StSAM-MT gene and its application

Abstract

The present invention belongs to the field of genetic engineering technology and relates to StSAM‑ MT Gene and its application. The present invention provides StSAM‑MT gene, the StSAM‑MT Gene: a1) encoding StSAM-MT protein; b1) having the nucleotide sequence shown in SEQ ID NO: 2. The present invention discloses StSAM‑MT This gene plays an important role in negatively regulating potato resistance to pathogenic Phytophthora, providing a theoretical basis and new technical ideas for the identification of potato disease-susceptibility genes. It has important guiding significance for the precise manipulation of the expression of such genes to create potato germplasm with broad-spectrum resistance and stable yield.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and relates to StSAM-MT Genes and their applications. Background Art

[0002] As an important dual-purpose food and vegetable crop in the world, potato has long been attacked by various pathogens, including Phytophthora infestans ( Phytophthora infestans ) is particularly serious, threatening potato production and may even lead to total failure.

[0003] When plants deal with external adverse factors, they have evolved two levels of molecular immune systems for defense. The first level of the plant immune system directly recognizes pathogen-associated molecular patterns (PAMPs) released by pathogens through pattern recognition receptors (PRRs) on the cell membrane, thereby triggering pattern-triggered immunity (PTI). This mechanism is the first line of defense for plants against pathogen infection and can effectively resist the invasion of some pathogens. However, when pathogens break through the first level of the immune system, plants will activate a stronger second level of the immune system, namely effector-triggered immunity (ETI) (Jones et al., 2006). This system relies on disease-resistant genes in plant cells ( R These proteins can recognize effector molecules released by pathogens and trigger a stronger immune response. R Genes are often used to develop crops that are resistant to specific pathogens. R Genes encode leucine-rich repeat-containing proteins that directly or indirectly recognize pathogenic effector proteins and trigger immunity. R Gene-mediated disease resistance is species-specific, and pathogens can evade plant immune defenses by mutating their effector genes.

[0004] Given that R Due to the limitations of gene-mediated disease resistance, scientists have begun to explore the destruction of plant susceptibility genes as a new strategy for breeding disease-resistant plants in recent years. Susceptibility genes are host genes necessary for pathogens to infect and cause disease. Compared with disease-resistant genes, resistance mediated by mutations in susceptibility genes is usually persistent and broad-spectrum. For example, MLO The gene is a typical disease susceptibility gene, and its loss-of-function mutation can significantly enhance the plant's broad-spectrum resistance to powdery mildew (Li et al., 2022). Similarly, the disease susceptibility gene in wheat TaPsIPK1 The edited lines also showed high resistance to stripe rust in field trials without affecting the main agronomic traits of wheat (Wang et al., 2022).

[0005] SAM-MT is an important enzyme in the secondary metabolism of plants. It can transfer the methyl group of S-adenosylmethionine (SAM) to the structure of one or more secondary metabolites, thereby changing the structure and biological activity of these compounds. For example, in the synthesis of compounds such as lignin, phenylpropanes and flavonoids, SAM-MT can catalyze methylation reactions to generate secondary metabolites with specific structures and functions. In addition, SAM-MT also affects the synthesis and signal transduction of plant hormones such as jasmonic acid through methylation modification, thereby regulating the growth and development process of plants. SAM-MT also plays an important role in the initiation and regulation of plant defense mechanisms. It can affect methylation reactions, thereby affecting the disease resistance and insect resistance of plants. Some literature reports indicate that, WUSCHEL It can inhibit the expression of some plant S-adenosyl-L-methionine-dependent methyltransferases (including possible SAM-MT), thereby inhibiting the synthesis of viral proteins (Haijun et al., 2020). In addition, the methyltransferase superfamily TaSAM Genes have been shown to contribute to wheat resistance to fusarium head blight (Malla et al., 2024). Based on these findings, the applicants speculate that in potatoes, S-adenosyl-L-methionine-dependent methyltransferase genes (especially the StSAM-MT ) may play an important role in potato resistance to late blight. The applicant's research results show that StSAM-MT It is a potato late blight susceptibility gene.

