A pathogenicity-related Sclerotinia sclerotiorum gene, SsVSP19, and its application.

Abstract

This invention relates to the field of microbial genetic engineering technology, specifically to the pathogenicity-controlling gene SsVSP19 from *Sclerotinia sclerotiorum*. The DNA sequence of SsVSP19, as shown in SEQ ID No:1, consists of 1298 nucleotides. The protein encoded by the SsVSP19 gene has an amino acid sequence as shown in SEQ ID No:2, consisting of 332 amino acids. The SsVSP19 gene can be applied in the field of plant resistance to *Sclerotinia sclerotiorum* genetic engineering. Knocking out the pathogenicity-controlling gene SsVSP19 in *Sclerotinia sclerotiorum*, thus defecting its pathogenicity, can be used to reduce the pathogenicity of *Sclerotinia sclerotiorum*.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering technology, specifically relating to the application of genes and their encoded proteins for controlling fungal pathogenicity in the field of plant protection. Background Technology

[0002] *Sclerotinia sclerotiorum* (Lib.) de Bary is a fungus belonging to the Ascomycota phylum and is a global plant pathogen, a typical necrotrophic plant pathogen. *Sclerotinia sclerotiorum* is highly destructive, with a wide host range, infecting important economic crops such as soybean, rapeseed, and sunflower, causing sclerotinia rot. This disease is a major global disease, characterized by its high prevalence, wide distribution, and severe damage. Soybean sclerotinia rot is the main disease affecting its development, typically resulting in yield reductions of 20%-30%, and in severely affected areas, yield reductions can exceed 50%. Especially with climate change and adjustments in planting structures, the occurrence and damage of soybean sclerotinia rot have intensified. In the life cycle of *Sclerotinia sclerotiorum*, the sclerotium, apothecia, and infection mat are the most important fruiting bodies, and their development determines the occurrence, prevalence, and severity of sclerotinia rot.

[0003] Sclerotinia sclerotiorum infection of plants can be divided into two stages. In the first stage, the hyphae come into contact with the plant epidermis, and the hyphal tips differentiate to form infection pads, which then form infection nails. These nails penetrate the cuticle of the host epidermis by generating mechanical pressure and secreting cutinases, subsequently forming bulb-like subcutaneous hyphae. In the second stage, the subcutaneous hyphae expand continuously under the plant cuticle, and then differentiate to form subcutaneous infection hyphae. These infection hyphae kill host cells by secreting oxalic acid, toxins, cell wall degrading enzymes, effector proteins, and some toxicity-related secreted proteins, causing plant tissue necrosis and ultimately leading to the death of the host plant.

[0004] For many years, due to limited genetic resources available for crop breeding projects, chemical fungicides have been widely used as the primary tool for controlling Sclerotinia sclerotiorum. However, long-term use of chemical fungicides not only leads to pollution of the agricultural ecological environment and disruption of ecological balance, but also results in the development of fungicide resistance in Sclerotinia sclerotiorum and the presence of chemical residues in stored products. Therefore, exploring the growth, development, and pathogenic mechanisms of Sclerotinia sclerotiorum at the molecular level can provide new directions for the prevention and control of Sclerotinia sclerotiorum disease.

[0005] *Sclerotium sclerotiorum* has long been considered a necrotrophic fungus, but increasing research suggests it is actually a hemitrophic fungus. During its brief biotrophic phase, *Sclerotium sclerotiorum* suppresses plant immunity and promotes infection by secreting effector proteins. Nearly one hundred candidate effector proteins are predicted to exist in *Sclerotium sclerotiorum*. These effector proteins play a crucial role in the pathogenicity of *Sclerotium sclerotiorum*, and identifying the targets of these effector proteins in plants will help understand the interaction mechanisms between plants and *Sclerotium sclerotiorum*, facilitating the breeding of resistant varieties. Summary of the Invention

[0006] The purpose of this invention is to provide a gene that controls pathogenicity and the protein it encodes. The secretory protein SsVsp19 involved in this invention does not affect the vegetative growth and sclerotium formation of Sclerotium sclerotiorum, nor does it affect the formation of the infection pad, but it positively regulates the pathogenicity of Sclerotium sclerotiorum.

[0007] The pathogenicity control gene provided by this invention is derived from *Sclerotinia sclerotiorum* and is named *Sclerotinia sclerotiorum* virulence secretory protein 19 (SsVsp19). Its ID number in the *Sclerotinia sclerotiorum* reference genome is Ss_cle05g042460, and it has the DNA sequence shown in SEQ ID No:1 in the sequence listing. This gene consists of 1298 nucleotides, containing 5 exons located between nucleotides 1 to 217, 271 to 338, 395 to 593, 672 to 1114, and 1227 to 1297 at the 5' end of SEQ ID No:1, respectively. The total length of the coding region is 999 nucleotides.

