Detection method for methylation of human mitochondrial genome and application

Abstract

The invention provides a human mitochondrial genome methylation detection method and application. Double-state design is performed aiming at mitochondrial DNA double-chain CG sites, repetitive sequences are avoided, the capture efficiency is ensured, and the probe dosage is adjusted according to the thermodynamic stability of the probe sequence; the method comprises the following steps: constructing a mitochondrial genome bisulfite library, carrying out imbricated design based on thermodynamic stability, and selecting a high GC region and a tandem repeat region encryption probe and a strategy of selecting a flanking probe according to the requirements of capture efficiency, uniformity and coverage rate; the method for detecting mitochondrial gene methylation by utilizing a high-throughput technology is realized, so that the transformation efficiency is stable, the capture efficiency is high, the uniformity is high, the methylation detection rate is stable, the cost is reduced, and the method is suitable for researching mitochondrial methylation markers and regulatory mechanisms; and clinical application such as research on disease diagnosis, treatment response and disease prognosis.

Description

Technical Field

[0001] The present invention belongs to the field of life science and biotechnology, and relates to a method for hybridization capture sequencing of human mitochondrial gene methylation, and in particular to a method for detecting human mitochondrial genome methylation and its application, which utilizes high-throughput sequencing to determine the relationship between the human mitochondrial gene methylation state and the occurrence and development of diseases. Background Art

[0002] In the human genome, DNA methylation mainly occurs on CG. The regions with high CpG density in the genome are called CpG islands, which are significantly enriched in the promoter region and the first exon region of the gene. Methylation of CpG islands can regulate the expression or silencing of related genes by regulating chromatin structure and transcription factors. Studies have shown that the DNA methylation status of CpG islands located near the transcriptional regulatory region of genes is often closely related to the occurrence and development of diseases.

[0003] Mitochondria are semi-autonomous organelles that have their own complete set of equipment for mitochondrial DNA (mtDNA) replication, transcription, and protein translation. Methylation on mitochondrial DNA was first discovered in the 1870s. Subsequently, a series of studies reported the presence of methylation on mitochondrial DNA at a level lower than that of the nuclear genome. However, more and more studies have shown that mitochondrial DNA methylation is closely related to the occurrence and development of a variety of diseases. In tumor tissues, the level of mitochondrial DNA methylation is generally significantly increased, and this increase is closely related to the occurrence and development of tumors. Mitochondrial DNA methylation is also closely related to a variety of diseases such as diabetes and cardiovascular disease. In addition, mitochondrial DNA methylation is also related to cellular metabolic activities, which can cause mitochondrial dysfunction, energy metabolism disorders, and lead to the occurrence of a variety of diseases.

[0004] In recent years, for the detection of mitochondrial gene methylation, domestic mitochondrial methylation detection methods have been developed successively to meet the research on mitochondrial methylation of related diseases, such as an application for a human mitochondrial genome methylation detection kit and its application (patent application number: CN201810597493.X). This invention uses sulfite modification, PCR amplification technology, chip spotting and mass spectrometry detection methods for detection, and only detects 292 CpG sites in the mitochondrial genome, which has certain application value. However, this method only reflects the methylation of part of the mitochondrial gene sequence, and has not yet fully detected the overall methylation of the mitochondrial genome. Another application for the screening method and application of mitochondrial-nuclear DNA methylation joint sites (patent application number: CN201710771772.9) is only the detection of the demethylation level of the four sites 322, 3636, 9994 and 13431 on mitochondrial DNA. Another application is a method for using transposase to study chromatin open regions and mitochondrial methylation (patent application number: CN201810040939.9). This invention is a method for using transposase to study chromatin open regions and mitochondrial methylation, and only detects 1209 sites in the mitochondrial genome. Due to the existence of homologous sequences between nuclear genes and mitochondrial genes, the problems of false positives and false negatives of methylation have not yet been explained.