[0006] In summary, the exploration and utilization of disease-susceptibility genes provides a new approach to breeding disease-resistant plant varieties. By destroying or editing disease-susceptibility genes, plant varieties with persistent and broad-spectrum resistance can be bred, thereby more effectively responding to the threat of pathogens. This strategy helps to improve plant disease resistance and provide a sustainable and environmentally friendly disease prevention and control solution for agricultural production. In the future, the applicant will further analyze StSAM-MT The mechanism of action in plant immunity can provide new strategies and methods for breeding potato varieties resistant to late blight. Summary of the Invention

[0007] The present invention aims to further identify key genes that regulate potato resistance to Phytophthora infestans and to effectively expand the application of these genes in improving potato resistance to late blight. To this end, the present invention provides a novel approach to enriching disease-resistant gene resources and molecular-assisted breeding and development of disease-resistant materials by using the S-adenosyl-L-methionine-dependent methyltransferase StSAM-MT.

[0008] The inventors of this application successfully isolated and cloned a potato S-adenosyl-L-methionine-dependent methyltransferase gene from a potato cDNA library (StSAM-MT gene), and verified StSAM-MT The role of genes in the regulation of potato immunity in response to infection by Phytophthora infestans.

[0009] To achieve this technical purpose, the present invention adopts the following technical solutions.

[0010] In a first aspect, the present invention provides StSAM-MT gene, the StSAM-MT Gene:

[0011] a1) Encoding StSAM-MT protein;

[0012] b1) having the nucleotide sequence shown in SEQ ID NO: 2.

[0013] In a second aspect, the present invention provides a StSAM-MT protein, wherein the StSAM-MT protein is:

[0014] 1) having the amino acid sequence shown in SEQ ID NO: 1;

[0015] 2) a derivative amino acid sequence obtained by substituting, deleting and / or adding one or more amino acids from the amino acid sequence in 1), said derivative amino acid sequence having the activity of the amino acid sequence shown in 1); or

[0016] 3) An amino acid sequence having at least 80% homology to the amino acid sequence in 1).

[0017] Preferably, the StSAM-MT Genes related to immune regulation in potato-infesting fungus Phytophthora infestans.

[0018] Preferably, the StSAM-MT The gene plays a negative regulatory role in the immune response of potato against Phytophthora infestans.

[0019] Preferably, overexpression of StSAM-MT Genes that reduce host plant resistance to Phytophthora infestans Phytophthora infestans resistance.

[0020] Preferably, the StSAM-MT The gene has a specific gene fragment with a nucleotide sequence as shown in SEQ ID NO: 3, and silencing the specific gene fragment can enhance the host plant's resistance to Phytophthora infestans. Phytophthora infestans resistance.

[0021] In a third aspect, an expression vector is provided, wherein the expression vector contains the StSAM-MT Gene.

[0022] In addition, resistance to Phytophthora infestans is also provided Phytophthora infestansA method for cultivating a plant variety, comprising transferring the expression vector of the present invention into a host plant and silencing StSAM-MT Gene steps.

[0023] Furthermore, the present invention also provides StSAM-MT Gene or expression vector of the present invention in the resistance to Phytophthora infestans Phytophthora infestans Application in plant variety breeding.

[0024] Preferably, including:

[0025] a2) Silence StSAM-MT Nucleotide sequence of a gene that enhances host plant resistance to Phytophthora infestans Phytophthora infestans resistance; or

[0026] b2) Reduce the activity and / or expression of StSAM-MT protein to enhance the host plant's resistance to Phytophthora infestans Phytophthora infestans resistance.

[0027] In the present invention, reducing the activity and / or expression level of a specific protein in plants can be achieved by methods well known in the art such as VIGS, RNA interference, homologous recombination, and gene site editing to achieve the purpose of reducing the activity and / or expression level of a specific protein in plants.

