Application of a variable shear NAC transcription factor OsNTL5 in rice high environmental temperature response
By gene editing and overexpression of alternatively spliced NAC transcription factors OsNTL5, especially OsNTL5.1 and OsNTL5.2, the regulation of rice growth and development under high temperature was solved, the adaptability of rice to high environmental temperature was improved, and genetic resources and molecular mechanisms were provided.
Patent Information
- Application Number
- CN202411713008.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-27
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-11-27
AI Technical Summary
Existing technologies have failed to effectively explain how the proteasome regulates the high-temperature response and affects the growth and development of rice under high environmental temperatures, and lack genetic resources and molecular mechanisms for adapting to high temperatures.
High-temperature response in rice can be regulated by gene editing and overexpression of alternatively spliced NAC transcription factors OsNTL5, particularly OsNTL5.1 and OsNTL5.2. CRISPR/Cas9 technology can be used to insert/delete/replace OsNTL5 at specific locations, and gene editing or overexpression can be performed in the temperature-response defective mutant togr3.
It significantly restored the growth and development defects of rice under high temperature, improved the adaptability of rice to high environmental temperature, and provided genetic resources and research foundation for breeding high-temperature adapted varieties.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, and more specifically, to an alternatively spliced NAC transcription factor. OsNTL5 Application in the response of rice to high ambient temperature. Background Technology
[0002] The World Meteorological Organization's 2023 report, "The State of the Global Climate in 2022," indicated that due to record levels of greenhouse gases, the global average temperature in 2022 was approximately 1.15°C higher than pre-industrial levels. The accelerated pace of global warming, coupled with the fact that optimal temperatures for crop growth and development cannot be altered in the short term, poses a significant threat to food security. Studies show that, without considering fertilization, crop adaptability, and genetic improvement, a 1°C increase in the global average temperature is projected to reduce the yields of wheat, maize, rice, and soybeans by 6%, 3.2%, 7.4%, and 3.1%, respectively (Zhao et al., 2017). Therefore, researching plant perception and responses to high temperatures in the context of global warming is crucial.
[0003] Heat stress can lead to the rapid accumulation of large amounts of misfolded toxic proteins in cells. Removing these toxic proteins is more beneficial than restoring their activity (Zhang et al., 2019). The ubiquitin / 26S proteasome is an important protein degradation complex responsible for degrading ubiquitinated proteins (Xu and Xue, 2019). Researchers have cloned a heat-tolerant QTL in African rice. TT1 , TT1 Encoding the 26S proteasome α2 subunit, derived from a superior allele of African rice. OgTT1 It can effectively remove ubiquitination-mediated denatured proteins and maintain cellular protein homeostasis at high temperatures (Li et al., 2015). TOGR3 The β4 subunit of the rice 26S proteasome maintains carbon balance by enhancing carbon fixation and inhibiting carbon metabolism, thus promoting growth response to high ambient temperatures (Guo Feifei, 2020). However, how the proteasome regulates the high-temperature response remains unclear. Therefore, genetic screening of repressors of temperature-response-deficient proteasome mutants can help to better understand the molecular mechanisms by which they participate in the temperature response, thereby providing a theoretical basis and new genetic resources for breeding rice varieties adapted to high ambient temperatures. Summary of the Invention
[0004] The purpose of this invention is to provide a NAC transcription factor with alternative splicing. OsNTL5 Application in the response of rice to high ambient temperature.
[0005] To achieve the objectives of this invention, in a first aspect, this invention provides an alternatively spliced NAC transcription factor. OsNTL5Application in the response of rice to high ambient temperature.
[0006] In this invention, OsNTL5 The genomic DNA sequence is as follows:
[0007] i) The nucleotide sequence shown in SEQ ID NO:1;
[0008] ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:1 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function;
[0009] iii) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS, followed by washing the membrane with the same solution; or
[0010] iv) Nucleotide sequences that have more than 90% homology with the nucleotide sequences of i), ii) or iii) and express the same functional protein.
[0011] Furthermore, OsNTL5 Contains four alternative splicing transcripts OsNTL5.1 , OsNTL5.2 , OsNTL5.4 and OsNTL5.5 ;in, OsNTL5.1 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO:2, or a DNA sequence that has more than 90% homology with the DNA sequence shown in SEQ ID NO:2 and encodes a protein with the same function; OsNTL5.2 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO:3, or a DNA sequence that has more than 90% homology with the DNA sequence shown in SEQ ID NO:3 and encodes a protein with the same function; OsNTL5.4 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO:4, or a DNA sequence that has more than 90% homology with the DNA sequence shown in SEQ ID NO:4 and encodes a protein with the same function; OsNTL5.5 The nucleotide sequence is: the DNA sequence shown in SEQ ID NO:5, or a DNA sequence that has more than 90% homology with the DNA sequence shown in SEQ ID NO:5 and encodes a protein with the same function.
