Construction method and application of traced endogenous FGFR2 + cell lineage fate mouse model

Abstract

The invention provides a method for tracing an endogenous FGFR2 < + > cell lineage fate mouse model (FGFR2-EGFP-CreERT2; the invention relates to a construction method of an endogenous FGFR2 (Fibroblast Growth Factor Receptor 2) gene, in particular to a construction method of an endogenous FGFR2 (Fibroblast Growth Factor Receptor 2) gene (ROSA26-LSL-tdTomato mouse), an EGFP-Linker-CreERT2 expression sequence is inserted through an ES (Expression Spectroscopy) targeting method, the expression of the EGFP-Linker-CreERT2 under the control of an endogenous FGFR2 promoter is realized, and an FGFR2 positive (FGFR2 +) cell is marked in real time through a fluorescent protein EGFP. Then CreERT2 expression is combined with a fluorescence report mouse (such as ROSA26-LSL-tdTomato) based on a Cre / loxP system, after fluorescent protein tdTomato expression is induced, the FGFR2 + cells can be permanently marked, and pedigree tracing of the FGFR2 + cells is defined by observing distribution of tdTomato positive cells. The mouse model provides an important tool for in-vivo research on distribution and pedigree tracing of FGFR2 + cells, and provides a new support for research on tumor generation, organ development and tissue regeneration related to FGFR2.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and in particular relates to a construction method and application of a mouse model for tracing endogenous FGFR2+ cell lineage fate. Background Art

[0002] Fibroblast growth factors and their receptors (FGFs / FGFRs) are important signal regulatory molecules in the body, and are widely involved in organ development and pathological processes. FGFR2 is one of the important receptors for FGF. Extracellular FGF signaling molecules (FGF2, FGF7, FGF10, etc.) bind to FGFR2 with tyrosine kinase activity, causing FGFR2 to dimerize, which then activates a series of intracellular signaling molecules to phosphorylate and transmit the signal into the cell. FGFR2 is mainly located on the cell membrane, containing an extracellular region, a transmembrane region, and an intracellular kinase region. It is reported that high-frequency single nucleotide variations (SNVs) in FGFR2 can cause endometrial cancer, non-small cell carcinoma (4%), and gastric cancer. These somatic activation FGFR2 mutations mainly occur in the transmembrane (Y375C, C382Y / R) and extracellular domain (S252W, W290C, P253R) regions of FGFR2, rather than the kinase domain (N549H / K, K659E). The oncogenic potential of FGFR2 mutations is due to increased receptor-ligand binding affinity and receptor dimerization. FGFR2 has also been shown to fuse with proteins AFF3, CASP7, and CCDC6, thereby abnormally activating FGFR2 and leading to the occurrence of triple-negative breast cancer. Increased copy number of the FGFR2 gene is also associated with gastric cancer and breast cancer. In addition, in skeletal development, FGFR2 gain-of-function mutations (Ser252Trp, Pro253Arg) cause premature fontanelle syndromes such as Apert, Crouzon, and Pfeiffer, showing symptoms such as skull deformity, widened eye distance, brain abnormalities, mental retardation, and short limbs. Loss-of-function mutations in the FGFR2 transmembrane region cause BBD (Bent Bone Dysplasia) syndrome, in which patients exhibit symptoms such as long bone curvature, craniofacial deformities, and craniosynostosis.

[0003] Tracing the cell migration and lineage fate of FGFR2+ cells is very important for analyzing the cellular mechanisms of these physiological and pathological processes. To trace the fate of FGFR2+ cells, it is necessary to permanently mark the FGFR2+ cells in the body. Currently commonly used in situ hybridization, immunohistochemistry (immunofluorescence) and other techniques can only be performed in ex vivo samples and cannot achieve the purpose of in vivo tracing. Transgenic mice expressing fluorescent proteins controlled by the FGFR2 promoter can mark FGFR2+ cells in vivo, but this type of mouse only marks cells that express FGFR2 in real time, and cannot mark cells that have expressed FGFR2, so the purpose of tracing the fate of FGFR2+ cells cannot be achieved. At present, there is still a lack of mouse models that can be used to trace the lineage fate of FGFR2+ cells in vivo. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention proposes a method for constructing a mouse model for tracing the fate of endogenous FGFR2+ cell lineages and its application.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] A method for constructing a mouse model for tracing endogenous FGFR2+ cell lineage fate comprises the following steps:

[0007] S1. Amplify the mouse FGFR2 gene fragment, insert the reporter gene sequence and site-specific recombinase system into the targeting vector, and then insert the amplified gene fragment into the targeting vector to obtain a complete targeting vector;

[0008] S2. Introduce the complete targeting vector prepared in S1 into ES cells, and screen to obtain homologous recombination-positive ES cells;

[0009] S3. Inject the positive ES cells into blastocysts, transplant the blastocysts into the uterus of pseudo-pregnant female mice, and give birth to obtain chimeric mice;

[0010] S4. The chimeric male mice are mated with pure strain mice to obtain ES cell-derived mice;

[0011] S5. Breed ES cell-derived mice with fluorescent reporter mice of different colors to obtain double-gene modified mice.

[0012] Furthermore, the reporter gene sequence and the site-specific recombinase gene sequence in step S1 can be inserted at the start codon of the coding region of the endogenous FGFR2 gene, or at the stop codon of the coding region.

[0013] Furthermore, the reporter gene sequence and the site-specific recombinase gene sequence in step S1 are connected in series.

[0014] Furthermore, the expression product of the reporter gene in step S1 includes a fluorescent protein, or a luciferase, or a β-galactosidase LacZ, the fluorescent protein is one of green fluorescent protein GFP, enhanced green fluorescent protein EGFP, red fluorescent protein RFP, yellow-green fluorescent protein YFP, and blue fluorescent protein BFP, and the luciferase includes one of Renilla luciferase Rluc and firefly luciferase Luc.

[0015] Furthermore, in step S1, the site-specific recombinase system is a Cre / loxP system, or a Flp / FRT system, or a Dre / Rox system.

[0016] Furthermore, the reporter gene sequence and the site-specific recombinase system in step S1 are connected by a self-cleaving peptide, or an IRES connection, or a connecting peptide connection; the self-cleaving peptide is one of P2A, T2A, and F2A, and the connecting peptide is one of a flexible connecting peptide and a rigid connecting peptide.

[0017] Furthermore, FGFR2 includes FGFR2-IIIb and FGFR2-IIIc, wherein the amino acid sequence of FGFR2-IIIb is shown in SEQ ID NO.1, and the amino acid sequence of FGFR2-IIIc is shown in SEQ ID NO.2.

[0018] Furthermore, the gene sequence encoding the FGFR2 protein is shown in SEQ ID NO.14.

[0019] The application of double-gene modified mice constructed according to the above construction method in tracing the fate of endogenous FGFR2-positive cell lineages.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention relates to a construction method of a gene knock-in mouse (FGFR2-EGFP-CreERT2; ROSA26-LSL-tdTomato mouse) for tracing endogenous FGFR2+ cell lineage fate. First, at the start codon (ATG) of the mouse FGFR2 gene coding region, an EGFP-Linker-CreERT2 expression sequence is inserted through ES targeting to achieve EGFP-Linker-CreERT2 expression under the control of the endogenous FGFR2 promoter, and FGFR2+ cells are marked in real time by the fluorescent protein EGFP. In addition, CreERT2 expression is combined with a fluorescent reporter mouse (such as ROSA26-LSL-tdTomato) based on the Cre / loxP system, and tamoxifen (TM) is injected at a specific time point to induce the expression of the fluorescent protein tdTomato, and the FGFR2+ cells are permanently marked. In the future, the lineage tracing of FGFR2+ cells is clarified by observing the distribution of tdTomato-positive cells. In addition, the co-expression of EGFP and tdTomato fluorescence can be used to identify which cells have previously expressed FGFR2 (tdTomato+) and which cells are currently expressing FGFR2 (GFP+). This mouse model will provide an important tool for studying the distribution and lineage tracing of FGFR2+ cells in vivo, and provide new support for FGFR2-related tumorigenesis, organ development, and tissue regeneration research. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the specific implementation of the present invention, the following will briefly introduce the drawings required for use in the specific implementation. In all the drawings, each element or part is not necessarily drawn according to the actual scale.