[0005] The mitochondrial DNA methylation capture sequencing technology used in this study adopts a post-sulfurization capture technology scheme, that is, first constructing a mitochondrial genome bisulfite library, and then capturing the entire region of the mitochondrial genome. After obtaining the machine library, high-throughput sequencing is performed to avoid the loss of template diversity, machine sequencing and biological analysis, and the methylation status of the mitochondrial genome is calculated. Summary of the invention

[0006] The purpose of the present invention is to provide a method for detecting methylation of human mitochondrial genome in view of the shortcomings of the current mitochondrial DNA methylation technology, which is a probe design concept for performing a dual-state design on the double-stranded CG site of mitochondrial DNA, avoiding repeated sequences, ensuring capture efficiency, and adjusting the probe dosage according to the thermodynamic stability of the probe sequence; a library construction scheme of bisulfite sulfurization conversion of the gold standard, stable conversion efficiency and effective reduction of false positive rate; and a highly optimized hybridization capture system with a self-developed specific component enhancer that effectively improves capture efficiency and a universal blocking sequence of a connector that supports multiple hybrid schemes.

[0007] The present invention provides a method for detecting human mitochondrial genome methylation, i.e., a method for detecting mitochondrial DNA methylation based on high-throughput sequencing technology, which consists of five components: mitochondrial genome purification, ultrasonic disruption of mitochondrial DNA, bisulfite treatment, probe design and mitochondrial DNA region capture, and upper sequencing and analysis. The specific operation steps are as follows:

[0008] (1) Mitochondrial genome purification and fragmentation: Collect whole blood or cell samples, separate mitochondria using density gradient method, and then purify mitochondrial DNA; use ultrasonic random fragmentation to fragment mitochondrial genomic DNA (150-200bp), repair the ends of genomic DNA fragments, add A, connect adapters, and purify; (2) Methylation adapter ligation: The mitochondrial DNA fragments were methylated with adapters in the prepared methylation adapter reaction system. The P5 end sequence of the methylation adapter was 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCT, and the P7 end sequence was: / 5Phos / GATCGGAAGAGCACACGTCTGAACTCCAGTCAC; (3) Bisulfite treatment: adding a mitochondrial DNA protection solution to the bisulfite conversion reaction system, wherein the main components of the protection solution are 1×SSPE pre-hybridization solution, 5×Denhardt solution, 0.01 mol / L ethylenediaminetetraacetic acid solution and 0.2% sodium dodecyl sulfate solution; setting bisulfite treatment parameters on the PCR instrument to perform bisulfite treatment; the mitochondrial DNA protection solution ensures the methylation status of the mitochondrial DNA; (4) Probe design and mitochondrial whole genome capture: A dual-state design is performed for the double-stranded CG sites of the mitochondrial genome to reduce costs while ensuring the methylation detection rate; the probe design is based on thermodynamic stability and a shingled design is performed, and the optimal probe coverage scheme is selected according to the requirements of capture efficiency, uniformity and coverage; at the same time, for high GC regions and tandem repeat regions, the strategy of encrypted probes and selected flanking probes is adopted; for the case where there are many homologous sequences in the genome, the appropriate probe design scheme can be recommended based on the non-specific evaluation results and the impact on capture efficiency; at the same time, the probe design is based on the latest reference genome GRCh38 and the latest patch sequence of the GRC official website, which can effectively reduce missed detections caused by individual differences, and capture the required mitochondrial DNA methylation probe components totaling 512. Then the mitochondrial DNA methylation probe is hybridized with the library, and the mitochondrial DNA methylation library is captured by streptavidin magnetic beads. (5) After capture, the library is enriched and purified. The amplification primers involved in the PCR amplification reaction are: universal adapter forward primer 5'-AATGATACGGCGACCACCGA; reverse primer: 5'-CAAGCAGAAGACGGCATACGA; a mitochondrial DNA methylation-specific library is obtained, and the library is amplified, enriched, and quality-checked to obtain a final mitochondrial DNA methylation library that is suitable for sequencing. (6) The sequencing was performed on the machine, and bioinformatics analysis was performed after the machine: low-quality reads and repeated sequences were removed, the completed reads were aligned to the reference genome GRCh38 / hg38 using BSMAP, and the methylation levels of CpG, CHG, and CHH were calculated using MethylDackel.

[0009] The probe design in step (4) covers the entire mitochondrial genome. The CGI probe data of different capture reactions were analyzed for correlation. The mitochondrial DNA methylation capture technology has good technical repeatability in detecting mitochondrial DNA methylation levels. 2 Reached 0.99.