[0012] Furthermore, through the analysis of rice OsNTL5 The rice can be modified to lose its function, thereby improving its adaptability to high ambient temperatures.
[0013] Genome editing technologies, such as CRISPR, TALEN, and ZFN, can be used to edit genes. OsNTL5 To carry out the renovation.
[0014] Furthermore, by overexpressing in rice OsNTL5.1 and OsNTL5.2 This improves the rice's adaptability to high ambient temperatures.
[0015] Secondly, this invention provides a method for improving the adaptability of rice to high environmental temperatures, the method comprising: using genetic engineering techniques to weaken or knock out [certain substances] in rice. OsNTL5 .
[0016] Furthermore, with OsNTL5 To target the target, a CRISPR / Cas9-based sgRNA sequence was designed. A DNA fragment containing the sgRNA sequence was ligated into a vector carrying CRISPR / Cas9, and rice was transformed to obtain the desired result. OsNTL5 Genetically modified rice with loss of function.
[0017] Preferably, the nucleotide sequence of the sgRNA action site is 5'-GTACAGGTCCACCTCCGCGATGG-3' and 5'-GTACGGAGCTCCTTTTGTTGAGG-3'.
[0018] Furthermore, the transformation was carried out using Agrobacterium-mediated transformation.
[0019] For example, simultaneously linking expression cassettes containing the above two target sequences into pYLCRISPR / cas9 carrier ( pYLCRISPR / cas9 The vector (kindly provided by the laboratory of Liu Yaoguang, College of Agriculture, South China Agricultural University) was used to transform rice temperature-response defective mutants. togr3 It can be restored togr3 High-temperature response defects.
[0020] Thirdly, the present invention provides a method for improving the adaptability of rice to high environmental temperatures, the method comprising: using genetic engineering techniques to overexpress... OsNTL5.1 and OsNTL5.2 For example, in rice temperature-response defective mutants togr3 overexpression OsNTL5.1 and OsNTL5.2 It can be restored togr3 High-temperature response defects.
[0021] Furthermore, the overexpression method can be selected from the following 1) to 5), or any combination thereof:
[0022] 1) By importing a plasmid containing the gene;
[0023] 2) By increasing the copy number of the aforementioned genes on plant chromosomes;
[0024] 3) By altering the promoter sequences of the aforementioned genes on plant chromosomes;
[0025] 4) By operatively linking a strong promoter to the gene;
[0026] 5) By importing enhancers.
[0027] Fourthly, the present invention provides the application of transgenic rice obtained according to the method in plant breeding.
[0028] Furthermore, breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.
[0029] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:
[0030] This invention identifies for the first time a key factor regulating the growth and development of rice plants under high environmental temperatures, and discloses a method for controlling the alternative splicing of NAC transcription factors. OsNTL5 Gene editing and overexpression OsNTL5.1 and OsNTL5.2 Methods for cultivating rice varieties adapted to high environmental temperatures will provide genetic resources and a research foundation for cultivating superior rice varieties adapted to high environmental temperatures. Attached Figure Description
[0031] Figure 1 In a preferred embodiment of the present invention togrs1 Phenotypic identification. A, ZH11, grown in Hainan and Beijing. togr3 , togr3 togrs1 and togrs1 B and C, plant height (n≥16) and tiller number (n≥16) were statistically analyzed for each genotype of rice in A. D, ZH11 grown in Beijing, togr3 , togr3 togrs1 and togrs1 The panicle phenotypes, E and F, were analyzed for panicle elongation length (n=12) and flag leaf width (n=12) of each genotype in D. G, ZH11 planted in 25℃ / 20℃ and 35℃ / 30℃ incubators for 16 days, togr3 , togr3 togrs1 and togrs1H: The third leaf (25℃ / 20℃) and fourth leaf (25℃ / 20℃) of rice at three weeks of growth were observed under magnification. I: Seedling height was statistically analyzed for each genotype of rice in G (n=26). J: Leaf width was statistically analyzed for each genotype of rice in H (n=16). The scale bar for A, D, and H is 10cm, and the scale bar for G is 20cm. Values are expressed as mean ± standard deviation. One-way ANOVA was used for significance analysis, and Tukey-Test was used for multiple comparisons. Different letters indicate significant differences.
