A precise Pichia pastoris base editor based on an adenosine deaminase mutant
By directed evolution of ABE8e in Pichia pastoris, we constructed a Pichia pastoris base editor of adenosine deaminase mutant and nCas9 protein, which solved the problem of low expression efficiency of oligomeric proteins and membrane proteins in Pichia pastoris and achieved precise base editing within a narrow editing window, which is suitable for the study of specific gene mutations and sequence replacements.
Patent Information
- Application Number
- CN202410571109.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-10
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-05-10
AI Technical Summary
Existing Pichia pastoris is inefficient in expressing oligomeric proteins, membrane proteins or certain protein complexes, lacks complete genetic manipulation tools, and the editing window of adenine base editors is wide, making it difficult to achieve precise editing.
By directed evolution of ABE8e in Pichia pastoris, an adenosine deaminase mutant was constructed, and combined with nCas9 protein and gRNA to form a Pichia pastoris base editor, achieving precise editing of the targeted site.
Achieving base editing within a narrow editing window improves the accuracy and specificity of editing, reduces the risk of misediting at non-target sites, and is suitable for the study of specific gene mutations and sequence replacements.
Smart Images

Figure CN119913131B_ABST
Abstract
Description
Technical Field
[0001] The invention provides a DNA molecule composition, belonging to the technical field of nucleic acid. Background Art
[0002] An adenine base editor (ABE) is a tool based on CRISPR / Cas9 technology (clustered regularly interspaced short palindromic repeats; Cas9: CRISPR-associated protein 9). It can mutate bases from A·T to G·C within a target genomic sequence without generating double-strand breaks or requiring a specific nucleic acid template. The most widely used and efficient ABE tools are based on the deaminase ABE8e. Adenine base editors have reportedly been widely used in various species, including rice, wheat, and mammalian cells.
[0003] Pichia pastoris ( pichia pastoris ) is an excellent and regulatable host for heterologous protein expression. AOX1 High-density fermentation, which relies on strict regulation of promoters, is primarily used for the production of biopharmaceuticals and industrial enzymes. As Pichia pastoris becomes increasingly widely used for the expression of exogenous proteins, its shortcomings are becoming increasingly prominent. For example, Pichia pastoris often cannot effectively express oligomeric proteins, membrane proteins, or certain protein complexes. To address these issues, genetic engineering of Pichia pastoris and the development of more complex and efficient genetic manipulation tools are becoming increasingly necessary. Studies have reported that the Cre-loxp recombinase system, CRISPR / Cas9 gene editing system, and cytosine base editors have been applied to Pichia pastoris. However, compared to other expression systems, Pichia pastoris lacks a comprehensive and efficient genetic manipulation tool set.
[0004] To construct an adenine base editor suitable for Pichia pastoris, we used the deaminase ABE8e to construct two adenine base editors: N-ABE and C-ABE. N-ABE has a slightly higher editing efficiency than C-ABE, but both adenine base editors have a wide editing window, which is a significant limitation for precise editing. The purpose of this invention is to provide an adenine base editor with more precise editing of target sites by directed evolution of ABE8e in Pichia pastoris. Summary of the Invention
[0005] Based on the above purpose, the present invention first provides an adenosine deaminase mutant, wherein the adenosine deaminase mutant is a wild-type C141R, L144P mutant with a sequence as shown in SEQ ID NO.1.
[0006] Secondly, the present invention provides a polynucleotide encoding the above-mentioned adenosine deaminase mutant, the sequence of which is shown in SEQ ID NO.2.
[0007] Third, the present invention provides a Pichia pastoris base editor, which is a DNA molecular composition, comprising a first expression plasmid and a second expression plasmid, wherein the first expression plasmid contains a polynucleotide encoding the nCas9 protein and a polynucleotide encoding the adenosine deaminase mutant, and the second expression plasmid contains gRNA, wherein the amino acid sequence of the nCas9 protein is shown in SEQ ID NO.3, and the spacer sequence length of the gRNA is 20 nt.