[0023] Figure 1 The schematic diagram of the targeting vector for FGFR2 gene constructed in the present invention.

[0024] Figure 2 This is the result of enzyme digestion of the targeting vector in Example 1.

[0025] Figure 3 This is a schematic diagram of the targeting vector of Example 1.

[0026] Figure 4 This is the ES cell PCR identification result of Example 4.

[0027] Figure 5 This is the result of genotype identification of FGFR2-EGFP-CreERT2 mice in Example 6.

[0028] Figure 6This is a schematic diagram of the preparation of FGFR2-EGFP-CreERT2; ROSA26-LSL-tdTomato double-gene modified mice in Example 7.

[0029] Figure 7 This is the tdTomato fluorescence distribution of FGFR2-EGFP-CreERT2;ROSA26-LSL-tdTomato mice (5d) in Example 8.

[0030] Figure 8 This is the overall fluorescence distribution at 3 days and 20 days after the skull drilling surgery in Example 9 (the arrow indicates the defect site).

[0031] Fig. 9 This is the fluorescence distribution of the defect site 3 days after the skull drilling surgery in Example 9.

[0032] Fig.10 This is the fluorescence distribution of the defect site 20 days after the skull drilling surgery in Example 9. DETAILED DESCRIPTION

[0033] Source of reagents:

[0034] PCR kit (Dalian Baosheng Biotechnology Co., Ltd., China); 10% SDS (Shanghai Biotechnology Co., Ltd., China); proteinase K (Roche, USA); Tris-EDTA (pH 8.0) (Shanghai Biotechnology Co., Ltd., China); protease inhibitors (Roche, USA); EDTA powder (Shanghai Biotechnology Co., Ltd., China); paraformaldehyde (Shanghai Biotechnology Co., Ltd., China).

[0035] Mouse source:

[0036] ROSA26-LSL-tdTomato mice (Jax lab, USA)

[0037] Main instruments and equipment:

[0038] Small animal X-ray machine (FAXITRON, USA); small animal Micro CT (Scanco vivoCT40, Switzerland); PCR instrument (Bio-Rad, USA); Power PAC 300 electrophoresis instrument (Bio-Rad, USA); Gel Doc 2000 gel imager (Bio-Rad, USA); CKX41 dissecting microscope (Olympus, Japan); fluorescence microscope (Olympus, Japan); confocal microscope (Zeiss, Germany); -70℃ low temperature refrigerator (SANYO, Japan);

[0039] FGFR2 includes FGFR2-IIIb and FGFR2-IIIc;

[0040] The amino acid sequence of FGFR2-IIIb is as follows (NP_963895.2) (SEQ ID NO.1):