[0032] Figure 2 This is a preferred embodiment of the present invention for measuring the internode cell length of rice. A, Beijing grain-filling stage ZH11, togr3 , togr3 togrs1 and togrs1 Stalk, with red arrows indicating internode positions. B, Relative percentage of internode length for each genotype of rice in A (n≥11). C, Statistical analysis of internode length for each genotype of rice in A (n≥11). D, Resin section observation of the middle portion of the last internode in each genotype of rice in A. E, Statistical analysis of cell length for each genotype of rice in D (n=9). F, Statistical analysis of cell number for each genotype of rice in D (n=9). Scale bar: A = 10cm, D = 100µm. Data are expressed as mean ± standard deviation. Significance analysis was performed using one-way ANOVA, and multiple comparisons were performed using Tukey-Test. Different letters indicate significant differences.
[0033] Figure 3 In a preferred embodiment of the present invention TOGRS1 Map-based cloning. A, TOGRS1 Map-based cloning, using 68 exchanged monoplants and M1-M6 marker primers to... TOGRS1 The candidate gene is located at the end of the long arm of chromosome 8. B, according to RGAP annotation, candidate gene... OsNTL5 It contains 5 transcripts. The white boxes represent non-coding regions, the gray boxes represent exons, the horizontal lines represent introns, and the arrows indicate... togrs1 Mutations and premature termination sites. C, OsNTL5.1 protein structure diagram, orange box represents NAM domain, green box represents transmembrane domain. D, Speculated... togrs1 Protein sequence.
[0034] Figure 4 In a preferred embodiment of the present invention TOGRS1 candidate genes OsNTL5 Genetic verification. A, ZH11, togr3 , togr3 togrs1 , togrs1 And different genetically modified materials are grown in Beijing. togr3 osntl5g Indicates in togr3 Import in background osntl5Self-starter driver osntl5 Genome sequence, togr3 osntl5c Indicates in togr3 Import in background ACTIN Startup driver osntl5 CDS sequence togr3 osntl5cri Indicates in togr3 CRISPR editing was performed against the background. The scale bar is 10cm. B, Statistics on rice plant height for each genotype in A (n≥16). C, Statistics on tiller number for each genotype in A (n≥16). Values are expressed as mean ± standard deviation. Significance analysis was performed using one-way ANOVA, and multiple comparisons were performed using Tukey-Test. Different letters indicate significant differences.
[0035] Figure 5 In a preferred embodiment of the present invention OsNTL5 CRISPR CAS9 gene editing mutation types. OsNTL5.1 For reference, the red and blue arrows indicate the locations of the two target sites, the first and second exons, respectively, and the red box represents the PAM sequence. osntl5-cri-1 A 3bp deletion occurs between 160-162bp, and a 1bp deletion occurs at 550bp. osntl5-cri-2 A 1bp insertion occurs at 161bp, and a 343bp insertion occurs between 551-894bp.
[0036] Figure 6 RT-qPCR detection is a preferred embodiment of the present invention. OsNTL5 Expression of [a specific substance]. A, RT-qPCR detection. OsNTL5 Expression levels in different rice tissues, including leaves, leaf sheaths, nodes, internodes, roots, pre-flowering florets, post-flowering florets, and leaves and roots of 14-day-old rice seedlings grown in Beijing field at the flowering stage. B, ZH11 rice grown for 2 weeks in incubators at 25℃ / 20℃ and 35℃ / 30℃ was analyzed by RT-qPCR. togr3 , togr3 togrs1 and togrs1 Different transcripts of OsNTL5 were detected.
[0037] Figure 7 In a preferred embodiment of the present invention, yeast self-activation was used to verify that OsNTL5.1 has transcriptional activation activity.
[0038] Figure 8 In a preferred embodiment of the present invention, four variants of OsNTL5 are localized in tobacco subcellular structures, with mcherry-HDEL being a marker localized in the endoplasmic reticulum. Detailed Implementation
[0039] This invention provides an alternatively spliced NAC transcription factor OsNTL5 And its application in the response of rice to high ambient temperature.
[0040] The inventors' defective mutants in response to high ambient temperature togr3 Perform suppressor screening and name one of the suppressors as togrs1 ( togr3 suppressor 1 ), togr3 It exhibits similar behavior to the wild type at low ambient temperatures, but shows significant dwarfing at high ambient temperatures. togrs1 It can significantly inhibit togr3 The high-temperature dwarfing phenotype. TOGR3 Encoding the β4 subunit of the rice 26S proteasome, togrs1 yes togr3 The repressor indicates TOGRS1 It participates in the proteasome-mediated high-temperature response pathway.
[0041] This invention identifies [the virus] through map-based cloning and transgenic experiments. TOGRS1 Encoding NAC transcription factor OsNTL5 Its gene number is Os08g0562200 (RAP number) LOC_Os08g44820 (MSU number).
[0042] This invention provides OsNTL5 The genomic DNA sequence, including the upstream promoter and the downstream 3'UTR, is shown in SEQ ID NO:1.
