connected in sequence from the 5' end to the 3' end, wherein the 36N sequence refers to a sequence formed by connecting 36 arbitrary nucleotide bases.

[0104] GCACGGACACAAGAAAAAG(SEQ ID NO:3)

[0105] CTTGTGCTGCCTTTGTTCTG(SEQ ID NO:4)

[0106] The primer sequences are specifically shown in Table 1. Among them, S in the primer name represents the forward primer, and A in the primer name represents the reverse primer.

[0107] Table 1 Primers and their sequences

[0108] Primer name Sequence (5'-3') SEQ ID NO LibS1 GCACGGACACAAGAACAAAG 5 Lib-FAM-S1 FAM-GCACGGACACAAGAACAAAG 6 Lib-Biotin-A2 Biotin - CAGAACAAAGGCAGCACAAG 7 LibA2 CAGAACAAAGGCAGCACAAG 8

[0109] The primers were prepared into 100 μM stock solutions with DPBS buffer and stored at -20°C for future use.

[0110] 2. Magnetic bead screening

[0111] The magnetic bead method was used to screen the aptamers in the above library for a total of 9 rounds.

[0112] Each round of screening process includes reverse screening and positive screening. The reverse screening uses carboxyl magnetic beads (MB-His) coupled with His small peptide (a small peptide with 6 His in series, commissioned by Nanjing GenScript Biotechnology Co., Ltd. for chemical synthesis) for screening; the positive screening uses carboxyl magnetic beads (MB-Bst) coupled with Bst enzyme for screening. The specific screening process is as follows:

[0113] First round of screening: Take 1OD from the synthesized DNA library, centrifuge at 14000rpm for 5 minutes, remove the supernatant, add DPBS buffer to prepare a 10μM library solution. The library solution is dispensed into PCR tubes, placed in a PCR instrument, and maintained at 95℃ for 10min to open the secondary structure of the aptamer (i.e., the aptamer melts), then maintained at 4℃ for 5min and equilibrated to room temperature.

[0114] Add the treated library solution to 50 μL of MB-His magnetic beads, mix well and incubate at room temperature on a vertical mixer. After incubation, place on a magnetic stand and collect the supernatant. Then mix the collected supernatant with 50 μL of MB-Bst and incubate at room temperature (25°C) on a vertical mixer. After incubation, place on a magnetic stand, remove the supernatant, wash the magnetic beads 4 times with 200 μL DPBS buffer, and make a suspension with 200 μL DPBS buffer after washing. Boil in water for 10 minutes, and the obtained supernatant is named elution-Bst.

[0115] The nucleic acid molecules in elution-Bst were used as templates and amplified by ordinary PCR. The method is as follows: all template elution-Bst was added to 2 ml PCR mix (purchased from Baorui Bio, 2X STR Premix (079201)) and mixed evenly, the template and PCR mix mixture was divided into 100 μL / tube and added to the PCR tube, placed in the PCR instrument and amplified according to the following conditions: 95°C pre-denaturation for 2 minutes, 95°C denaturation for 60 seconds, 60°C annealing for 60 seconds, 72°C extension for 60 seconds, a total of 25 cycles, and stored at 4°C.

[0116] The amplified product was purified using commercially available Tiandirenhe SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening.

[0117] The 2nd to 9th rounds of screening: The operation is the same as the 1st round of screening, except that each round uses the secondary library obtained from the previous round of screening as the starting screening library.

[0118] During the screening process, surface plasmon resonance (SPR) was used to detect the changes in the recognition ability of the DNA single-stranded library for Bst DNA polymerase. When the recognition ability of the DNA single-stranded library for Bst DNA polymerase met the requirements, that is, the binding ability of the screened DNA single-stranded library to the target protein gradually increased ( Figure 1 ),from Figure 1 As can be seen from the figure, as the screening proceeds, the retention rate increases significantly from the fourth round and reaches a peak in the eighth round, indicating that the binding affinity between the aptamer and the target is significantly improved with the increase in the number of screening rounds. The obtained library is analyzed by high-throughput sequencing to meet the sequencing requirements.

[0119] 3. Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, two aptamer sequences with the strongest affinity were finally selected and named XY01 and XY02, respectively. Their nucleotide sequences are shown in Table 2 below.

[0120] Table 2 Screened aptamers

[0121]

[0122] Example 2

[0123] This example is used to illustrate the affinity of the Bst enzyme of the nucleic acid aptamer provided by the present invention.

[0124] Suzhou Genewise Biotechnology Co., Ltd. was commissioned to synthesize nucleic acid aptamers with sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and they were diluted with DPBS buffer to 12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM and 400 nM respectively for use.