[0008] The present invention provides a protein encoded by the SsVSP19 gene, which has the amino acid sequence shown in SEQ ID No:2 in the sequence listing, which consists of 332 amino acids.

[0009] The pathogenicity control gene SsVSP19 from Sclerotinia sclerotiorum can be applied to the field of genetic engineering for plant resistance to Sclerotinia sclerotiorum.

[0010] The pathogenicity control gene SsVSP19 from Sclerotinia sclerotiorum can be knocked out to render it defective, which can be used to reduce the pathogenicity of Sclerotinia sclerotiorum.

[0011] This invention demonstrates that the deletion of the SsVSP19 gene leads to a significant reduction in the pathogenicity of *Sclerotinia sclerotiorum*, indicating that the SsVSP19 gene is required for *Sclerotinia sclerotiorum* to cause sclerotinia disease in crops. Therefore, clarifying its gene function and its interaction mechanism with the host can effectively control the occurrence of sclerotinia disease. One important application of the SsVSP19 gene provided by this invention is that the expression of this gene and the expression, modification, and localization of its encoded protein product can serve as important candidate target sites for reducing the pathogenicity of *Sclerotinia sclerotiorum*. Attached Figure Description

[0012] Figure 1 This is a schematic diagram of the knockout strategy for the SsVSP19 gene in Sclerotium sclerotiorum (gene replacement via homologous recombination).

[0013] Wherein: HYG is the hygromycin resistance gene, SsVSP19-LB / SsVSP1919-RB are the upstream and downstream fragments of the SsVSP19 gene, respectively; primers SsVSP19-FP1 / RP1, SsVSP19-FP2 / RP2, M13R / NLC38, and M13F / NLC37 are used to verify the mutant;

[0014] Figure 2 Electrophoresis diagram for PCR verification of the SsVSP19 gene deletion mutant strain;

[0015] Among them, SsVSP19-FP1 / RP1, SsVSP19-FP2 / RP2, M13R / NLC38, and M13F / NLC37 are the primers used, and their corresponding positions are shown in [link to primer list]. Figure 2 ΔSsvsp19-4 and ΔSsvsp19-5 are two independently obtained SsVSP19 gene deletion mutants, and WT is the wild-type strain UF-1.

[0016] Figure 3 Electrophoresis image for PCR verification of the SsVSP19 gene complement strain;

[0017] Figure 4 A graph showing the relative expression levels of the SsVSP19 gene deletion mutant, the SsVSP19 gene complemented strain, and the wild-type strain UF-1, verified by real-time quantitative PCR (qRT-PCR).

[0018] Figure 5 Comparative photographs of the culture characteristics of the SsVSP19 gene deletion mutant, the SsVSP19 gene complemented strain, and the wild-type strain UF-1.

[0019] The culture medium used was PDA, and the culture was carried out at 25℃. The inoculation was observed and photographed at 12h, 36h, 48h and 14d respectively. WT is the wild-type strain UF-1 of Sclerotinia sclerotiorum, and ΔSsvsp19-4 and ΔSsvsp19-5 are two independently obtained SsVSP19 gene deletion mutants.

[0020] Figure 6 A graph showing the quantitative analysis of colony size formed by SsVSP19 gene deletion mutants, SsVSP19 gene complemented strains, and wild-type strain UF-1.

[0021] Wherein: the tested strains and culture conditions were the same as above, and the colony diameter was measured at the same time as above, converted to relative size. ** indicates that the difference was significant at the p<0.01 level.

[0022] Figure 7A chart showing the quantitative analysis of sclerotium dry weight formed by SsVSP19 gene deletion mutants, SsVSP19 gene complemented strains, and wild-type strain UF-1.

[0023] Figure 8 Comparative photographs of the infection pads of the SsVSP19 gene deletion mutant, the SsVSP19 gene complement strain, and the wild-type strain.

[0024] The process involved inoculating the mycelial cake (mycelial side down) onto a glass slide, placing it in a humidified chamber, and incubating it in the dark at 25°C. The infected pad was photographed at 6h, 12h, 24h, and 48h.

[0025] Figure 9 Charts showing the quantitative analysis of the infection pad grayscale of SsVSP19 gene deletion mutants, SsVSP19 gene complemented strains, and wild-type strains.

[0026] Among them: the cultivation method is the same as above, and the time point for quantitative analysis of gray scale of the contaminated pad is the same as above;

[0027] Figure 10 Photographs comparing the pathogenicity of SsVSP19 gene deletion mutants, SsVSP19 gene complemented strains, and wild-type strains.