[0008] In a preferred embodiment, the sequence of the polynucleotide encoding the adenosine deaminase mutant is shown in SEQ ID NO. 2, the sequence of the polynucleotide encoding the nCas9 protein is shown in SEQ ID NO. 4, and the polynucleotide encoding the adenosine deaminase mutant and the polynucleotide encoding the nCas9 protein are separated by a sequence encoding (GGGGS) 10 The polynucleotides of the linked peptides are linked.
[0009] In a more preferred embodiment of the present invention, the polynucleotide encoding the adenosine deaminase mutant in the first expression plasmid is located at the 5' end of the polynucleotide encoding the nCas9 protein and is fused to the polynucleotide encoding the nCas9 protein by encoding (GGGGS) 10 The polynucleotides of the connecting peptide are connected, wherein the 5' end of the polynucleotide encoding the adenosine deaminase mutant is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5, and the 3' end of the polynucleotide encoding the nCas9 protein is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5.
[0010] More preferably, the sequence of the segment from the polynucleotide encoding the adenosine deaminase mutant to the polynucleotide encoding the nCas9 protein in the first expression plasmid is as shown in SEQ ID NO. 6. In the present invention, the first expression plasmid having this sequence configuration is named "pN-ABE".
[0011] In another more preferred embodiment of the present invention, the polynucleotide encoding the nCas9 protein in the first expression plasmid is located at the 5' end of the polynucleotide encoding the adenosine deaminase mutant and is separated from the polynucleotide encoding the adenosine deaminase mutant by encoding (GGGGS) 10 The polynucleotide of the connecting peptide is connected, wherein the 3' end of the polynucleotide encoding the nCas9 protein is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5.
[0012] More preferably, the sequence of the segment from the polynucleotide encoding the nCas9 protein to the polynucleotide encoding the adenosine deaminase mutant in the first expression plasmid is as shown in SEQ ID NO. 7. In the present invention, the first expression plasmid having this sequence configuration is named "pC-ABE".
[0013] Fourth, the present invention provides a Pichia pastoris host cell transfected with the above-mentioned Pichia base editor.
[0014] Finally, the present invention provides a method for base editing a target gene in Pichia pastoris using the above-mentioned Pichia pastoris base editor, the method comprising the following steps:
[0015] (1) Transfecting a first expression plasmid containing the polynucleotide encoding the adenosine deaminase mutant and the polynucleotide encoding the nCas9 protein, and a second expression plasmid containing a gRNA into a Pichia pastoris cell containing the target gene to be edited, wherein the gRNA targets the target gene to be edited and the length of the spacer sequence of the gRNA is 20 nt;
[0016] (2) Screening of positive Pichia pastoris clones in which the target gene to be edited is specifically edited.
[0017] The method provided by the present invention can be used to achieve targeted gene editing of target cells, thereby realizing industrial application in the basic and applied research fields of Pichia pastoris.
[0018] The adenosine deaminase mutant and Pichia pastoris adenine base editor provided by the present invention can achieve base editing within a narrow editing window. This editor can achieve base editing within an extremely limited editing window, which brings significant advantages to specific application scenarios. Although its editing range is relatively narrow, because of this, the editor exhibits higher editing accuracy and specificity. For studies that require precise control of the location and number of gene mutations, such as single-base mutations in specific genes or precise replacement of specific sequences, this base editor with a narrow editing window will become an ideal choice. At the same time, it also shows great potential in preventing misediting of non-target sites, and is expected to reduce potential side effects and risks. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 . Schematic diagram of the pN-ABE and pC-ABE vector structures;
[0020] Figure 2 Identify positive clones after pN-ABE transformation by colony PCR and agarose gel electrophoresis;
[0021] Figure 3 Identify positive clones after pC-ABE transformation by colony PCR and agarose gel electrophoresis;
[0022] Figure 4 Sanger sequencing results of pN-ABE positive clones;
[0023] Figure 5 Sanger sequencing results of pC-ABE positive clones;
[0024] Figure 6 Identification of positive strains after integration of the pN-ABE and pC-ABE recombinant vectors into GS115. Numbers 1-5 are clones identified after pN-ABE integration, and numbers 6-10 are clones identified after pC-ABE integration.