[0010] In step (4), a double-stranded CG site dual-state design is performed for the regulatory region of the mitochondrial genome, and the amount of probe used is only twice that of a conventional probe, which ensures the methylation detection rate while saving probes and reducing costs.

[0011] The methylation hybridization capture system provided by the present invention is developed based on a mature regional capture system, uses a single tube operation, requires only two rinse reagents, is simpler to experiment, has stable multi-hybridity performance, and is stable for probes of different sizes. With the independently developed enhancer, the capture efficiency is effectively improved, and the uniformity and stability are excellent.

[0012] The detection method of the present invention is applied in the detection of methylation of human mitochondrial genome. The present invention performs a dual-state design for the double-stranded CG site of mitochondrial DNA, significantly reducing the risk of missed detection due to individual differences, not only reducing the detection cost, but also effectively improving the detection rate of methylation.

[0013] The probe design concept provided by the present invention is to perform a dual-state design for double-stranded CG sites, which can reduce costs and ensure the methylation detection rate; adopt automatic optimal sequence selection to avoid repeated sequences and ensure capture efficiency; adjust the probe dosage according to the thermodynamic stability of the probe sequence to ensure high uniformity.

[0014] The highly optimized hybridization capture system and the highly optimized experimental process provided by the present invention ensure high uniformity and stability; the universal blocking sequence of the independently developed connector supports multiple hybridization schemes and further reduces the experimental cost.

[0015] The mitochondrial DNA methylation capture sequencing technology of the present invention adopts a capture scheme after bisulfite treatment, that is, first constructing a whole-genome bisulfite library, then performing mitochondrial genome methylation domain capture, and performing high-throughput sequencing after obtaining the machine library, thereby avoiding the loss of template diversity.

[0016] The mitochondrial DNA methylation detection method and preparation thereof of the present invention have the following significant features: 1. This study adopted a high-throughput mitochondrial DNA methylation hybridization capture sequencing method and performed a dual-state design for the double-stranded CG sites of mitochondrial DNA. This design not only reduced the detection cost, but also effectively improved the detection rate of methylation. 2. At present, there are many methods for detecting mitochondrial DNA methylation at home and abroad, such as chip spotting and mass spectrometry detection. However, these methods usually face the defects of time-consuming, complicated operation and high detection cost, which limits their promotion in clinical applications. In contrast, the high-throughput detection method provided by the present invention effectively avoids the problems of false positives, false negatives and low throughput, and significantly improves the sensitivity and specificity of the detection. 3. The design of the mitochondrial DNA methylation probe is based on the latest reference genome GRCh38 and the patch sequence updated on the GRC official website, which significantly reduces the risk of missed detection due to individual differences and further enhances the reliability and accuracy of this method. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the design of mitochondrial DNA methylation probe shown in the present invention.

[0018] Figure 2 The flowchart of mitochondrial DNA methylation detection shown in the present invention.

[0019] Figure 3 It is a quality graph of the mitochondrial DNA methylation library capture sequencing provided by the present invention.

[0020] Figure 4 This is the coverage distribution diagram of the mitochondrial DNA methylation library provided by the present invention. DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0022] Example 1 A method for detecting human mitochondrial genome methylation and its application The present invention provides a method for detecting mitochondrial genome methylation, which uses a method for detecting mitochondrial DNA methylation based on high-throughput sequencing technology, comprising mitochondrial genome purification, ultrasonic interruption of mitochondrial DNA, bisulfite sulfation treatment, probe design and mitochondrial DNA region capture, upper sequencing and analysis.

[0023] (1) Methylation adapter ligation: The mitochondrial DNA fragments were methylated with adapters in the prepared methylation adapter reaction system. The P5 end sequence of the methylation adapter was 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCT, and the P7 end sequence was: / 5Phos / GATCGGAAGAGCACACGTCTGAACTCCAGTCAC.

[0024] (2) Add mitochondrial DNA protection solution to the prepared bisulfite conversion reaction system. The protection solution mainly comprises the following final concentration components: 1×SSPE pre-hybridization solution, 5×Denhardt solution, 0.01 mol / L ethylenediaminetetraacetic acid solution and 0.2% sodium dodecyl sulfate solution.

[0025] (3)Use Figure 1 A total of 512 mitochondrial DNA methylation probe components were designed to capture the required components.