[0028] Among them, the selected hosts were Arabidopsis thaliana, soybean William 82 (W82), soybean Ji soybean No. 1, and soybean oil. The method of inoculating the mycelium cake with detached leaves was adopted, and the evaluation was carried out at multiple time points after inoculation. WT is the wild-type strain of Sclerotinia sclerotiorum UF-1, and ΔSsvsp19-4 and ΔSsvsp19-5 are two independently obtained SsVSP19 gene deletion mutants.

[0029] Figure 11 Quantitative analysis of the size of lesions produced by mutant and control strains of the SsVSP19 gene infecting the host.

[0030] The tested strains and inoculation methods were the same as above. After inoculation, the leaf lesion area was measured and calculated at multiple time points to compare the pathogenicity of each strain. *** indicates a significant difference at the p<0.001 level. Detailed Implementation

[0031] The present invention will now be described with reference to the accompanying drawings. Unless otherwise specified, the methods in the following embodiments are conventional methods.

[0032] Example 1: Knockout of the SsVSP19 gene

[0033] 1) Homologous recombination of the target gene

[0034] by

[0035] Using Sclerotinia sclerotiorum UF-1 genomic DNA as a template, 800-1000 bp fragments upstream and downstream of the gene were amplified separately for SsVsp19-FP1(5'-CTTACACCGAATCGCTGAAG-3'), SsVSP19-RP1(5'-TCCTGTGTGAAATTGTTATCCGCTT GTTGGAACCGAAACCTCA-3'), SsVSP19-FP2(5'-GTCGTGACTGGGAAAACCCTGGCGGTTATGTGAGGGAGGCGG A-3'), and SsVSP19-RP2(5'-GGACACGGGTAGATATGTGATG-3'. The resistance gene hygromycin (HYG) was then fused using the Split-marker technique and were to be transferred into the protoplasts of Sclerotinia sclerotiorum UF-1.

[0036] Perform PCR detection according to the reactions in Table 1 and the procedures in Table 2:

[0037]

[0038]

[0039] The UF-1 sclerotium used in this invention was kindly provided by Professor Jeffrey A. Rollins of the University of Florida.

[0040] 2) Transformation of Sclerotinia sclerotiorum

[0041] a. Preparation of Sclerotium protoplasts

[0042] Use an inoculation needle to pick up wild-type Sclerotinia sclerotiorum (UF-1) stored at 4℃ and place it on PDA solid medium. Activate and culture at 25℃ for 1-2 days. Use a sterile punch to take an appropriate number of mycelial discs with fresh outer hyphae and inoculate them into YPSU liquid medium. Culture at 25℃ for 2-3 days. Remove the agar blocks from the white mycelial film. Wash the mycelial film 2-3 times with sterile water and once with 0.7M NaCl solution. Use sterile scissors to cut the washed mycelial film into small pieces in a sterilized petri dish. Transfer the mixture to an Erlenmeyer flask containing enzymatic hydrolysate (Driselase-disintegrating enzyme 0.2g, cellulase 0.2g, dissolved in 20mL 0.7M NaCl solution, thoroughly mixed with a magnetic stirrer, centrifuged at 7000rpm for 5min at room temperature, and filtered through a 45μm filter). Incubate at 25℃, 100rpm, in the dark for 2-3 hours.

[0043] Filter the lysate using a cell sieve, add an equal volume of pre-cooled 0.7M NaCl solution, centrifuge at 3000 rpm for 5 min at 4°C, discard the supernatant, resuspend thoroughly in 10 mL of STC, centrifuge at 3000 rpm for 5 min, discard the supernatant, and repeat this step once. Add an appropriate amount of STC to resuspend, making the protoplast concentration approximately 1 × 10⁻⁶. 8 Take a small amount of the resuspension, dilute it tenfold, and observe the protoplast concentration under a microscope.

[0044] b. PEG3350-Cacl2-mediated genetic transformation of Sclerotinia sclerotiorum protoplasts

[0045] Add 15 μL each of the left and right homologous fragments and 5 μL of heparin sodium to the prepared protoplasts, and incubate on ice in the dark for 20 min. Add 200 μL of PEG, mix well by pipetting, and incubate on ice for 10 min. Repeat once. Then add 800 μL of PEG, mix well by pipetting, and incubate at 25°C for about 20 min.

[0046] c. Screening of Sclerotium sclerotiorum transformants

[0047] Add the mixture to the lower solid medium of RM (59.9g sucrose, 0.25g hydrolyzed casein, 3.75g agar, 0.25g yeast extract), and incubate in the dark at 25℃ for 12-16 hours. Then cover with 10mL of upper RM medium containing 60uL hygromycin 50mg / mL (34.2g sucrose, 0.1g hydrolyzed casein, 1g agar, 0.1g yeast extract) and incubate at 25℃ for 5-8 days. At this time, single mycelia can be observed emerging from the surface of the medium.