[0043] This invention provides OsNTL5 The four alternatively spliced nucleotide sequences are named as follows: OsNTL5.1 , OsNTL5.2 , OsNTL5.4 , OsNTL5.5 The nucleotide sequences correspond to SEQ ID NO: 2, 3, 4, 5, respectively, or have more than 90% homology with SEQ ID NO: 2, 3, 4, 5 and encode proteins with the same transcription factor function.
[0044] This invention provides OsNTL5 The different splice variants encode the protein amino acid sequences, which are named as follows: OsNTL5.1 , OsNTL5.2 , OsNTL5.4 and OsNTL5.5The amino acid sequences correspond to SEQ ID NO: 6, 7, 8, 9, respectively, or are proteins derived from SEQ ID NO: 6-9 by substituting, deleting, or adding one or more amino acids to the amino acid sequences shown in SEQ ID NO: 6, 7, 8, 9, and having the same transcription factor function as the proteins shown in SEQ ID NO: 6, 7, 8, 9. The OsNTL5.1 protein includes a NAM domain at its N-terminus and a transmembrane domain at its C-terminus.
[0045] This invention provides a method for... OsNTL5 A method for regulating the high-temperature response of rice through gene editing. Specifically, this involves designing targeted... OsNTL5 The sgRNA, using CRISPR / CAS9 technology, was analyzed. OsNTL5 By performing insertions, deletions, and substitutions at specific locations, rice plants with altered genomes can be obtained. This is particularly relevant in temperature-responsive mutants. togr3 In China, OsNTL5 Gene editing can significantly restore togr3 High temperature response.
[0046] This invention provides a method for... OsNTL5.1 and OsNTL5.2 A method for regulating the high-temperature response of rice through overexpression. Specifically, this involves... pACTIN:EGFP-OsNTL5.1 and pACTIN:EGFP-OsNTL5.2 Transformation of recombinant vector into temperature-responsive mutant togr3 Significant recovery togr3 High temperature response.
[0047] The present invention provides the above-mentioned recombinant vector, and a host cell containing the recombinant vector, such as Escherichia coli, Agrobacterium, and rice cells.
[0048] The present invention also provides vectors comprising two types: one is a plant expression vector containing the polynucleotide sequence, and the other is a plant gene editing vector containing a target sequence for gene editing of the polynucleotide sequence.
[0049] The present invention also provides a host cell containing the vector, wherein the host cell is selected from bacteria, fungi, or plant cells, preferably *Escherichia coli*. Escherichia coli ) cells, Agrobacterium ( Agrobacterium tumefaciens ) cells or plant cells.
[0050] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0051] Example 1: Isolation and genetic analysis of genes controlling rice's adaptation to high ambient temperature.
[0052] togr3 This is a temperature-response defective mutant that was previously screened in our laboratory (corresponding to the mutant in CN114410603B). togr3 - 1 In Hainan, where the ambient temperature is low, its plant height is similar to that of the wild type, but in Beijing, where the temperature is higher, it exhibits more severe dwarfing. To analyze... togr3 The molecular mechanisms involved in the temperature response, the inventors of this invention... togr3 EMS mutagenesis was performed, and its repressors were screened. One of them was named togrs1 ( togr3 suppressor 1 ).exist togr3 togrs1 In double mutants, togrs1 Significantly inhibited in Beijing togr3 Phenotypic features include shorter plant height, shorter ear length, reduced ear length extending beyond the leaf sheath, and narrower leaves. Figure 1 (AF). To eliminate interference from other environmental factors in the field, the above materials were planted in incubators at 25℃ and 35℃ to observe the phenotype. Similar to the results above, at 25℃, togr3 Similar to the wild type, at 35℃, togr3 Severe dwarfing togrs1 Able to inhibit togr3 Phenotypic features of shorter plant height and narrower leaves Figure 1 (GJ).
[0053] togr3 In Beijing, the plant height was severely dwarfed. Statistics on internode length revealed that the last internode was significantly shorter compared to ZH11. togr3 togrs1 The proportions of intersegment lengths are similar to those of ZH11. Figure 2 (AC). In order to investigate at the cellular level togr3 and togrs1 To assess its role, we performed resin sections on the inverted intersegment and counted cell length and number. togr3 Cell length was significantly shortened, while cell number was significantly increased. togr3 togrs1 Cell length and cell number are similar to ZH11. Figure 2 (DF) indicates togr3 Reduce cell elongation, togrs1 Able to inhibit togr3 Cell length is reduced.
