Application of Soybean GmSUC6 Gene and Its Encoded Protein in Regulating Soybean Seed Protein Content

Abstract

The present invention relates to the field of genetic engineering technology, and discloses the application of soybean GmSUC6 gene and its encoded protein in regulating the protein content of soybean seeds. The present invention for the first time reveals that the soybean GmSUC6 gene and its encoded protein have the function of regulating the protein content of soybean seeds, and the protein content of soybean can be effectively increased by mutating the encoded protein of the GmSUC6 gene in plants. The GmSUC6 gene and its encoded protein provided by the present invention can be used for the breeding of high-protein soybean varieties, and have broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and specifically, to the application of soybean GmSUC6 gene and its encoded protein in regulating the protein content of soybean seeds. Background Art

[0002] Soybean is an important food and oil crop, and the protein content in its seeds is one of the key indicators for measuring the quality of soybeans. Soybean protein is one of the few high-quality proteins containing all essential amino acids, especially rich in lysine, and is suitable as a high-quality source of dietary protein. For vegetarians or people who restrict animal protein intake, soybean protein is an important nutritional supplement. Soybean protein has a wide range of uses and is used in animal feed and human food in various ways. Soybean protein is widely used in the food industry and can be used to make various products such as soy milk, tofu, vegetarian meat, and protein powder. Its functional properties (such as emulsifying property and gelling property) make it an important raw material in food processing. Soybean protein also contains various components beneficial to the human body such as bioactive peptides and isoflavones, which are beneficial to reducing the risk of chronic diseases such as cardiovascular diseases, diabetes, and immune disorders. Therefore, improving the protein content in soybean seeds is one of the important directions for high-quality soybean breeding. Summary of the Invention

[0003] The purpose of the present invention is to provide the application of soybean GmSUC6 gene and its encoded protein in regulating the protein content of soybean seeds.

[0004] To achieve the purpose of the present invention, in the first aspect, the present invention provides the application of soybean GmSUC6 gene and its encoded protein in regulating the protein content of soybean seeds.

[0005] The soybean GmSUC6 gene is a gene encoding the following protein (a) or (b):

[0006] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO:1; or

[0007] (b) a protein derived from (a) with one or several amino acids substituted, deleted or added and having the same function.

[0008] The CDS sequence of gene GmSUC6 is shown in SEQ ID NO:2.

[0009] In the second aspect, the present invention provides a method for increasing the protein content of soybean seeds, which modifies the soybean GmSUC6 gene to make its function lost, thereby increasing the protein content of soybean seeds.

[0010] Further, the method includes: using the soybean GmSUC6 gene as a target, designing a CRISPR-Cas9-based gRNA sequence, ligating a DNA fragment encoding the gRNA sequence into a vector carrying CRISPR-Cas9, and transforming soybean to obtain transgenic soybean with a loss-of-function of this gene. Specifically as follows: using the soybean GmSUC6 gene as a target, designing a knockout target sequence based on CRISPR-Cas9, first ligating an oligonucleotide sequence encoding the knockout target sequence into the pBlu gRNA intermediate vector to construct gRNA, then digesting the constructed gRNA, ligating the digested gRNA onto the CRISPR-Cas9 vector, and then transforming soybean to obtain transgenic soybean with a loss-of-function of this gene.

[0011] Correspondingly, the nucleotide sequence of the gRNA knockout target is shown in SEQ ID NO:5.

[0012] In the third aspect, the present invention provides a soybean GmSUC6 gene mutant, including mutant gmsuc6-1 and gmsuc6-2 , wherein mutant gmsuc6-1 is:

[0013] I) The nucleotide sequence shown in SEQ ID NO:3;

[0014] II) The nucleotide sequence shown in SEQ ID NO:3 with one or more nucleotides substituted, deleted and / or added and expressing the same functional protein;

[0015] III) The nucleotide sequence hybridizing with the sequence shown in SEQ ID NO:3 under stringent conditions and expressing the same functional protein, and the stringent conditions are hybridizing in a solution of 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS at 65°C and washing the membrane with this solution; or

[0016] IV) The nucleotide sequence having more than 90% homology with the nucleotide sequence of I), II) or III) and expressing the same functional protein.