[0026] Table 1 Mitochondrial genome regions covered by the 512 designed methylation probes:

[0027] (4) The probe and the library are hybridized in a hybridization reaction solution, and the mitochondrial library is captured using streptavidin magnetic beads.

[0028] (5) After capture, the library is enriched and purified, wherein the amplification primers involved in the PCR amplification reaction are: universal adapter forward primer 5'-AATGATACGGCGACCACCGA; reverse primer: 5'-CAAGCAGAAGACGGCATACGA.

[0029] Example 2 Construction and sequencing analysis of mitochondrial genome methylation library according to Figure 2 The schematic diagram shown in the figure is used to prepare the library before the mitochondrial DNA methylation assay, as follows:

[0030] Step 1: Genomic DNA extraction: Take samples such as whole blood or cells, use density gradient centrifugation to separate mitochondria, extract mitochondrial DNA, and ensure that the quality and purity of mitochondrial DNA meet the requirements.

[0031] Step 2: Use ultrasonic shearing to randomly shear the mitochondrial DNA (150-200bp), fragment it, repair the ends, and add "A" to the 3' end: prepare the reaction system as follows: 50μL sample DNA, 10μL deionized water, 7μL "A" enzyme buffer added to the ends, and 3μL "A" enzyme added to the ends; use a pipette to mix, and centrifuge instantly; set the PCR instrument parameters as follows, place the reaction system on the PCR instrument, and run the program: 30℃30min cycle once, 65℃30min cycle once, and store at 4℃.

[0032] Step 3: Methylated adapter ligation: In an ice box, prepare the reaction system according to the table below, including 60 μL of reaction product, 5 μL of methylated adapter, 30 μL of methylated adapter ligation buffer, and 5 μL of adapter ligase. Use a pipette to mix the components thoroughly, followed by instant centrifugation to remove bubbles. Next, set the PCR instrument parameters to 22°C for 1 cycle for 15 minutes, and store the reaction system at 4°C after completion. Finally, place the configured reaction system in the PCR instrument and execute the preset program.

[0033] Step 4: Purification of ligation product: First, prepare an 80% ethanol solution using anhydrous ethanol and deionized water and place it at room temperature for later use. It is recommended to use a freshly prepared solution to optimize the magnetic bead purification effect. Remove the purified magnetic beads, mix thoroughly, and equilibrate at room temperature for 30 minutes, then vortex to mix. After the reaction is completed, add 70μL of magnetic beads to the 100μL reaction system, gently pipette or vortex to mix to ensure that the magnetic beads are evenly distributed in the reaction solution, and let it stand at room temperature for 5 minutes to promote the binding of the target molecule. Next, quickly centrifuge and place the PCR tube on the magnetic rack for 3 minutes until the supernatant is clear. Keep the PCR tube on the magnetic rack, carefully remove the supernatant, then add 200μL 80% ethanol, let it stand for 30 seconds, and remove the supernatant again. Repeat the ethanol wash step to remove impurities. After that, quickly centrifuge, put the PCR tube back on the magnetic rack, and carefully use a 10μL pipette to remove the residual ethanol at the bottom to avoid sucking in the magnetic beads. Keep the PCR tube on the magnetic rack and let it stand at room temperature for 3-5 minutes to ensure that the residual ethanol is completely evaporated. Finally, add 22μL of deionized water to elute the target molecule, remove the PCR tube, gently pipette or vortex to mix, and let it stand at room temperature for 2 minutes. After rapid centrifugation, put the PCR tube back on the magnetic rack for 2 minutes. When the solution is clear, carefully aspirate 20μL of supernatant, transfer it to a new PCR tube and label it for storage.