[0054] In order to clone TOGRS1 The encoded gene is first subjected to genetic analysis. togr3 and togr3 togrs1 After hybridization, the F1 generation exhibited a near-wild type. The F2 offspring were then observed in Beijing to determine their phenotype and statistically correlated with the wild type.togr3 For plants with the dwarf phenotype, the chi-square test results showed that the individual plants exhibited a 3:1 segregation ratio. togrs1 It is a mutant controlled by a dominant single gene. We also constructed... togr3 togrs1 68 individuals were selected from the F2 group (ZH11 background) and NJ6 (Nanjing 6). togr3 Genotypes of individual plants with different phenotypes were identified using polymorphic molecular markers, revealing a close linkage between the M6 marker on chromosome 8 and the phenotype. Figure 3 A). Further, we... togr3 and togr3 togrs1 Resequencing was performed, and togr3 Compared to the sequence, togr3 togrs1 Only one gene near M6 has a mutation in its coding region: a CCGC insertion in exon 208-211 bp of LOC_Os08g44820.1, causing a frameshift and premature termination of translation. According to the rice RGAP database annotations, this gene is named... OsNTL5 It contains 5 transcripts and is a NAC family transcription factor. The OsNTL5.1 protein has a conserved NAM domain at its N-terminus and a transmembrane domain at its C-terminus. Figure 3 (B~D). Therefore, we identified this gene as TOGRS1 Candidate genes.
[0055] Example 2 TOGRS1 candidate genes OsNTL5 Transgenic verification and rice genetic transformation
[0056] The results of Example 1 show togrs1 It is a dominant mutation, therefore... osntl5 ( togrs1 Mutations occur in osntl5 )genome sequence (including its own promoter sequence, genome sequence and 3' non-coding region sequence) ligated in pCAMBIA2300 Carrier (laboratory preservation), construction pCAMBIA2300-osntl5genome The vectorization steps are as follows: First, approximately 2 kb of the upstream sequence of ATG is amplified using OsNTL5-pro-EcorⅠ and OsNTL5-pro-BamHI as the promoter sequence. Then, the sequence is ligated into the vector using EcoⅠ and BamHI restriction enzyme digestion. pCAMBIA2300-pro Next, approximately 1 kb downstream of the ATG stop codon was amplified using OsNTL5-F-BamHI and OsNTL5-R-SalHI, and then ligated into the target cell using BamHI and SalHI enzymes. pCAMBIA2300-pro The vector and primer sequences are as follows (5′-3′):
[0057] OsNTL5-pro-EcorⅠ: CCGGAATTCCAGGCTCCAAGACATCAAAC (SEQ ID NO:12)
[0058] OsNTL5-pro-BamHI: CGCGGATCCGTGCCCTAGATTGGGATTGG (SEQ ID NO:13)
[0059] OsNTL5-F-BamHI: CGCGGATCCATGAGCCACCCCTCGTCGTC (SEQ ID NO:14)
[0060] OsNTL5-R-SalⅠ: ACGCGTCGACGTGAAGCTGAATTGCTCGCC (SEQ ID NO:15)
[0061] Will pCAMBIA2300-osntl5genome Sequence conversion to togr3 Significant recovery togr3 The dwarfed phenotype at high ambient temperatures ( Figure 4 AC).
[0062] In addition, it will be terminated early. togrs1 The CDS sequence (SEQ ID NO:10) was inserted via a seamless cloning method. pCAMBIA2300-proACTIN-EGFP In the middle, obtain pCAMBIA2300-proACTIN-EGFP-togrs1 The primer sequences are as follows (5′-3′):
[0063] togrs1 -F: GCATGGACGAGCTGTACAAGATGAGCCACCCCTCGTCGTC (SEQ ID NO:16)
[0064] togrs1 -R: TAAAGCAGGGCATGCCTGCAGTCAACAAAAGGAGCTCCGTACTG (SEQ ID NO:17)
[0065] Will pCAMBIA2300-proACTIN-EGFP-togrs1 Transform to togr3 Phenotypic observations in Beijing revealed that recovery was also possible. togr3 High temperature response defects ( Figure 4 AC).
[0066] Furthermore, the inventors of this invention have... OsNTL5 Two CRISPR CAS9 editing targets were designed ( Figure 5 The target sequence is as follows (5′-3′):
[0067] OsNTL5-CRI#1: GTACAGGTCCACCTCCGCGATGG (SEQ ID NO:18)
[0068] OsNTL5-CRI#2: GTACGGAGCTCCTTTTGTTGAGG (SEQ ID NO:19)
[0069] The expression cassette containing the above two target sequences was simultaneously ligated into pYLCRISPR / cas9 carrier ( pYLCRISPR / cas9 The vector was kindly provided by the laboratory of Liu Yaoguang, College of Agriculture, South China Agricultural University, for transformation. togr3 It can also be restored togr3 High temperature response defects ( Figure 4 (A~C).