[0125] 1. Bst DNA polymerase was coupled to the second channel on the surface of a CM5 chip (purchased from Beijing Bio-Technology Co., Ltd.) as follows: first, the chip was cleaned with 50 mM NaOH, 20 μL was injected, and the flow rate was 10 μL / min. Then, equal volumes of EDCC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) were mixed and 50 μL was injected to activate the chip at a flow rate of 5 μl / min. Bst DNA polymerase was diluted with 10 mM NaAc solution at pH = 4 to a final concentration of 50 μg / mL and then injected. The injection volume was 50 μL, the flow rate was 5 μL / min, and the Bst polymerase coupling amount was 3500 RU. After the injection was completed, ethanolamine was injected to seal the chip at a flow rate of 10 μL / min and 100 μL was injected. Among them, RU is the response value (response), which is the unit of resonance angle in SPR, 1RU = 10 -4According to measurement experience, the resonance angle increases by 1000RU, which is about 1ng / mm 2 of proteins attached to the surface.

[0126] Channel 1 and channel 2 were treated in the same way, except that the Bst enzyme was replaced with 3500 RUBSA as the control channel.

[0127] 2. Detection: Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K) to set the detection parameters. The diluted two aptamer samples flow through channels 1 and 2 in turn. The program for each aptamer is as follows: injection 30 μL / min, time 2 minutes, dissociation 30 μL / min, time 2 minutes, regeneration 1M NaCl 30 μL / min, time 30 seconds, and the two diluted nucleic acid aptamers are injected in turn.

[0128] The affinity test data of nucleic acid aptamers and Bst DNA polymerase are shown in Figure 2-3 , Figure 2 This is the affinity test diagram of aptamer XY01 and Bst DNA polymerase; Figure 3 The affinity test diagram of aptamer XY02 and Bst DNA polymerase is shown in Table 3. The KD value test results are read by the instrument software. The smaller the KD value, the greater the affinity. The specific results are shown in Table 3. It can be seen that the KD values ​​of these two nucleic acid aptamers are small, reaching the nM level, indicating that the corresponding nucleic acid aptamers have strong binding ability with the target protein Bst polymerase.

[0129] Table 3 Affinity of nucleic acid aptamers and Bst polymerase

[0130] Aptamer sequence Affinity for Bst DNA polymerase KD (nM) XY01 (SEQ ID NO: 1) 1.65 XY02 (SEQ ID NO: 2) 1.45

[0131] Example 3

[0132] This example is used to illustrate the stability of the nucleic acid aptamer provided by the present invention and its effect of extending the storage time of the Bst enzyme.

[0133] 1. Stability of aptamers

[0134] A 10x primer mix for loop-mediated isothermal amplification (LAMP) was prepared according to the sequences shown in Table 4.

[0135] The genomic cDNA of the 2019n CoV virus (GenBank ID: NC_045512.2) was used as a template and the primer mixture in Table 4 was used for loop-mediated isothermal amplification (LAMP) reaction.

[0136] Table 4 10x Primer Mix Configuration

[0137]

[0138]

[0139] The isothermal amplification reaction system was prepared as shown in Table 5, with the balance being an RNaes-free aqueous solution, and using the WarmStart TM The reaction was carried out using LAMP2×MasterMix (DNA & RNA).

[0140] Table 5 Isothermal amplification reaction system (25 μL)

[0141] Reagents Dosage / μL 10x Isothermal Amplification Buffer 2.5 <![CDATA[MgSO4(100mM)]]> 1 dNTPs(10mM) 3.5 SYTO-9 1 10x Primer Mix 3 Apt-Bst 2 template 3

[0142] The preparation method of Atp-Bst is as follows:

[0143] 1. Treatment of aptamers: Add 1.5 μL of 100 μM aptamers to 98.5 μL of binding solution, incubate at 95°C for 5 min, then quickly place in a -20°C refrigerator for 5 min to obtain a quenched aptamer solution. The binding solution is Tris-HCl buffer.

[0144] 2. Binding of aptamer and enzyme: Add 30 μL Bst original enzyme solution (5 U / μL, prepared with Tris-HCl buffer) directly to the above 100 μL quenched aptamer, mix well and place at 4°C for 20 min to obtain Atp-Bst solution (enzyme activity 5 U / μL).

[0145] Test results such as Figure 4 As shown in the figure, it can be seen that when Atp-Bst is used for isothermal amplification, its activity as a DNA amplification enzyme is significantly higher than that of using Bst enzyme alone.

[0146] The same method was used to detect the conjugate of aptamer XY02 and Bst enzyme, and similar results were obtained.