[0034] Step 5: Bisulfite treatment: First, prepare the bisulfite conversion reaction system, the specific components are: 20μL of reaction product, 85μL of bisulfite and 35μL of DNA protection solution, with a total volume of 140μL. After adding the DNA protection solution to the PCR tube, observe that the liquid turns blue, gently pipette and mix 6 times, then evenly divide it into two tubes and mark them. Next, set the PCR instrument program and run according to the following conditions: the hot cover temperature is set to 105℃, heat at 95℃ for 5 minutes, keep warm at 60℃ for 10 minutes, then repeat heating at 95℃ for 5 minutes and keeping warm at 60℃ for 10 minutes once each, and finally keep at 20℃. After the reaction is completed, perform sample purification: mix the samples after the reaction, add 310μL of buffer to the EP tube, then add 250μL of anhydrous ethanol, shake and mix, centrifuge instantly, and transfer to the centrifuge column. After standing at room temperature for 1 minute, centrifuge at 12000r / min for 1 minute, transfer the liquid in the collection tube back to the centrifuge column, stand at room temperature for 1 minute, and centrifuge at the same speed for 1 minute. Take out the centrifuge column, discard the waste liquid, and then put the centrifuge column back into the centrifuge tube. Subsequently, add 500μL of buffer to the centrifuge column, centrifuge at 12000r / min for 1 minute, repeat this step, add another 500μL of buffer, incubate at room temperature for 15 minutes, and finally centrifuge at 12000r / min for 1 minute. Repeat the washing step twice to remove impurities. Finally, add 250μL of anhydrous ethanol to the centrifuge column, centrifuge at maximum speed for 1 minute, discard the waste liquid in the centrifuge tube, put the centrifuge column back into the centrifuge tube, centrifuge at 12000r / min for 1 minute again, and use a 10μL pipette to remove the residual liquid on the centrifuge column to ensure that there is no ethanol residue. Transfer the centrifuge column to a new 1.5mL centrifuge tube, add 22μL enzyme-free water, let stand for 2 minutes, and then centrifuge at 12000r / min for 1 minute; transfer the liquid in the centrifuge tube to the centrifuge column, let stand at room temperature for 1 minute, and then centrifuge at the same speed for 1 minute, and finally use a 10μL pipette to transfer the remaining liquid in the centrifuge column to a 1.5mL centrifuge tube. Discard the centrifuge column, retain the marked purified product, and prepare for the next step of reaction.

[0035] Step 6: PCR amplification: Mix 20 μL of the reaction product obtained in the above step, 25 μL of PCR reaction mixture and 5 μL of primers thoroughly, use a pipette to gently mix, and perform instant centrifugation to ensure that the reaction solution is evenly distributed at the bottom of the tube. Place the reaction system in a preset PCR instrument and amplify according to the following procedures: the temperature of the hot cover is set to 105°C; first pre-denature at 98°C for 2 minutes to fully denature the template DNA, followed by 11 cycles, each cycle including denaturation at 98°C for 20 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds to achieve specific amplification. After the amplification is completed, perform terminal extension at 72°C for 1 minute to ensure that all amplified fragments are fully extended. Finally, the reaction product is stored at 4°C.

[0036] Step 7: Post-amplification purification: Vortex the purified magnetic beads that have been equilibrated to room temperature and set aside. Add an equal volume of magnetic beads (50 μL) to the PCR product, gently pipette or vortex to mix, and let stand at room temperature for 5 minutes. Then perform a quick centrifugation and place the PCR tube on a magnetic rack for 3 minutes until the solution is clear. While keeping the PCR tube on the magnetic rack, carefully discard the supernatant, then add 200 μL of 80% ethanol solution to the PCR tube and let it stand for 30 seconds. Repeat this step and add 200 μL of 80% ethanol solution to the PCR tube again, let it stand for 30 seconds and discard the supernatant. Cover the tube and perform a quick centrifugation to centrifuge the remaining ethanol to the bottom of the tube, then place the PCR tube on the magnetic rack and carefully use a 10 μL pipette to discard the remaining ethanol at the bottom, making sure not to inhale the magnetic beads. While keeping the PCR tube on the magnetic rack, let it stand at room temperature for 3 to 5 minutes to ensure that the magnetic beads are completely dry and the residual ethanol is completely evaporated. Next, add 30 μL of enzyme-free water, remove the PCR tube from the magnetic stand, gently pipette or vortex to mix, and let stand at room temperature for 2 minutes. After instant centrifugation, place the PCR tube on the magnetic stand for 2 minutes to wait for the solution to clarify. Finally, use a pipette to aspirate 28 μL of supernatant, transfer it to a new PCR tube and mark it. Take 1 μL of library sample and use a spectrophotometer to detect the library concentration, and record the concentration value; take another 1 μL of library sample to detect the library length using a fragment analyzer.