[0070] The inventors have expanded OsNTL5.1 and OsNTL5.2 CDS sequences are linked via a seamless cloning method. pCAMBIA2300-proACTIN-EGFP The vector and primer sequences are as follows (5′-3′):
[0071] OsNTL5.1CDS-F: GACGAGCTGTACAAGTCTAGAATGAGCCACCCCTCGTCG (SEQ ID NO:20)
[0072] OsNTL5.1CDS-R: TAAAGCAGGGCATGCCTGCAGCTACTTGCCATAGATGCACATGC (SEQ IDNO:21)
[0073] OsNTL5.2CDS-F: GACGAGCTGTACAAGTCTAGAATGAGCCACCCCTCGTCG (SEQ ID NO:22)
[0074] OsNTL5.2CDS-R: TAAAGCAGGGCATGCCTGCAGTTAATGGCCAGGCAATGAGAA (SEQ ID NO:23)
[0075] Will pCAMBIA2300-proACTIN-EGFP-OsNTL5.1 / 5.2 Transformation togr3 By observing the phenotype, it was found that they were able to recover. togr3 Temperature response defects ( Figure 4 AC).
[0076] The method for genetic transformation of rice is as follows: the constructed vector is transformed into... E.coliIn DH5α competent cells, positive clones were screened using kanamycin. Plasmids were extracted and sequenced to identify positive clones with completely accurate sequences in the cloning vector. The plasmids of these positive clones were then electrotransformed into EHA105 Agrobacterium competent cells (prepared using standard methods, referring to *Plant Genetic Engineering*, Wang Guanlin and Fang Hongyun, Science Press, 2nd edition, 2004). The successfully transformed clones were then infected using Agrobacterium-mediated transformation. togr3 Transgenic manipulation is performed on the recipient.
[0077] The procedure for genetic modification is as follows:
[0078] (1) Seed sterilization: Weigh 20-30 g of dried rice seeds, remove the seed coat using a small dehulling machine in the laboratory, soak the dehulled seeds in 70% ethanol for 1 minute, then soak in 30% sodium hypochlorite (the stock solution is 10% available chlorine, add 1 drop of Tween20 per 50 mL) for 30 minutes, and gently shake on a shaker. Then rinse with sterile water 5-6 times; disinfect once with 30% sodium hypochlorite (without Tween20) and rinse with sterile water 5-6 times. Transfer the seeds to filter paper in the ultra-clean workbench to air dry.
[0079] (2) Inducing callus: Transfer the seeds to the pre-prepared N6D medium and then culture them in a light incubator at 32℃ and 24 hours of continuous light for 5-7 days until the seeds grow golden yellow callus.
[0080] (3) Agrobacterium infection: Infecting Agrobacterium containing specific plasmids EHA105 Streak the culture on YEB medium containing rifampicin (Rif 25-50 mg / L) and kanamycin (Kan 50 mg / L), then incubate in the dark at 28°C for 2-3 days. Pick single clones and transfer them to 5-6 mL of liquid YEB medium containing the same antibiotics, then incubate overnight at 28°C and 220 rpm with shaking for approximately 12 hours. Inoculate the bacterial culture at a 1:100 ratio into 50 mL of AAM medium and incubate overnight at 28°C and 220 rpm with shaking until OD (dose elapsed). 600 The concentration is approximately 0.1. Soak healthy callus in Agrobacterium tumefaciens solution for 2 minutes, then quickly remove the callus with tweezers and place it on sterile filter paper to air dry. After the callus has dried, transfer it to N6D-As medium pre-soaked in sterile filter paper (AAM soaking). Wrap the culture dish containing the callus with sealing film and aluminum foil and incubate in the dark at 25°C for 2-2.5 days.
[0081] (4) Screening and Differentiation: First, rinse the callus co-cultured with Agrobacterium tumefaciens 3-4 times in sterile double-distilled water, then rinse 2-3 times with sterile double-distilled water containing carbenicillin (500 mg / L) before soaking for 30 minutes each time, repeating 3-5 times to thoroughly clean the Agrobacterium tumefaciens from the callus surface. After washing, blot the callus with sterile filter paper and air dry. Then transfer it to N6DS medium containing the antibiotics hygromycin B (50 mg / L) and carbenicillin (400 mg / L) and culture it in a light incubator at 32°C with 24-hour continuous light for 2-3 weeks. The callus with good growth was transferred to regeneration RE medium containing hygromycin B (50 mg / L) and carbenicillin (250 mg / L) and cultured in an incubator at 32°C for one month to induce differentiation. The RE medium was changed about every two weeks until green seedlings appeared. The callus that differentiated into green seedlings was transferred to MS medium (30 g / L sucrose) containing hygromycin B (50 mg / L) and carbenicillin (200 mg / L) to induce rooting. When the seedlings grew to a certain size, they were transferred to MS medium without antibiotics for culture.