[0017] Mutant gmsuc6-2 is:

[0018] i) The nucleotide sequence shown in SEQ ID NO:4;

[0019] ii) The nucleotide sequence shown in SEQ ID NO:4 with one or more nucleotides substituted, deleted and / or added and expressing the same functional protein;

[0020] iii) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:4 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in a solution of 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS, and washing the membrane with this solution; or

[0021] iv) A nucleotide sequence having more than 90% homology with the nucleotide sequence of i), ii) or iii) and expressing the same functional protein.

[0022] Fourthly, the present invention provides the use of the soybean GmSUC6 gene mutant or the biological material containing the gene mutant in regulating the protein content of soybean seeds.

[0023] Fifthly, the present invention provides the use of the soybean GmSUC6 gene mutant or the biological material containing the gene mutant in the preparation of transgenic plants.

[0024] Sixthly, the present invention provides a method for increasing the protein content of soybean seeds, and the method includes: introducing the soybean GmSUC6 gene mutant gmsuc6-1 or gmsuc6-2 into soybean by plasmid or integrating it into the soybean chromosome by genetic engineering means.

[0025] Seventhly, the present invention provides the use of the transgenic soybean obtained by the method in plant breeding.

[0026] Furthermore, the breeding methods include but are not limited to transgenic, hybridization, backcross, self-cross or asexual reproduction.

[0027] By the above technical solutions, the present invention has at least the following advantages and beneficial effects:

[0028] The present invention for the first time reveals that the soybean GmSUC6 gene and its encoded protein have the function of regulating the protein content of soybean seeds, and by mutating the encoded protein of the GmSUC6 gene in plants, the protein content of soybean can be effectively increased. The GmSUC6 gene and its encoded protein provided by the present invention can be used for the breeding of high-protein soybean varieties and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the genomic sequence of a part of the soybean GmSUC6 gene provided by Example 1 of the present invention; wherein, the bold represents the exon sequence, the italic represents the intron sequence, and ATG represents the start codon.

[0030] Figure 2This is the genomic sequence of partial soybean GmSUC6 gene provided in Example 1 of the present invention; among them, the bold represents the exon sequence, the italic represents the intron sequence, and TGA represents the stop codon.

[0031] Figure 3 This is the intermediate vector map used for constructing the CRISPR-Cas9 knockout plants of GmSUC6 gene provided in Example 2 of the present invention.

[0032] Figure 4 This is the CRISPR-Cas9 vector map used for constructing the CRISPR-Cas9 knockout plants of GmSUC6 gene provided in Example 2 of the present invention.

[0033] Figure 5 This is two mutants generated after knocking out the GmSUC6 gene provided in Example 2 of the present invention gmsuc6-1 、 gmsuc6-2 mutation mode map.

[0034] Figure 6 This is the schematic diagram of the protein content of the seeds of the plants expressing the GmSUC6 gene mutant and the wild-type Williams 82 soybean provided in Example 3 of the present invention. Detailed implementation manners

[0035] The present invention aims to provide the application of soybean GmSUC6 gene and its encoded protein in regulating the protein content of soybean seeds.

[0036] The present invention adopts the following technical solutions:

[0037] The present invention provides a GmSUC6 protein, including: the amino acid sequence shown in SEQ ID NO: 1.

[0038] The GmSUC6 protein is encoded by the nucleotide sequence shown in SEQ ID NO: 2.

[0039] The present invention also provides a nucleic acid, which is used for encoding the GmSUC6 protein.

[0040] The nucleic acid includes genomic DNA, cDNA, recombinant DNA or mRNA, hnRNA encoding the GmSUC6 protein; or a nucleic acid molecule that is reverse complementary to the above DNA, cDNA, recombinant DNA or mRNA.