[0041] MGLPSTWRYGRGPGIGTVTMVSWGRFICLVLVTMATLSLARPSFSLVEDTTLEPEGAPYWTNTEKMEKRLHAVPAANTVKFRCPAGGNPTPTMRWLKNGKEFKQEHRIGGYKVRNQHWSLIMESVVPSDKGNYTCLVENEYGSINHTYHLDVVERSPHRPILQAGLPANASTVVGGDVEFVCKVYSDAQPHIQWIKHVEKNGSKYGPDGLPYLKVLKHSGINSSNAEVLALFNVTEMDAGEYICKVSNYIGQANQSAWLTVLPKQQAPVREKEITASPDYLEIAIYCIGVFLIACMVVTVIFCRMKTTTKKPDFSSQPAVHKLTKRIPLRRQVTVSAESSSSMNSNTPLVRITTRLSSTADTPMLAGVSEYELPEDPKWEFPRDKLTLGKPLGEGCFGQVVMAEAVGIDKDKPKEAVTVAVKMLKDDATEKDLSDLVSEMEMMKMIGKHKNIINLLGACTQDGPLYVIVEYASKGNLREYLRARRPPGMEYSYDINRVPEEQMTFKDLVSCTYQLARGMEYLASQKCIHRDLAARNVLVTENNVMKIADFGLARDINNIDYYKKTTNGRLPVKWMAPEALFDRVYTHQSDVWSFGVLMWEIFTLGGSPYPGIPVEELFKLLKEGHRMDKPTNCTNELYMMMRDCWHAVPSQRPTFKQLVEDLDRILTLTTNEEYLDLTQPLEQYSPSYPDTRSSCSSGDDSVFSPDPMPYEPCLPQYPHINGSVKT。

[0042] The amino acid sequence of FGFR2-IIIc is as follows (NP_963895.2) (SEQ ID NO.2):

[0043] MGLPSTWRYGRGPGIGTVTMVSWGRFICLVLVTMATLSLARPSFSLVEDTTLEPEEPPTKYQISQPEAYVVAPGESLELQCMLKDAAVISWTKDGVHLGPNNRTVLIGEYLQIKGATPRDSGLYACTAARTVDSETWYFMVNVTDAISSGDDEDDTDSSEDVVSENRSNQRAPYWTNTEKMEKRLHAVPAANTVKFRCPAGGNPTPTMRWLKNGKEFKQEHRIGGYKVRNQHWSLIMESVVPSDKGNYTCLVENEYGSINHTYHLDVVERSPHRPILQAGLPANASTVVGGDVEFVCKVYSDAQPHIQWIKHVEKNGSKYGPDGLPYLKVLKAAGVNTTDKEIEVLYIRNVTFEDAGEYTCLAGNSIGISFHSAWLTVLPAPVREKEITASPDYLEIAIYCIGVFLIACMVVTVIFCRMKTTTKKPDFSSQPAVHKLTKRIPLRRQVTVSAESSSSMNSNTPLVRITTRLSSTADTPMLAGVSEYELPEDPKWEFPRDKLTLGKPLGEGCFGQVVMAEAVGIDKDKPKEAVTVAVKMLKDDATEKDLSDLVSEMEMMKMIGKHKNIINLLGACTQDGPLYVIVEYASKGNLREYLRARRPPGMEYSYDINRVPEEQMTFKDLVSCTYQLARGMEYLASQKCIHRDLAARNVLVTENNVMKIADFGLARDINNIDYYKKTTNGRLPVKWMAPEALFDRVYTHQSDVWSFGVLMWEIFTLGGSPYPGIPVEELFKLLKEGHRMDKPTNCTNELYMMMRDCWHAVPSQRPTFKQLVEDLDRILTLTTNEEYLDLTQPLEQYSPSYPDTRSSCSSGDDSVFSPDPMPYEPCLPQYPHINGSVKT

[0044] The gene (ID: 14183) encoding the FGFR2 protein has the sequence shown in SEQ ID NO.14 (see attachment).

[0045] Example 1: Construction of the targeting vector and sequencing verification

[0046] Design and construct a targeting vector for the FGFR2 gene. For the principle, see Figure 1 .