[0025] Figure 7 . Schematic diagram of the pTEF-AC vector structure;
[0026] Figure 8 Agarose gel electrophoresis results after pTEF-AC colony PCR;
[0027] Figure 9 Sanger sequencing results of pTEF-AC positive clones;
[0028] Figure 10 Typical mutation results from base A to base G in the target sequence after pTEF-AC was transferred into N-ABE / GS115 and C-ABE / GS115.
[0029] Figure 11 Statistical analysis of Sanger sequencing results of target sequences after pTEF-AC was transferred into N-ABE / GS115 and C-ABE / GS115.
[0030] Figure 12 Statistical analysis of Sanger sequencing results of target sequences after pTEF-AC was transferred into N-ABE / GS115 and ABEham / GS115, respectively.
[0031] Figure 13 Statistical analysis of high-throughput sequencing results after pTEF-AC was transferred into N-ABE / GS115 and ABEham / GS115.
[0032] Figure 14 . ABEham sequence mutation alignment. DETAILED DESCRIPTION
[0033] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.
[0034] Experimental materials used in the examples of the present invention
[0035] Pichia pastoris ( Pichia pastoris ) GS115 is preserved by our laboratory; Escherichia coli ( Escherichia coli TOP 10 was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. YPD (1% yeast powder, 2% peptone, 2% glucose) medium was used for routine yeast cell culture, while YPDS (1% yeast powder, 2% peptone, 2% glucose, 1 M sorbitol) and MD (2% glucose, 1.34% yeast nitrogen base (YNB)) medium were used for screening yeast mutant strains. LB (0.5% yeast powder, 1% peptone, 1% sodium chloride) and LLB (0.5% yeast powder, 1% peptone, 0.5% sodium chloride) medium were used for culturing Escherichia coli. Solid media were supplemented with 20 g / L agar powder as a selection marker. Ampicillin (A+) and zeocin (Z+) concentrations were 100 mg / L and 100 mg / L, respectively.
[0036] Restriction enzymes, ligases, and dephosphorylases were purchased from New Brunswick Biotechnology Co., Ltd.; KOD FX Neo was purchased from Toyobo; the homologous recombination kit was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; the plasmid extraction kit was purchased from Qiagen; the nucleic acid gel recovery kit was purchased from Omega Bio-Tek; peptone and yeast powder were purchased from OXOID; agar powder was purchased from Beijing Solebao Co., Ltd.; agarose and sorbitol were purchased from Sigma; ampicillin was purchased from Saitonc; bleomycin was purchased from Invitrogen; and other chemical reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. The electroporator (GenePulser Xcell) and PCR instrument (C1000 Touch) were purchased from Bio-Rad. Unless otherwise noted, gene sequence synthesis and sequencing were performed by Suzhou GeneWeizhi Biotechnology Co., Ltd.
[0037] Example 1. Construction of ABE expression plasmid and ABE recombinant strain
[0038] 1. Construction of ABE recombinant plasmid
[0039] Adenosine deaminase ABE8e is published as NCBI (GenBank of ABE8e: UNJ19119.1) 20-185 Adenosine deaminase ABE8e is wild type. 20-185 The amino acid sequence is shown in SEQ ID NO.1. The yeast codons were optimized and two wild-type ABE expression plasmids with different sequences were constructed: pN-ABE: pGAP-ABE8e-(GGGGS) 10 -nCas9 (sequence shown in SEQ ID NO. 6) and pC-ABE: pGAP-nCas9-(GGGGS) 10 -ABE8e (sequence shown in SEQ ID NO.7), wherein the nCas9 protein has an amino acid sequence shown in SEQ ID NO.3, and the sequence of the gene encoding the nCas9 protein is shown in SEQ ID NO.4.