[0147] 2. Effect of nucleic acid aptamers on the storage time of Bst enzyme

[0148] The genomic RNA of the 2019n CoV virus (GenBank ID: NC_045512.2) was amplified using the conjugate of aptamer XY01 and Bst enzyme (Atp-Bst) and Bst enzyme respectively according to the method of Example 3. The difference is that the Atp-Bst and Bst enzymes used in this example were placed at 4°C for 3 days before use. Figure 5The isothermal amplification curves and dissolution curves using Atp-Bst and Bst as amplification enzymes are shown. It can be seen from the figure that after storage at 4°C for 3 days, the dissolution curve using Atp-Bst showed a single peak, indicating that there were no non-specific products, while a miscellaneous peak appeared when using Bst enzyme, and the amplification product peak was significantly reduced, indicating that non-specific amplification occurred.

[0149] The same method was used to perform isothermal amplification using a conjugate of aptamer XY02 and Bst enzyme placed at 4°C for 3 days as an amplification enzyme, and similar results were obtained.

[0150] It can be seen that compared with the simple Bst enzyme, the aptamer provided by the present invention and the Bst enzyme have better stability, which also shows that the combination of the nucleic acid aptamer provided by the present invention promotes the long-term preservation of the Bst enzyme.

[0151] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A nucleic acid aptamer binding to Bst DNA polymerase, characterized in that: The nucleotide sequence of the nucleic acid aptamer has at least 30% homology with the following sequences (1) and / or (2): (1) the DNA sequence shown in SEQ ID NO: 1; (2) The DNA sequence shown in SEQ ID NO:

2.

2. The nucleic acid aptamer according to claim 1, wherein The nucleotide sequence of the nucleic acid aptamer has at least 50% homology with the sequence of (1) and / or (2), preferably at least 80% homology; Preferably, the nucleotide sequence of the nucleic acid aptamer includes the sequence of (1) and / or (2); Preferably, the KD value of the nucleic acid aptamer and Bst DNA polymerase is no more than 10nM, preferably 0.5nM-7nM; More preferably, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:1 or SEQ ID NO:

2.

3. The nucleic acid aptamer according to claim 1 or 2, wherein The nucleic acid aptamer is also modified or transformed; Preferably, the modification or transformation includes: backbone transformation based on the nucleic acid aptamer; Preferably, the modification or transformation comprises: connecting a chemical modification group to the nucleic acid aptamer; And / or, the nucleic acid aptamer is also connected to a marker; Preferably, the marker comprises at least one of a fluorescent marker, a radioactive marker, siRNA, a nanoluminescent marker, a chemiluminescent marker, an enzyme marker and a drug.

4. The use of the nucleic acid aptamer according to any one of claims 1 to 3, characterized in that: The application includes at least one of the following: (a) Application in detecting Bst DNA polymerase; (b) Application in purification of Bst DNA polymerase; (c) Application in prolonging the storage time of Bst DNA polymerase; (d) Application as a hot start molecule for Bst DNA polymerase; (e) Application in the preparation of drugs targeting Bst DNA polymerase.

5. A Bst DNA polymerase preparation, characterized in that The preparation comprises a nucleic acid aptamer and Bst DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer according to any one of claims 1 to 3.

6. The preparation according to claim 5, wherein In the preparation, the content of the nucleic acid aptamer is 1-20 nM relative to 1 U of Bst DNA polymerase; Preferably, the preparation is a liquid preparation, and preferably the liquid preparation comprises water and / or TE buffer; Preferably, the preparation is a solid preparation.

7. The preparation according to claim 5 or 6, wherein In the preparation, the nucleic acid aptamer and the Bst DNA polymerase are packaged independently, or the nucleic acid aptamer and the Bst DNA polymerase are packaged together; Preferably, the nucleic acid aptamer and the Bst DNA polymerase are mixed and packaged in the preparation, and the nucleic acid aptamer and the Bst DNA polymerase are combined in the preparation.

8. Use of the nucleic acid aptamer according to any one of claims 1 to 3, or the preparation according to any one of claims 5 to 7 in nucleic acid isothermal amplification reaction and related reactions thereof, preferably wherein the related reactions include at least one of whole genome amplification, multiple strand displacement amplification, helicase-dependent amplification, rolling circle amplification and loop-mediated isothermal amplification.

9. A method for isothermal in vitro nucleic acid amplification, characterized in that: The method comprises using the preparation described in any one of claims 5 to 7 as a nucleic acid amplification enzyme to perform in vitro nucleic acid isothermal amplification.

10. The method according to claim 9, wherein: The starting temperature of the in vitro nucleic acid isothermal amplification is above 50°C, preferably 50-55°C.

Images