[0047] Figure 1 The EGFP sequence (SEQ ID NO.3) in

[0048] is as follows:

[0049] Figure 1 The Linker sequence (SEQ ID NO.4) in

[0050] is as follows:

[0051] Figure 1 The CreERT2 sequence (SEQ ID NO.5) is as follows:

[0052]

[0053] Figure 1 The 5' homology arm sequence (SEQ ID NO.6) is as follows:

[0054]

[0055] Figure 1 The 3' homology arm sequence (SEQ ID NO.7) is as follows:

[0056]

[0057] Figure 1 The NEO sequence (SEQ ID NO.8) is as follows:

[0058]

[0059] Figure 1 The Rox sequence (SEQ ID NO.9) is as follows:

[0060] taactttaaataatgccaattatttaaagtta

[0061] The upstream and downstream DNA sequences of the start codon (ATG) of the mouse FGFR2 gene (Gene ID: 14183) were amplified from the BAC library by PCR as the 5' and 3' homology arm regions, and the amplified fragments were connected to the targeting vector. Then, the EGFP-Linker-CreERT2 expression sequence was inserted downstream of ATG according to the targeting vector diagram to obtain a complete targeting vector with a total length of 19.4kb.

[0062] The obtained targeting vector was digested and sequenced for verification. Figure 2 As shown, the enzyme digestion results are as follows Figure 3 As shown in the figure, it can be seen that the targeting vector was digested with AfIII / AhdI, AvaI, AgeI, HindIII, and SacI / ScaI, and all the expected bands were obtained. The vector plasmid was linearized with NotI endonuclease to obtain a linearized plasmid with a single band of about 19.4Kb in size. The size of the band obtained after digestion was consistent with the expected size. The vector sequence sequencing results were consistent with the expectations, and the vector was constructed correctly.

[0063] Example 2: Linearization of targeting vector plasmid and electroporation of ES cells

[0064] The targeting vector plasmid prepared in Example 1 was linearized by Not I digestion, and a single band of 19.4 kb was obtained by agarose electrophoresis, and the plasmid band was recovered. 0.8 ml of the prepared ES cell suspension was taken, and about 35 μg of the above-mentioned targeting vector plasmid was added, mixed and transferred to a sterile electroporation cup, and electroporated at 250 V and 500 μF for 10 ms. The ES cells were resuspended and cultured in a culture dish.

[0065] Example 3 ES cell drug screening

[0066] The plasmids prepared in Example 2 were electroporated and ES cells were selectively cultured in culture medium containing the drug G418 (300 mg / L) and Ganciclovoir (2 μmol / L). When the surviving resistant ES cells grew into visible clones, the resistant clones were picked and digested in 30 μl 0.1% trypsin-EDTA in a 96-well plate, pipetted, and then transferred to a 96-well culture plate for culture. After the cells were fully grown, the cells were frozen for later use, and part of the ES cell genomic DNA was extracted for PCR identification.

[0067] Example 4 PCR Identification of Homologous Recombination Positive ES Cell Clones

[0068] Take the resistant ES cells prepared in Example 3, design upstream and downstream primers on the homology arm sequence of ES cells and EGFP-Linker-CreERT2-polyA-rox-Neo-rox sequence, respectively. The primer sequences are F1 (SEQ ID NO.10): 5'-GTCCCAAG CGTCCCAAATCCCTGT-3'; R1 (SEQ ID NO.11): 5'-GGTGGTGCAGATGAACTTCAGGGT-3'. PCR was used to identify homologous recombination-positive ES cell clones. The reaction conditions were: 95°C, 5min; 94°C, 20s; 60°C, 30s; 72°C, 185s for 33 cycles, and 72°C for 10min. The size of the PCR positive band was 3.1kb. The PCR identification results of ES cells are as follows: Figure 4 As shown in the figure, it can be seen that ES cell clones such as 1B1, 1D2, 1E2, 1F3, 1C6, 1E6, 1A7, 1C10, 1E9, 1D11, 2F2, 2G3, 2H3, 2A6, 2H6, 2B8, 2C8, 2F9 and 2F10 amplified a specific 3.1kb band, indicating that these ES cells are successfully targeted cells.

[0069] Example 5 Blastocyst Injection and Embryo Transplantation of ES Cells

[0070] Blastocysts were collected from donor C57BL / 6J mice and cultured in vitro, and then the homologous recombination-positive ES cells prepared in Example 4 were injected into the blastocysts. After the injected blastocysts were cultured at 37° C. for 1 hour, they were transplanted into the uterus of a 2.5-day pseudopregnant female mouse. The pseudopregnant female mouse gave birth naturally to obtain chimeric mice.