[0037] Step 8: Preliminary preparation for hybridization capture experiment: Take out the hybridization blocking reagent, RNase blocking agent and enhancer from the -20℃ refrigerator and place them in an ice box for melting. After melting, gently vortex and centrifuge briefly, and then temporarily store them in an ice box. Next, take out the blocking oligonucleotide reagent from the -20℃ refrigerator, place it on an ice box to melt, and also vortex and centrifuge briefly, and temporarily store it in an ice box. Then, take out the required probe from the -80℃ refrigerator, place it in an ice box to melt, vortex and centrifuge briefly, and temporarily store it in an ice box. Next, take out the library to be hybridized and captured from the -20℃ refrigerator, place it in an ice box to melt, vortex and centrifuge briefly, and then temporarily store it in an ice box. Finally, take out the buffer from the -20℃ refrigerator, place it at room temperature to melt, and preheat it at 65℃ until it is completely dissolved. Then, a brief vortex mixing and instant centrifugation were performed, and 20 μL was taken from each reaction into a new PCR tube, and finally placed at 65°C for use.

[0038] Step 9: Library and probe hybridization: When performing single library hybridization, take 750ng of library and add it to the PCR tube and mark it. Next, add 10μL of enhancer to each PCR tube. Place the PCR tube in a vacuum concentrator, open the tube cap, and concentrate to dryness. After the library is concentrated, prepare the hybridization reaction solution according to the following recipe: 13μL of hybridization buffer, 5μL of human genome repeat sequence blocking reagent, 2μL of universal blocking oligonucleotide, 5μL of RNase inhibitor, 3μL of deionized water and 2μL of probe set, with a total volume of 30μL. Add the prepared hybridization reaction solution to the dried library, gently vortex for 30 seconds to ensure that the DNA at the bottom of the tube is completely dissolved, and then centrifuge briefly. Next, set the PCR instrument parameters, place the hybridization reaction solution in the PCR instrument for reaction, set the hot cover temperature to 105℃, heat at 95℃ for 5 minutes, and then keep it at 65℃ for 1 time. The recommended hybridization time is 12 to 18 hours, and be ready for the next step 30 minutes before the end of the program.

[0039] Step 10: Preparation before capture experiment: First, remove the magnetic beads from the 4℃ refrigerator, mix thoroughly and equilibrate at room temperature for 30 minutes. Next, prepare an 80% ethanol solution using anhydrous ethanol and deionized water and store it at room temperature for use in the subsequent purification steps. Then, remove the eluate and, if a precipitate is observed, heat it in a 37℃ water bath until the precipitate is completely dissolved. At the same time, preheat the eluate in a 60℃ water bath. Next, take 50μL of magnetic beads and add them to a new PCR tube, place it on the magnetic rack for 1 minute, wait for the solution to clear, and gently discard the supernatant. Then remove the PCR tube from the magnetic rack, add 180μL of binding buffer, and gently pipette or vortex to resuspend the magnetic beads. After a brief centrifugation, place the PCR tube on the magnetic rack again for 1 minute, wait for the solution to clear, and discard the supernatant. This step needs to be repeated twice to ensure that the magnetic beads have been thoroughly washed three times. Finally, remove the PCR tube from the magnetic stand, add 180 μL of binding buffer again, and gently pipette or vortex to resuspend.