[0041] The present invention also provides two GmSUC6 gene mutants ( gmsuc6-1 and gmsuc6-2 ), including: the gmsuc6-1 nucleotide sequence shown in SEQ IDNO: 3, the gmsuc6-2 nucleotide sequence shown in SEQ ID NO: 4.

[0042] The present invention also provides a biological material, which comprises the nucleic acid or the GmSUC6 gene mutant; the biological material includes but is not limited to recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or transgenic cell line.

[0043] The present invention also provides a kit, which comprises one or more of the GmSUC6 protein, the nucleic acid, the GmSUC6 gene mutant or the biological material.

[0044] The present invention further provides the use of the GmSUC6 protein, the nucleic acid, the GmSUC6 gene mutant, the biological material or the kit in increasing the protein content of soybean seeds.

[0045] The following examples are used to illustrate the present invention, but do not limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0046] Example 1

[0047] This example provides a method for isolating the GmSUC6 gene from soybean and analyzing its structure, which specifically includes the following procedures:

[0048] 1. Isolation of the GmSUC6 gene

[0049] The present invention extracts total RNA from soybean variety Williams 82, uses the total RNA as a template, and synthesizes the first strand of cDNA with the oligonucleotide sequence (T)17 as a primer. Using the first strand of cDNA as a template, PCR amplification is carried out respectively with the forward primer (5’-ATGGAGCCTCTCTCTTCCACC -3’) and the reverse primer (5’- TTAGTGGAATCCTCCTCCGGC -3’). A GmSUC6 gene cDNA fragment with a length of 1566bp is obtained, and this fragment is ligated to the pEasy -vector (Kangrun Biological Company) and named Blunt Blunt - GmSUC6 .

[0050] For the obtained GmSUC6 gene, its CDS sequence is shown in SEQ ID NO:2, and the full length of the GmSUC6 gene CDS is 1566bp in total; the amino acid sequence of the protein encoded by this gene is shown in SEQ ID NO:1, with a total of 522 amino acids.

[0051] 2. Structure analysis of the GmSUC6 gene

[0052] DNA was extracted from the young leaves of soybean variety Williams 82. Using this genomic DNA as a template, the GmSUC6 genomic fragment was amplified. The GmSUC6 genomic sequence is as Figure 1 and Figure 2 shown. The full length is 3677 bp in total, containing 3 exons and 2 introns.

[0053] Example 2

[0054] In the present invention, the GmSUC6 mutant ( gmsuc6-1 , gmsuc6-2 ) was constructed by the CRISPR-Cas9 technology. The specific process is as follows:

[0055] 1. Design the target sequence for knocking out the GmSUC6 gene

[0056] Search for the GmSUC6 gene in the Arabidopsis database (www.arabidopsis.org) to obtain its amino acid sequence. Use the BLAST tool (https: / / phytozome-next.jgi.doe.gov / blast-search) to search for the corresponding homologous gene in the Glycine max (soybean) genome. Input the DNA sequence of GmSUC6 using the CRISPR design tool (http: / / cfans-pmorrell.oit.umn.edu / CRISPR / ). Design and synthesize the target oligonucleotide sequence (oligo) with sticky ends.

[0057] Oligonucleotide sequence:

[0058] F: 5’-gattGCTGGGGATTCCCCACACTT-3’;

[0059] R: 5’-aaacAAGTGTGGGGAATCCCCAGC-3’.