[0071] Example 6 Mouse breeding and genotype PCR amplification identification

[0072] Chimeric male mice with a higher chimerism rate were selected to mate with C57BL / 6J female mice, and positive heterozygous mice were obtained after giving birth. The obtained positive heterozygous mice were mated with mice expressing Dre throughout the body, and the offspring mice were identified by PCR to obtain FGFR2-EGFP-CreERT2 mice with the neo gene removed. The PCR identification primers were designed at the EGFP sequence and the 5' homology arm, and the sequences were: F2 (SEQ ID NO.12): 5'-CAGTAACAACAGCAACAGCAGCACAG-3'; R2 (SEQ ID NO.13): 5'-TGAAGCACTGCACGCCGTAGGT-3', and the reaction conditions were: 95℃, 5min; 94℃20s, 62℃, 35s, 72℃, 35s for 35 cycles, and 72℃, 5min. The size of the recombinant positive band was 324bp. The genotype identification results of FGFR2-EGF P-CreERT2 mice are shown in the figure. Figure 5 As shown in the figure, it can be seen that mice No. 2-7, 9, and 11-13 showed a specific 324 bp band, indicating that these mice were correctly verified.

[0073] Example 7 Preparation and use of FGFR2-EGFP-CreERT2; ROSA26-LSL-tdTomato double gene modified mice

[0074] FGFR2-EGFP-CreERT2 mice were bred with fluorescent reporter mice ROSA26-LSL-tdTomato mice (Gt(ROSA)26Sortm9(CAG-tdTomato)Hze, Jax lab). The genotypes of the offspring mice were identified by PCR to obtain FGFR2-EGFP-CreERT2;ROSA26-LSL-tdTomato double-gene modified mice. After intraperitoneal injection of tamoxifen (TM) at a specific time point, tdTomato expression was induced in FGFR2+ cells of the double-gene modified mice to produce red fluorescence. The principle is as follows Figure 6 shown.

[0075] Example 8 Frozen Sections of Gene Knock-in Mouse Samples

[0076] Take the neonatal (d5) or adult (3 months old) FGFR2-EGFP-CreERT2; ROSA26-LSL-tdTomato mice prepared in Example 7, TM injection 3 times (1 time / day), anesthesia to death, take the skull, 4% PFA in a 4°C refrigerator to fix the sample for 24 hours, ddH2O wash the sample twice, the neonatal mouse is decalcified in 15% EDTA at 4°C for 2-5 days, and the adult mouse needs to be decalcified for 1-2 weeks. After the skull softens, the sample is washed twice with ddH2O, each time for 3 minutes, and the sample is soaked in 30% sucrose solution for 24-72 hours, and the freshly prepared sucrose solution is replaced 2-3 times during the period. Specimens of the skull cap, cranial suture and other parts are embedded and frozen sections are made at a thickness of 12μm.

[0077] Fluorescence observation of the distribution of FGFR2+ cells in the cranial sutures and skull of FGFR2-EGFP-CreERT2;ROSA26-LSL-tdTomato double-gene modified newborn mice. Figure 7 As shown in the figure, FGFR2+ cells are distributed in the periosteum, dura mater, front of skull bone formation, cranial sutures, etc. FGFR 2+ cells are distributed in the coronal suture, sagittal suture and lambdoid suture, indicating that the double gene modification model can be used to detect the expression site of FGFR2 in mouse tissues.

[0078] Example 9 Preparation of Mouse Skull Injury Model

[0079] Adult FGFR2-EGFP-CreERT2; ROSA26-LSL-tdTomato double gene modified mice were obtained. After sodium pentobarbital anesthesia, the head hair was removed using a shaver and depilatory cream, and the skin was disinfected with iodine. The skin was cut along the middle suture of the skull, and a micro drill was used to drill a skull hole (aperture 2mm) in the middle of the left parietal bone. 0.9% NaCl saline was used to gently flush out the bone debris in and around the hole, and the skin was sutured. The mice were kept warm until awake. TM was injected continuously for 3 times (1 time / day), and the skull was fixed at 4d and 20d after surgery, frozen sections were made, and DAPI staining was performed.