[0028] In the present invention, those skilled in the art can easily adopt known methods, such as directed evolution and point mutation methods, to modify the present invention. StSAM-MT Therefore, the present invention claims protection for the S-adenosyl-L-methionine-dependent methyltransferase gene StSAM-MT Application in the selection and creation of germplasm resources resistant to potato infestation phytophthora. StSAM-MT The nucleotide sequence of the gene is 75% or more identical to the nucleotide sequence of the gene, as long as the encoding StSAM-MT The genes have the same function and are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0029] As used herein, the term "nucleotide sequence" or "polynucleotide" refers to a linear polymer of natural or synthetic nucleotide residues linked by phosphodiester bonds or their analogs. It can be single-stranded or double-stranded and includes RNA, DNA (e.g., genomic, cDNA, or synthetic), analogs thereof, or combinations thereof. Those skilled in the art will appreciate that nucleotide sequences are generally presented in 5'-3' order from left to right, and that, unless otherwise indicated, "A" refers to deoxyadenosine, "C" refers to deoxycytidine, "G" refers to deoxyguanosine, "T" refers to deoxythymidine, and "U" refers to the ribonucleoside, uridine. Typically, nucleotide sequences contain the four naturally occurring deoxynucleotides or the four naturally occurring ribonucleotides; however, they may also contain non-natural nucleotide analogs.

[0030] For the purposes of this invention, the term "amino acid sequence" refers to the order in which amino acids are arranged in a protein. This sequence is determined by genetic information, specifically, by the genes in DNA or RNA through the processes of transcription and translation. Amino acid sequences are typically represented by a string of letters, with each letter representing a specific amino acid. These sequences are arranged from the N-terminus (amino terminus) to the C-terminus (carboxyl terminus). In biology, there are 20 different standard amino acids, each with a specific single-letter or three-letter abbreviation. For example, the three-letter and single-letter abbreviations for methionine (lysine) are Lys and K, respectively.

[0031] In this application, the term "gene" refers to the primary mechanism of genetic variation. It is the fundamental unit of genetic variation, consisting of the sequence of numerous base pairs within a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecule that determine biological traits. Genes express the genetic information they carry by directing protein synthesis, thereby controlling the expression of traits in an individual organism. Specifically, genes are located on chromosomes, arranged linearly and occupying a specific position within the chromosome. Genes possess a dual nature: they can faithfully replicate themselves to maintain the basic characteristics of an organism, while also potentially mutating during reproduction. Mutated genes can also continue to replicate and be passed on to future generations. Genes not only transmit genetic information to the next generation through replication but also enable this information to be expressed in the molecular structure of proteins. Therefore, genes are the fundamental unit of genetic variation. A gene consists of only one DNA molecule, but a single DNA molecule can contain multiple genes. Genes are segments of DNA molecules with heritable effects that determine the expression of traits.

[0032] As used herein, the term "protein" refers to protein, which is the material basis of life. Protein is an organic macromolecule, the fundamental organic substance that constitutes cells, and the primary driver of life activities. Without protein, there would be no life. Amino acids are the basic building blocks of protein. Protein is a substance that is closely linked to life and all forms of life activities.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] (1) The present invention discloses an S-adenosyl-L-methionine-dependent methyltransferase gene that is susceptible to potato late blight, namely StSAM-MT Using Agrobacterium-mediated transient expression and virus-induced gene silencing (VIGS) technology, we revealed StSAM-MT Genes play an important role in enhancing potato resistance to pathogenic Phytophthora, providing a theoretical basis and new technical ideas for the identification of potato disease-resistant genes, and providing resistance gene resources for potato disease-resistant breeding.

[0035] (2) The present invention provides StSAM-MT The gene was transiently overexpressed in Nicotiana benthamiana using an Agrobacterium-mediated transient expression system, which verified StSAM-MT Genes that promote infection of plants by Phytophthora infestans and reduce plant resistance to the fungus; silenced in Nicotiana benthamiana using virus-induced gene silencing (VIGS) NbSAM-MT Gene, confirmed NbSAM-MT The gene promotes the infection of Phytophthora infestans on plants and weakens the resistance of plants to Phytophthora infestans. At the same time, the Agrobacterium-mediated potato genetic transformation system is used to stably overexpress the gene. StSAM-MT Gene, stable transformation StSAM-MT Transgenic potato plants with the same gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 for StSAM-MT Gel electrophoresis of genes.