[0040] Step 11: Mitochondrial Whole Genome Methylation Capture: First, keep the hybridization product in the PCR instrument. Then, add 180μL of pre-prepared magnetic beads and gently pipette to mix. After capping the PCR tube, remove it from the PCR instrument and place it in a vertical rotating mixer to bind at room temperature for 30 minutes at a speed not exceeding 10rpm. After completion, perform a quick centrifugation and place the PCR tube on the magnetic stand for 2 minutes until the solution is clear, and then carefully discard the supernatant. Next, remove the PCR tube from the magnetic stand, add 150μL of elution buffer, gently pipette to mix to resuspend the magnetic beads, and replace the tube cap. Place the PCR tube in a vertical rotating mixer and wash at room temperature for 15 minutes at a speed not exceeding 10rpm. Remove the PCR tube again, perform a quick centrifugation, and then place it on the magnetic stand for 2 minutes. After the solution is clear, discard the supernatant. Then, remove the PCR tube from the magnetic rack again, add 150 μL of elution solution preheated to 60°C, gently pipette to mix, centrifuge briefly, place in a constant temperature oscillating mixer or metal bath, and incubate at 60°C for 10 minutes. Remove the PCR tube, centrifuge briefly, and place on the magnetic rack for 2 minutes. After the solution is clear, discard the supernatant. Finally, repeat the above steps, add 150 μL of elution solution preheated to 60°C, gently pipette to mix, centrifuge briefly, and incubate at 60°C for 10 minutes in a constant temperature oscillating mixer or metal bath. Remove the PCR tube, centrifuge briefly, transfer all liquids (including magnetic beads) to a new PCR tube, place on the magnetic rack for 2 minutes, and discard the supernatant after the solution is clear. Keep the PCR tube on the magnetic rack, add 200 μL of 80% ethanol to it, let it stand for 30 seconds, then completely discard the ethanol solution, and dry the magnetic beads at room temperature to ensure that the residual ethanol is completely evaporated. Finally, add 24 μL of deionized water to the PCR tube, remove the PCR tube from the magnetic stand, and gently vortex to resuspend the magnetic beads in preparation for the subsequent amplification reaction.

[0041] Step 12: Post-capture PCR amplification: Before the experiment begins, the reaction products and PCR primers need to be taken out of the -20℃ refrigerator in advance and placed in an ice box for thawing, while keeping them in the ice box to avoid temperature fluctuations. Make sure that the PCR primers match the library type, and reconfirm the accuracy of the Post PCR Primer used before the PCR reaction. Gently vortex the mixing buffer and primers, and then centrifuge briefly to ensure uniform distribution. Prepare the PCR reaction solution according to the following recipe. This step is a PCR reaction with magnetic beads: mix 24μL of reaction product, 1μL of PCR primer and 25μL of PCR buffer. After mixing, use a pipette to mix gently and quickly transfer the reaction solution to the PCR instrument. Do not use the method of vortexing and then centrifuging. Next, set the PCR instrument program as follows: the temperature of the hot cover is set to 105°C, and the following cycle is performed: heating at 95°C for 1 minute for initial denaturation, followed by denaturation at 98°C for 20 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, and finally terminal extension at 72°C for 5 minutes, and keep at 4°C for subsequent operations. After the program is completed, the next step of the reaction can be carried out.

[0042] Step 13: Post-amplification purification: First, take out the purified magnetic beads, mix thoroughly and equilibrate at room temperature for 30 minutes. Next, add 1.1 times the volume of magnetic beads (55μL) to the PCR product obtained in step 3.5, gently pipette or vortex to mix, and then let it stand at room temperature for 5 minutes. After a quick centrifugation, place the PCR tube on the magnetic stand and let it stand for 3 minutes to wait for the solution to clarify. Keep the PCR tube on the magnetic stand, discard the supernatant, add 200μL of 80% ethanol solution to the tube, and let it stand for 30 seconds to facilitate washing. While keeping the PCR tube on the magnetic stand, after discarding the supernatant, repeat this step, add 200μL of 80% ethanol solution to the PCR tube again, let it stand for 30 seconds, and then completely discard the supernatant (you can centrifuge it briefly to concentrate the hanging liquid to the bottom of the tube, and then use a 10μL pipette to remove the ethanol remaining at the bottom). Subsequently, keep the PCR tube on the magnetic stand and let it stand at room temperature for 3 to 5 minutes to ensure that the residual ethanol is completely evaporated. Next, add 25μL of deionized water to the PCR tube, remove the PCR tube, gently pipette or vortex to mix, and let it stand at room temperature for 2 minutes. After instant centrifugation, place the PCR tube on the magnetic stand for another 2 minutes to wait for the solution to clarify. Finally, use a pipette to aspirate 23μL of supernatant, transfer it to a new PCR tube, and store the captured library in a -20℃ refrigerator. Under this condition, the library can be kept for one month.

[0043] Step 14: Take 1 μL of the library sample and measure the concentration on a spectrophotometer using a DNA detection reagent. Add the sample to an appropriate cuvette and ensure that the light path is clean. Set the spectrophotometer to an appropriate wavelength (usually 260 nm) to ensure optimal absorbance measurement of DNA. After starting the assay, record the absorbance value obtained and calculate the library concentration based on the standard curve.