[0080] The FGFR2-EGFP-CreERT2;ROSA26-LSL-tdTomato mice were used to trace FGFR2+ cells involved in the repair process of skull injury. Figure 8-10As shown in the figure, it can be seen that 3 days after perforation, in the early stage of injury repair, FGFR2+ cells are mainly distributed in the coronal suture, sagittal suture, lambdoid suture and other cranial sutures, and bone cells are almost not expressed; fewer cells in the new callus tissue at the defect site express FGFR2. At 20 days of tracking, in the middle and late stages of injury repair, FGFR2+ cells at the cranial sutures migrate to the defect site to participate in injury repair, and cells in the middle of the defect site newly express FGFR2, indicating that these FGFR2+ cells are involved in injury repair.

[0081] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments. On the basis of the present invention, some modifications or improvements can be made thereto, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A method for constructing a mouse model for tracing endogenous FGFR2+ cell lineage fate, characterized in that: The following steps are included: S1. Amplify the mouse FGFR2 gene fragment, insert the reporter gene sequence and site-specific recombinase system into the targeting vector, and then insert the amplified gene fragment into the targeting vector to obtain a complete targeting vector; S2. Introduce the complete targeting vector prepared in S1 into ES cells, and screen to obtain homologous recombination-positive ES cells; S3. Inject the positive ES cells into blastocysts, transplant the blastocysts into the uterus of pseudo-pregnant female mice, and give birth to obtain chimeric mice; S4. The chimeric male mice are mated with pure strain mice to obtain ES cell-derived mice; S5. Breed ES cell-derived mice with fluorescent reporter mice of different colors to obtain double-gene modified mice.

2. The construction method according to claim 1, characterized in that: The reporter gene sequence and site-specific recombinase gene sequence in step S1 can be inserted at the start codon of the coding region of the endogenous FGFR2 gene, or at the stop codon of the coding region.

3. The construction method according to claim 2, characterized in that: The reporter gene sequence and the site-specific recombinase gene sequence in step S1 are connected in series.

4. The construction method according to claim 3, characterized in that: The expression product of the reporter gene in step S1 includes a fluorescent protein, or a luciferase, or a β-galactosidase LacZ, the fluorescent protein is one of green fluorescent protein GFP, enhanced green fluorescent protein EGFP, red fluorescent protein RFP, yellow-green fluorescent protein YFP, and blue fluorescent protein BFP, and the luciferase includes one of Renilla luciferase Rluc and firefly luciferase Luc.

5. The construction method according to any one of claims 1 to 4, characterized in that: The site-specific recombinase system in step S1 is the Cre / loxP system, or the Flp / FRT system, or the Dre / Rox system.

6. The construction method according to claim 5, characterized in that: In step S1, the reporter gene sequence and the site-specific recombinase system are connected by a self-cleaving peptide, or an IRES connection, or a connecting peptide connection; the self-cleaving peptide is one of P2A, T2A, and F2A, and the connecting peptide is one of a flexible connecting peptide and a rigid connecting peptide.

7. The construction method according to claim 6, characterized in that: The FGFR2 includes FGFR2-IIIb and FGFR2-IIIc, wherein the amino acid sequence of FGFR2-IIIb is shown in SEQ ID NO.1, and the amino acid sequence of FGFR2-IIIc is shown in SEQ ID NO.

2.

8. The construction method according to claim 7, characterized in that: The gene sequence encoding the FGFR2 protein is shown in SEQ ID NO.

14.

9. Use of the double-gene modified mouse constructed according to the construction method according to any one of claims 1 to 8 in tracing the fate of endogenous FGFR2-positive cell lineages.

Images