[0048] Single hyphal tips were inoculated onto PDA solid plates containing HYG resistance. After 1 day, hyphal tips were picked again for screening. This step was repeated 4-6 times to obtain transformants. The obtained transformants were inoculated onto hygromycin PDA plates covered with cellophane. After the hyphae had fully grown on the medium, the transformant hyphae were harvested, and DNA was extracted for verification.

[0049] 3) Validation of deletion mutants

[0050] Transformants were screened by PCR amplification using four primer pairs. Transformants with the following amplification results were identified as SsVsp19 gene deletion mutants: primer NLC37 (5'-GGATGCCTCCGCTCGAAGTA-3') for the hygromycin resistance gene, paired with primer UF1 (5'-GGACGAGGAAGTTCAACAGA-3') located outside the upstream homologous arm, amplified the expected recombinant fragment (2.7kb) (no amplification band in wild-type strains); primer NLC38 (5'-CGTTGCAAGACCTGCCTGAA-3') for the hygromycin resistance gene, paired with primer DR1 (5'-GGCACTCCCCTCGCATACCG-3') located outside the downstream homologous arm, amplified the expected recombinant fragment (2.8kb) (no amplification band in wild-type strains); primer M13F (CGCCAGGGTTTTCCCAGTCACGAC) and...

[0051] M13R (AGCGGATAACAATTTCACACAGGA) could amplify to a 2.7kb fragment (no amplification band in wild-type strains); while primers F (5'-ATGGTCTCGTCGCTTCCTGC-3') and R (5'-TCACTCACATAACACTGTA-3') within the coding region showed no amplification bands (wild-type strains could amplify to a 1kb fragment). RNA was extracted from the knockout mutant and UF-1 strain, reverse transcribed, and the resulting cDNA was used to detect the expression level of SsVsp19 using real-time quantitative PCR. After a series of validations, two independent SsVSP19 gene deletion mutants, ΔSsvsp19-4 and ΔSsvsp19-5, were obtained for subsequent functional analysis (see [link to relevant documentation]). Figure 3 ).

[0052] Example 2: The role of the SsVSP19 gene in the mycelial growth of Sclerotinia sclerotiorum.

[0053] The plate culture method was used to evaluate the variation in mycelial growth and related phenotypes of the SsVSP19 mutant. Mycelial discs of the test strains were collected using a sterile punch and inoculated into the center of PDA medium, and incubated in the dark at 25°C. Observations at 12h, 36h, 48h, 7d, and 14d revealed no significant differences in colony morphology, mycelial growth rate, or sclerotium morphology among the mutants (see...). Figure 4 The above results indicate that the SsVSP19 gene does not affect hyphal growth and development or sclerotium formation.

[0054] Example 3: The role of the SsVSP19 gene in the formation of Sclerotinia sclerotiorum infection pads

[0055] The variation in infection pad formation of the SsVSP19 mutant was evaluated using a humidified dark incubation method. A suitable amount of mycelial cake was punched using a sterile puncher and inoculated onto a hydrophobic glass slide (mycelial side down). The slide was then placed in a humidified chamber and incubated in the dark at 25°C. Gray-scale analysis of the infection pads was performed at 6h, 12h, 24h, and 48h. The results showed that the infection pad formation and morphology of the SsVSP19 mutant strain were not significantly different from those of the wild-type *Sclerotinia sclerotiorum*.

[0056] Example 4: The role of the SsVSP19 gene in the pathogenicity of Sclerotinia sclerotiorum.

[0057] The pathogenicity of the SsVSP19 mutant was evaluated using an in vitro leaf inoculation method. Fresh, uniformly grown leaves were placed in black seedling trays, and mycelial cakes of the test strain were punched out using a puncher. The cakes were then inoculated face down onto leaves of Arabidopsis thaliana, soybean variety William 82 (W82), soybean variety Jida Soybean No. 1, and soybean oleander. The trays were sprayed with water to maintain humidity, and covered with a humidity-controlled lid to keep the inoculation environment at a humidity greater than 75%. Disease incidence was evaluated in Arabidopsis thaliana after 24 hours, and in soybean and soybean oleander after 48 hours. Lesion area was calculated using ImageJ, and three biological replicates were performed. The results showed that the lesion area of ​​the SsVSP19 mutant on different hosts was significantly smaller than that of UF-1 (see [link to experimental data]). Figure 6 The results of this study indicate that SsVSP19 is a key pathogenic gene, essential for Sclerotinia sclerotiorum to infect its host. If this gene or its encoded protein loses its activity, the ability of Sclerotinia sclerotiorum to infect its host and cause disease will be greatly suppressed.

Claims

1. The application of the SsVSP19 gene in reducing the pathogenicity of Sclerotinia sclerotiorum, characterized in that, Specifically, the pathogenicity of Sclerotinia sclerotiorum to different hosts is reduced by knocking out the SsVSP19 gene, the DNA sequence of which is shown in SEQ ID No:1.

Images