[0060] 2. gRNA cloning

[0061] The synthesized target oligonucleotide sequence (oligo) was diluted and annealed (50 °C, 6 hours). The pBlu gRNA (https: / / stuparlab.cfans.umn.edu / protocols / crisprcas9-glycine-max) vector was digested with BbsI ( Figure 3). The digested products were separated by gel electrophoresis, and the 3500 bp vector fragment was extracted. The annealed oligonucleotide sequence (oligo) was ligated to the digested pBlu gRNA vector (using T4 ligase, overnight at 16 °C). The ligation product was transformed into Escherichia coli (DH5α), and positive clones were screened. The plasmid was extracted and sequenced (using the T3 primer 5’-aattaaccctcactaaaggg-3’) to confirm the correct gRNA sequence. The nucleotide sequence of the gRNA knockout target is shown in SEQ ID NO:5.

[0062] 3. Insertion of gRNA into the Cas9 vector

[0063] The verified pBlu gRNA vector and the target Cas9 vector were digested with EcoRI. The digested products were separated by gel electrophoresis, and the 557 bp gRNA fragment was extracted. The gRNA fragment was ligated to the digested Cas9 vector (https: / / stuparlab.cfans.umn.edu / protocols / crisprcas9-glycine-max) ( Figure 4 ), using T4 ligase (overnight at 16 °C). The ligation product was transformed into Escherichia coli (DH5α), and positive clones were screened. Positive clones were screened by colony PCR to confirm the correct insertion of the gRNA fragment. The plasmid was extracted and sequenced to ensure correct vector construction.

[0064] 4. Transformation of soybean and screening of positive plants

[0065] The constructed CRISPR-Cas9 vector was introduced into Williams 82 soybean callus by Agrobacterium-mediated transformation. Positive transformed plants were screened using the selection marker Bar cassette. Genomic DNA of the transformed plants was extracted, and the knockout of the target gene was verified by PCR and sequencing to confirm whether it was a homozygous knockout plant. The knockout results are shown as Figure 5 shown.

[0066] Example 3

[0067] The protein content of GmSUC6 mutants ( gmsuc6-1 , gmsuc6-2 ) and Williams 82 seeds was determined, with the protein content of Williams 82 seeds as the control. The specific method is as follows:

[0068] The protein content of mature soybean seeds was determined using a Thermo Fisher Antaris II FT-NIR analyzer (Key Laboratory of Soybean Molecular Design, Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences). At least 30 seeds were prepared for each plant, and the measurement was repeated three times. The average value of the three replicates was taken as the protein content of the soybean seeds of that plant.

[0069] Williams 82, gmsuc6-1 and gmsuc6-2 Ten individual plants were harvested separately, and the protein content of the seeds of each individual plant was measured. The average value of the measurement results of all individual plants of each variety was taken as the protein content of the soybean seeds of each variety. The measurement results are shown as Figure 6 follows.

[0070] As can be seen from the above experimental results, compared with the control group (Williams 82), gmsuc6-1 and gmsuc6-2 the protein content was significantly different, indicating that the GmSUC6 protein negatively regulates the protein content of soybeans. Therefore, mutating GmSUC6 can effectively increase the protein content of soybeans, and GmSUC6 can be used as a potential target for breeding soybeans with high protein content.

[0071] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. Use of deletion of soybean GmSUC6 gene or its encoded protein in increasing protein content of soybean seeds; The amino acid sequence of the protein encoded by the soybean GmSUC6 gene is shown in SEQ ID NO:

1.

2. A method for increasing the protein content of soybean seeds, characterized in that, Modify the soybean GmSUC6 gene to cause loss of function of this gene, thereby increasing the protein content of soybean seeds; wherein, the soybean GmSUC6 gene is the same as that described in claim 1.

3. The method according to claim 2, characterized in that, The method includes: using the soybean GmSUC6 gene as a target, designing a CRISPR-Cas9-based gRNA sequence, ligating the DNA fragment encoding the gRNA sequence into a vector carrying CRISPR-Cas9, transforming soybean, and further obtaining transgenic soybean with loss of function of this gene.

4. The method according to claim 3, wherein The nucleotide sequence of the gRNA action site is shown in SEQ ID NO:

5.

5. Use of the transgenic soybean obtained by the method according to any one of claims 2-4 in breeding of soybean seeds with high protein content.

Images