[0037] Figure 2 For transient overexpression in Nicotiana benthamiana StSAM-MT Gene resistance verification diagram. a is the leaf infection diagram; b is the statistical analysis result diagram of the lesion area; GFP-GUS For comparison, GFP-StSAM-MT For overexpression StSAM-MT Gene expression vector.

[0038] Figure 3 for TRV - NbSAM - MT Gel electrophoresis of gene fragments during vector construction.

[0039] Figure 4 To silence Nicotiana benthamiana NbSAM-MT The results of significantly inhibiting the infection of Phytophthora infestans were obtained. a is the leaf infection diagram; b is the statistical analysis result diagram of the lesion area; TRV-GFP For comparison, TRV-NbSAM-MT For silence NbSAM-MT Gene expression vector.

[0040] Figure 5 for StSAM-MT Identification diagram of transgenic potato plants overexpressing the gene. a is the phenotypic diagram; b is the DNA identification diagram; c is the qPCR identification diagram; among them, Atlantic refers to the untransformed potato variety, GFP-StSAM-MT-OE-2 Refers to conversion GFP-StSAM-MT Transgenic potato line 2.

[0041] Figure 6 For StSAM-MT Resistance verification diagram of transgenic potato plants overexpressing the gene. a is the leaf infection diagram; b is the statistical analysis result of the lesion area; Among them, Atlantic refers to the potato variety used for genetic transformation, GFP- StSAM-MT-OE-2 Overexpression GFP-StSAM-MT Gene-transgenic potato lines 2. DETAILED DESCRIPTION

[0042] The technical solutions of the present invention are described clearly and completely below with reference to the embodiments. It is obvious that the embodiments described are only a portion of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are also within the scope of protection of the present invention.

[0043] The technical solutions of the present invention are described below with reference to the following examples. However, the present invention is not limited to the following examples. The experimental methods and detection methods described in each example are conventional methods unless otherwise specified. The reagents and materials described are commercially available unless otherwise specified. The percentages in the following examples are percentages by mass unless otherwise specified.

[0044] Example 1

[0045] This example describes the expression of potato S-adenosyl-L-methionine-dependent methyltransferase StSAM-MT Isolation and cloning of genes.

[0046] RNA was extracted from potato cultivar Atlantica. RNA was extracted from potato leaves using an RNA extraction kit. RNA integrity was assessed by agarose gel electrophoresis, and the purity and concentration of the RNA were determined spectrophotometrically. A reverse transcription kit was used to obtain cDNA from Phytophthora infestans-infected potato. Upstream and downstream primers were designed based on the full-length coding sequence of PGSC0003DMP400018799. Amplification was performed using potato cDNA as a template. The reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 5 minutes; and extension at 72°C for 5 minutes. The amplified PCR product was ligated with the pART27 vector (containing a GFP tag at the N-terminus) and transformed into Escherichia coli DH5α competent cells. Positive single clones were detected and streaked into liquid LB medium at 37°C for 220 min. rpm overnight culture, and the plasmid was extracted using a plasmid extraction kit (Beijing Biomed Biotechnology Co., Ltd., 79661555, DP102-01) and named GFP-StSAM-MT- pART27 Cloned potato S-adenosyl-L-methionine-dependent methyltransferase StSAM-MT Gene (abbreviated as StSAM-MT ) gel electrophoresis gel Figure 1 As shown, StSAM-MT The nucleotide sequence obtained by gene sequencing is shown in SEQ ID NO: 2, and the amino acid sequence of the StSAM-MT protein encoded thereby is shown in SEQ ID NO: 1.