[0044] Step 15: Take 1 μL of the library sample and use the fragment analyzer to check the fragment quality. Load the sample according to the instrument manual and select appropriate electrophoresis conditions to ensure optimal separation. After running the analysis, record the obtained fragment size and compare it with the expected library size.

[0045] Step 16: On-machine sequencing and bioinformatics analysis: After on-machine sequencing, low-quality reads and repeated sequences are first removed to ensure data quality. The results are as follows Figure 3 Then, the processed reads were compared with the reference genome to detect the methylation level of the mitochondrial genome and calculate the distribution of mitochondrial methylation site coverage. The results are shown in Figure 4 Specifically, the sequencing results of mtDNA targeted capture were aligned to the reference genome GRCh38 / hg38 using BSMAP. Next, the Samtools and Picard tools were used to sort the results and remove duplicate sequences to ensure the accuracy of the data. Finally, the MethylDackel tool was used to calculate the methylation levels of CpG, CHG, and CHH sites to evaluate the methylation status of mitochondrial DNA.

[0046] 6. Reliability test The high-throughput detection method of the present invention was used to analyze mitochondrial genome methylation. After sequencing and comparison on the machine, the test results were analyzed in detail. The samples were further treated with bisulfite and subjected to first-generation sequencing analysis, and the results showed that the two were consistent. This shows that the method of the present invention has good stability and reliability in detecting mitochondrial genome methylation.

[0047] Compared with chip mass spectrometry technology and fixed-point detection methods, high-throughput mitochondrial gene methylation detection technology has the following advantages: (see Table 2).

[0048] Table 2 Comparison of the present invention with other related technical indicators

[0049] The above embodiments are only preferred examples provided to fully illustrate the present invention, and the protection scope is not limited thereto. Any equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention.

Claims

1. A method for detecting human mitochondrial genome methylation, characterized in that: This is accomplished by following these steps: (1) Mitochondrial genome purification and fragmentation: Mitochondria were separated by density gradient method, mitochondrial DNA was purified, and mitochondrial DNA was randomly fragmented by ultrasound with a fragment length of 150-200 bp, and the ends were repaired and A was added; (2) Methylated linker ligation: methylated linker was used for ligation. The P5 end sequence of the methylated linker was 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCT, and the P7 end sequence was / 5Phos / GATCGGAAGAGC ACACGTCTGAACTCCAGTCAC; (3) Bisulfite treatment: Add mitochondrial DNA protection solution to the bisulfite conversion reaction system for treatment, wherein the final concentration of the main components of the DNA protection solution is 1× SSPE pre-hybridization solution, 5× Denhardt solution, 0.01 mol / L ethylenediaminetetraacetic acid solution and 0.2% sodium dodecyl sulfate solution; (4) Probe design and mitochondrial genome capture: binary design was performed for the double-stranded CG sites of the mitochondrial genome, and the optimal sequence was automatically selected. For high GC regions and tandem repeat regions, the strategy of encrypted probes and selected flanking probes was adopted, and a total of 512 probes were captured. The probes were hybridized with the library, and the mitochondrial DNA methylation library was captured using streptavidin magnetic beads. (5) After capture, library enrichment and purification are performed, wherein the amplification primers involved in the PCR amplification reaction are: universal adapter forward primer 5'-AATGATACGGCGACCACCGA, reverse primer: 5'-CAAGCAGAAGACGGCATACGA, to obtain a mitochondrial DNA methylation-specific library; (6) Sequencing was performed on the machine, and bioinformatics analysis was performed after the machine: low-quality reads and repetitive sequences were removed, the reads were compared with the reference genome, and the methylation level of the mitochondrial genome was detected.

2. The construction method according to claim 1, characterized in that: Step (3) setting bisulfite treatment parameters on a PCR instrument to perform bisulfite treatment.

3. The construction method according to claim 1, characterized in that: Step (6) The completed reads were aligned to the reference genome GRCh38 / hg38 using BSMAP, and the methylation levels of CpG, CHG, and CHH were calculated using MethylDackel.

4. The detection method according to claim 1 is used in the detection of human mitochondrial genome methylation.

Images