[0082] The culture media related to the Agrobacterium-mediated transformation of rice are shown in Table 1.
[0083] Table 1. Culture media related to the Agrobacterium-mediated transformation of rice.
[0084]
[0085] Example 3 OsNTL5 Analysis of the temperature response of alternatively spliced transcripts
[0086] Based on annotations from rice databases, it was detected by RT-PCR. OsNTL5.1 , OsNTL5.2 , OsNTL5.4 and OsNTL5.5 Four alternative splicing transcripts were detected, but none were found. OsNTL5.3 The expression of [the gene] was achieved using primers (OsNTL5total-qPCR-F / R) capable of amplifying all transcripts. tubulin Expression pattern analysis of the internal reference (tubulin-qPCR-F / R) revealed... OsNTL5 The highest expression was observed in the leaves of 14-day-old seedlings, followed by the roots, internodes, and leaf sheaths of mature plants. Expression was also found in leaves, nodes, and spikelets. Figure 6 (A) To investigate the temperature response of different transcripts, five pairs of RT-qPCR primers were designed, including those for specific amplification. OsNTL5.2 (OsNTL5.2-qPCR-F / R), OsNTL5.4Primers for single transcripts of OsNTL5.4-qPCR-F / R and OsNTL5.5 (OsNTL5.5-qPCR-F / R), and primers capable of simultaneously amplifying... OsNTL5.1 + OsNTL5.2 RNA levels in rice materials grown at two temperatures were detected using primers (OsNTL5.1 and 5.2-qPCR-F / R) and universal primers for all four transcripts (OsNTL5total-qPCR-F / R). High-temperature inhibition was found. OsNTL5.1 and 5.2 Expression ( B). The primer sequences are as follows (5′-3′):
[0087] OsNTL5total-qPCR-F: CAACCATTCTGAAGACGTGG
[0088] OsNTL5total-qPCR-R: GTTCCCAGCATTGGCACTAG
[0089] OsNTL5.2-qPCR-F: GTCTCCAGCATTGGCACTAG
[0090] OsNTL5.2-qPCR-R: TCCATGATGGATCAGCACTA
[0091] OsNTL5.4-qPCR-F: GCTATGTACTGTGGATGCTGAC
[0092] OsNTL5.4-qPCR-R: AGGGGTCTCAGAAGTTGGTA
[0093] OsNTL5.5-qPCR-F: CCTACACTGTTTCGGGGAAA
[0094] OsNTL5.5-qPCR-R: TGGCATCGCATTATCAGCAG
[0095] OsNTL5.1and5.2-qPCR-F: CCGTCGGCATGAAGAAGACC
[0096] OsNTL5.1and5.2-qPCR-R: ATACGGCACACGACGAATGA
[0097] tubulin-qPCR-F: GGAAATACATGGCTTGCTGCTT
[0098] tubulin-qPCR-R: TCTCTTCGTCTTGATGGTTGCA
[0099] Example 4: Yeast transcriptional self-activation experiment and Subcellular localization of alternatively spliced transcripts
[0100] Connect the full-length and truncated forms of OsNTL5.1 into (Clontech), transformed yeast strain Y2HGold, was cultured in triple-deficient medium (SD / -Trp / -Ade / -His) and grown. The results showed that OsNTL5.1 possesses transcriptional activation activity, and the transcriptional activation domain is not located in the conserved N-terminal NAM domain, but rather in the C-terminus (…). ).
[0101] Transient expression of eGFP-OsNTL5.1 in tobacco cells was observed using confocal fluorescence microscopy, where the fluorescence signal was localized to the nucleus and endoplasmic reticulum. Transient expression of OsNTL5.1-eGFP resulted in fluorescence localization only in the endoplasmic reticulum, consistent with previous studies suggesting that the C-terminal transmembrane domain of OsNTL5.1 is cleaved from the endoplasmic reticulum, releasing its N-terminus to enter the nucleus and exert transcriptional regulatory effects. In addition, the localization of three other transcripts was also investigated: OsNTL5.2 was localized to both the endoplasmic reticulum and the nucleus, and its C-terminus also contains a transmembrane domain localized to the endoplasmic reticulum; OsNTL5.4 and OsNTL5.5 were localized only to the endoplasmic reticulum, suggesting that the loss of their N-terminal NAM domain resulted in the loss of their nuclear localization signal. Only the N-terminal 53 amino acids and 161 frameshifted amino acids of OsNTL5.1 are retained (SEQ ID NO:11), and it is located in the cytoplasm and nucleus. ).