[0047] StSAM-MT The primer sequences of the genes are as follows:

[0048] StSAM-MT kpn1F: GGGGTACCATGGCAAATTTGTTCATTAAGCAAG;

[0049] StSAM-MT xba1R: GCTCTAGATCAATCCAAATTTCCAACTTTTCC.

[0050] Example 2

[0051] This example describes the overexpression of potato S-adenosyl-L-methionine-dependent methyltransferase in Nicotiana benthamiana. StSAM-MT Functional verification of genes.

[0052] according to Figure 2 As shown, this example uses Agrobacterium-mediated transient expression technology to transiently express in tobacco [[ID= Gene to increase the accumulation of StSAM-MT protein in plants. The specific implementation is as follows:

[0053] Will ​ - ​ The plasmid was transformed into Agrobacterium tumefaciens strain GV3101. Monoclonal plaques were picked with a sterilized pipette tip in a clean bench and placed in 5 mL of liquid culture medium. The culture was shaken at 200 rpm at 28°C for 10-16 h. The cells were collected by centrifugation at 3000 x g for 5 min at room temperature. The prepared MES resuspension solution (200 mM acetosyringone was added and diluted 1:1000) was added to gently resuspend the cell pellet. The culture was allowed to stand at room temperature for 1-3 h, and the OD value of the culture solution was measured. 600 Value and dilute to prepare OD 600 = 0.3 of the target bacterial solution, and selected the middle leaf of Nicotiana benthamiana leaves that were about 5 weeks old. Use a 1 mL syringe to inject the target bacterial solution on the back of the leaf surface, and perform subsequent experiments after 24 hours of expression.

[0054] Then take the expression ​ - ​ After 24 hours, the Nicotiana benthamiana leaves were washed to remove impurities on the leaf surface and excess water was absorbed with filter paper. The petioles were wrapped with moistened absorbent cotton and placed in a white plastic tray covered with wet filter paper. About 1,000 zoospores of Phytophthora infestans were inoculated on the back of the leaves. The plastic tray was covered with plastic wrap and placed in a 16°C incubator in the dark for about 5-6 days. The lesions were photographed and measured for data analysis.

[0055] The results showed that Agrobacterium-mediated transient expression combined with detached leaf inoculation demonstrated the S-adenosyl-L-methionine-dependent methyltransferase ​ Genes that reduce plant resistance to late blight.

[0056] Example 3

[0057] This embodiment describes ​ Transient gene silencing and disease resistance identification in Nicotiana benthamiana.

[0058] Through sequence alignment (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and specificity analysis, it was found that ​ A gene fragment with high sequence specificity (nucleotide sequence as shown in SEQ ID NO: 3) is constructed based on this specific gene fragment. ​ Gene silencing vectors. ​ The construction process of the gene silencing vector is described in Example 1. ​ Gene-specific primers amplified the representative ​The specific silencing fragment of the gene, namely SEQ ID NO: 3, was connected with the TRV vector and transformed into Escherichia coli DH5α competent cells. A positive single clone was detected and streaked into liquid LB medium. The single clone was cultured at 37°C and 220 rpm overnight. The plasmid was extracted using a plasmid extraction kit and named ​ - ​ (abbreviated as ​ - ​ ), the nucleotide sequence obtained by sequencing is shown in SEQ ID NO: 3. ​ Gene gel electrophoresis gel ​ shown.

[0059] ​ The gene-specific primer sequences are as follows:

[0060] ​ Xba1F:GCTCTAGAATGGAGAGAGTCAGAAAACTG;

[0061] ​ BamH1: CGGGATCCAGGAGTAGCAATCTTGATGAAAC.