[0102] Rice is one of the most important food crops in my country, and its normal adaptive response to environmental temperature is the foundation for its normal growth, development, and maturation. This invention clones key factors controlling rice's adaptability to high environmental temperatures, providing important guidance for improving rice's adaptability to environmental temperature through rice genetic engineering and molecular breeding.
[0103] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
[0104] References:
[0105] [1] Guo Feifei (2020) Carbon balance regulation of thermomorphogenesis mediated by OsPBD1 subunit of β4 proteasome in rice [D]. Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.
[0106] [2]Li XM, Chao DY, Wu Y, Huang X, Chen K, Cui LG, Su L, Ye WW,Chen H, Chen HC, Dong NQ, Guo T, Shi M, Feng Q, Zhang P, Han B, Shan JX, Gao JP, and Lin H Genet.2015:47(7):827-833.
[0107] [3]Xu FQ, and Xue H W. The ubiquitin-proteasome system in plantresponses to environments. Plant Cell Environ. 2019:42(10):2931-2944.
[0108] [4]Zhang J, Li XM, Lin HX, and Chong K. Crop Improvement ThroughTemperature Resilience. Annu Rev Plant Biol. 2019:70(753-780.
[0109] [5]Zhao C, Liu B, Piao S, Wang X, Lobell DB, Huang Y, Huang M, Yao Y, Bassu S, Ciais P, Durand JL, Elliott J, Ewert F, Janssens IA, Li T, Lin E, Liu Q, Martre P, Müller C, Peng S, Peñuelas J, Ruane AC, Wallach D, Wang T, Wu D, Liu Z, Zhu Y, Zhu Z, and Asseng S. Temperature increase reduces global yields of major crops in four independent estimates. Proc Natl AcadSci US A. 2017:114(35):9326–9331.
Claims
1. An alternatively spliced NAC transcription factor OsNTL5 Application in the response of rice to high ambient temperature; OsNTL5 The genomic DNA sequence is shown in SEQ ID NO:1; OsNTL5 Contains four alternative splicing transcripts OsNTL5.1 , OsNTL5.2 , OsNTL5.4 and OsNTL5.5 ;in, OsNTL5.1 The nucleotide sequence is shown in SEQ ID NO:2; OsNTL5.2 The nucleotide sequence is shown in SEQ ID NO:3; OsNTL5.4 The nucleotide sequence is shown in SEQ ID NO:4; OsNTL5.5 The nucleotide sequence is shown in SEQ ID NO:5; Through the analysis of rice OsNTL5 Modify it to disable its function, thereby improving the rice's adaptability to high ambient temperatures; or, By overexpressing in rice OsNTL5.1 and OsNTL5.2 This improves the rice's adaptability to high ambient temperatures; The rice is a temperature-responsive defective mutant. togr3-1 .
2. A method for improving the adaptability of rice to high ambient temperatures, characterized in that, The method includes: using genetic engineering techniques to weaken or knock out [certain substances] in rice. OsNTL5 ; OsNTL5 The genomic DNA sequence is shown in SEQ ID NO:1; The rice is a temperature-responsive defective mutant. togr3-1 .
3. The method according to claim 2, characterized in that, by OsNTL5 To target the target, a CRISPR / Cas9-based sgRNA sequence was designed. A DNA fragment containing the sgRNA sequence was ligated into a vector carrying CRISPR / Cas9, and rice was transformed to obtain the desired result. OsNTL5 Genetically modified rice with loss of function.
4. The method according to claim 3, characterized in that, The nucleotide sequences of the sgRNA action site are 5'-GTACAGGTCCACCTCCGCGATGG-3' and 5'-GTACAGGAGCTCCTTTTGTTGAGG-3'.
5. The method according to claim 3 or 4, characterized in that, The transformation was performed using Agrobacterium-mediated transformation.
6. A method for improving the adaptability of rice to high ambient temperatures, characterized in that, The method includes: using genetic engineering techniques to overexpress [the gene] in rice. OsNTL5.1 and OsNTL5.2 The OsNTL5.1 and OsNTL5.2 Same as described in claim 1; The overexpression method is selected from the following 1) to 5), or any combination thereof: 1) By importing a plasmid containing the gene; 2) By increasing the copy number of the aforementioned genes on plant chromosomes; 3) By altering the promoter sequence of the aforementioned genes on plant chromosomes; 4) By operatively linking a strong promoter to the gene; 5) By introducing enhancers; The rice is a temperature-responsive defective mutant. togr3-1 .
7. The application of transgenic rice obtained by the method according to any one of claims 2-6 in plant breeding.
8. The application according to claim 7, characterized in that, Breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.
Citation Information
Patent Citations
Application of rice high environment temperature response gene OsTOGR4
CN119614611A