[0062] The correct sequencing ​ - ​ Transform the plasmid into Agrobacterium tumefaciens GV3101. In a clean bench, pick a bacterial plaque with a sterile pipette tip and place it in 5 mL of liquid culture medium. Incubate the culture at 28°C, shaking at 200 rpm for 10-16 hours. Collect the cells by centrifugation at 3000 x g for 5 minutes at room temperature. Gently resuspend the cell pellet in prepared MES resuspension solution (with 200 mM acetosyringone, diluted 1:1000). Incubate the culture at room temperature for 1-3 hours. Measure the OD value of the culture solution. 600 Value and dilute to prepare OD 600 =0.3 target bacterial solution, select 2-week-old Nicotiana benthamiana for injection, and after two weeks of silence, ​ Indicator gene to determine the leaf position of Nicotiana benthamiana leaves, compared with the control ​ Leaves from the same leaf position were inoculated with zoospores of Phytophthora infestans in vitro and placed in a dark incubator at 16°C for approximately 5–6 days. The leaves under different treatments were then photographed, and the diameter of the leaf lesions was measured using a vernier caliper for data analysis.

[0063] Depend on ​ Knowing, silence ​ After gene, compared with control ​ Compared with the control, the lesion area is significantly smaller than that of the control, indicating that the silent ​ It can significantly inhibit the infection of Phytophthora infestans.

[0064] Example 4

[0065] This embodiment provides ​ Preparation and identification of genetically modified potato plants.

[0066] ​ Preparation of genetically modified potato plants:

[0067] First, remove the plasmid-containing Agrobacterium strain GV3101 from a -80°C freezer and streak onto LB plates containing spectinomycin (Spec), gentamicin (Gen), and rifampicin (Rif) resistance. Next, pick a colony from the plate and inoculate it into 5 mL of liquid LB containing Spec, Gen, and Rif. Incubate overnight at 28°C on a horizontal shaker at 200 rpm / min. When the OD value of the culture reaches 0.5, collect the culture and centrifuge it at 2500 x g for 10 minutes. Then, add an equal volume of LB to the original culture to resuspend the cells to obtain the bacterial transformation solution. 24 hours before Agrobacterium activation, cut 2-5 mm potato stem segments with a scalpel as explants. These explants were transferred to kin medium (MS solid medium with 1 mg / L kinetin) for pre-incubation (pre-incubation conditions were 23°C with 3000 lux illumination for 16 h, followed by 8 h in the dark at 16°C). After pre-incubation, the explants were transferred to bacterial transformation solution and soaked for 5–10 min before being blotted dry with sterile filter paper. The explants were then placed back onto fresh R3B medium (MS solid medium with 2.0 mg / L naphthaleneacetic acid auxin and 1.0 mg / L 6-benzylaminopurine cytokinin) and sealed with Parafilm to initially induce callus formation. After 48 h of incubation in the dark, the explants were transferred to Zcvk medium (MS solid medium with 100 mg / L kanamycin, 200 mg / L cytosine, 200 mg / L vancomycin hydrochloride, and 1.0 mg / L trans-zeatin) to induce callus and shoot differentiation. After half a month of culture, the Zcvk medium was replaced until transgenic plants were obtained ( ​ Once buds emerge, they are transferred to MS30 medium (MS powder 4.43 g / L + sucrose 30 g / L + agar 8 g / L) containing kanamycin resistance for screening and identification.

[0068] ​ Identification of genetically modified potato plants:

[0069] (1) PCR detection of transgenic plants

[0070] Take 0.2 g of leaf tissue from the potato plant to be transformed. Grind the leaf tissue under liquid nitrogen until it is a fine powder. Using a clean spatula, transfer the ground leaf powder to a 2 mL centrifuge tube. Add 800 μL of preheated CTAB buffer (preheated to the desired temperature) to the centrifuge tube. Mix gently and place the centrifuge tube in a 65°C water bath for 30–40 minutes, gently shaking the tube occasionally to promote mixing. After the sample cools to room temperature, add approximately 640 μL of Tris-saturated phenol (pH 8.0, containing 1% 2-mercaptoethanol). Invert the centrifuge tube to mix thoroughly and let it stand at room temperature for 10 minutes. Add 160 μL of chloroform, mix thoroughly again, and place the centrifuge tube on ice for 5 minutes. Centrifuge at 12,000 x g at 4°C for 15 minutes. Carefully transfer the supernatant to a new centrifuge tube (approximately 1 mL). Add 640 μL of isopropanol to the centrifuge tube containing the supernatant, mix gently, and place the tube at -20°C to precipitate the DNA for at least 1 hour. Then, centrifuge at 12,000 × g for 15 minutes at room temperature to recover the DNA precipitate. Wash the DNA precipitate with 80% ethanol and centrifuge again at 12,000 × g for 5 minutes. Discard the supernatant and briefly centrifuge again for 10 seconds. Carefully remove any remaining liquid with a pipette. Dry the tube in a laminar flow hood for approximately 2 minutes. Dissolve the dried DNA in 20 μL of ddH2O. PCR amplification was performed using 1 μL of the DNA solution as a template using specific primers synthesized by Beijing Aoke Company. The PCR reaction program was as follows: 94°C pre-denaturation for 8 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 52°C for 25 seconds, and extension at 72°C for 30 seconds. The PCR reaction system consisted of 1 μL of 0.5 μg / μL DNA template, 2.5 μL of 10× EasyTaq buffer, 0.5 μL of each primer, 2 μL of 2.5 mmol / L dNTPs, and 0.2 μL of EasyTaq DNA polymerase. The total volume was adjusted to 25 μL with ddH2O. The expected amplified fragment size was approximately 795 bp. An untransformed Atlantic plant was used as a negative control ( ​ Middle b).

[0071] Primer sequences:

[0072] pKAN-F: CAATCCCACTATCCTTCGCA;

[0073] ​ xba1R: GCTCTAGATCAATCCAAATTTCCAACTTTTCC.

[0074] (2) qRT-PCR detection of transgenic plants

[0075] Plant total RNA extraction was carried out in accordance with the instructions of the Plant RNA Kit and the reverse transcription kit (PrimeScript TM Reverse transcription was performed according to the instructions of FastStart Universal SYBR Green Master (ROX) (Cat. No. 04913914001). Reaction and detection were performed on a Q5 real-time quantitative PCR instrument produced by Life Technologies using a 25 μL system ( ​ Middle c).

[0076] Primer sequences:

[0077] ​ qPCR F: AGTCAAGTGTAGATTTGGTAAC;

[0078] ​ qPCR R:CAAATATTGCATCTACTGAGCT.

[0079] Depend on ​ As can be seen from a, the conversion ​ There was no significant difference in growth phenotype between potato transformants with the gene and non-transformed potatoes; ​ From b, we can see that ​ The transformed strain is a positive transformed strain; ​ From c, we can see that ​ Transformed strains ​ Upregulated gene expression.

[0080] Example 5

[0081] This embodiment describes the ​ Inoculation experiments on transgenic potatoes.

[0082] Two-month-old potato leaves were washed to remove surface impurities and excess moisture was absorbed with filter paper. The petioles were then wrapped with moistened cotton wool and placed in a white plastic tray lined with moist filter paper. Approximately 1,000 zoospores of Phytophthora infestans were inoculated on the underside of the leaves. The tray was covered with plastic wrap and incubated in a dark room at 16°C for approximately 3-4 days. The leaves under the different treatments were then photographed, and the diameter of the leaf lesions was measured with a vernier caliper for data analysis.

[0083] ​ Transgenic potato detached leaf inoculation demonstrated the expression of S-adenosyl-L-methionine-dependent methyltransferase genes​ Reducing plant resistance to late blight ( Figure 6 ), Figure 6 in GFP-StSAM-MT-OE-2 Abbreviated as OE-2 .

[0084] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but rather represents selected embodiments of the present invention. All other embodiments obtained without creative effort and through deduction and substitution by a person of ordinary skill in the art based on the concepts of the present invention are within the scope of protection of the present invention.

Claims

1. The nucleotide sequence is shown in SEQ ID NO: 3 NbSAM-MT Specific gene fragments in enhancing the resistance of Nicotiana benthamiana to Phytophthora infestans Phytophthora infestans Application in resistance.

Images