[0040] In the present invention, the pGAP-ABE8e-(GGGGS) 10 The key component of -nCas9 (pN-ABE) is obtained by fusion of adenosine deaminase ABE8e to the N-terminus of the CRISPR-associated protein Cas9 mutant (D10A), with a connecting peptide (GGGGS) in the middle of the fusion protein. 10 The Cas9 (D10A) sequence was ligated and the nuclear localization signal sequence (NLS) PKKKRKV (SEQ ID NO. 5) was incorporated into the C-terminus of the Cas9 (D10A) sequence. In addition, the nuclear localization signal sequence (PKKKRKV) was also incorporated into the N-terminus of ABE8e to ensure that the fusion protein can be accurately localized to the cell nucleus. The plasmid map is attached. Figure 1 .
[0041] In the present invention, the pGAP-nCas9-(GGGGS) 10 The key component of -ABE8e (pC-ABE) is adenosine deaminase ABE8e fused to the C-terminus of the CRISPR-associated protein Cas9 mutant (D10A), with a connecting peptide (GGGGS) in the middle of the fusion protein. 10 The Cas9 (D10A) sequence was connected and the nuclear localization signal sequence (NLS) PKKKRKV (SEQ ID NO.5) was incorporated into the C-terminus of the Cas9 (D10A) sequence to ensure that the fusion protein can be accurately localized to the cell nucleus. The plasmid map is attached. Figure 1 .
[0042] The designed vectors were sent to Beijing Sino-US Taihe Biotechnology Co., Ltd. for synthesis to obtain the recombinant vectors pN-ABE and pC-ABE. The recombinant vectors were then transformed into Escherichia coli. The results of colony PCR and agarose gel electrophoresis were as follows: Figure 2 and Figure 3 As shown in the figure, the target size bands (1022 bp and 835 bp) were successfully amplified. Figure 4 and Figure 5 The Sanger sequencing results confirmed that the ABE recombinant vector was correct.
[0043] 2. Construction of ABE / GS115 recombinant strain
[0044] The recombinant vectors pN-ABE and pC-ABE were integrated into the genome of Pichia pastoris GS115, and then positive strains were identified and sequenced. Nhe I am HIS4 The circular vector was linearized on the element, and then the linearized vector was transformed into GS115 competent cells by electroporation and cultured for 2-3 days. Positive clones were then identified using primers GAP-F / CYC-R: (CGTCGCTGGCAATAATAGCG / CCTTCCTTTTCGGTTAGAGC) and confirmed by sequencing.
[0045] The successfully constructed recombinant vector was linearized and then transferred into GS115 competent cells by electroporation. In the present invention, the ABE / GS115 recombinant strain constructed by the pN-ABE recombinant vector was named N-ABE / GS115 strain, and the ABE / GS115 recombinant strain constructed by the pC-ABE recombinant vector was named C-ABE / GS115 strain. Figure 6 Agarose gel electrophoresis results showed that positive clones were preliminarily identified, and subsequent Sanger sequencing indicated that the recombinant vector was successfully integrated to obtain the ABE / GS115 recombinant strain.
[0046] Example 2. Functional evaluation of the Pichia pastoris ABE system
[0047] 1. Cloning of recombinant gRNA-AC vector
[0048] pTEF is used as the gRNA expression vector and is kept in this laboratory. Unless otherwise specified in this article, all gRNA expression vectors carry the bleomycin resistance gene. Construction of gRNA-AC expression vector: XM_002489805.1 The gene selects a sequence rich in base A ( XM_002489805.1 2745-2746:SEQ ID NO.8:ACACAACACACACACATTAG) to comprehensively characterize the editing efficiency and editing window of the adenine base editor. The target fragment was obtained by synthesizing primers AC-F / AC-R:AGGACGAAACGAGTAAGCTCGTCTCAGATCACACAACACACACACATTAG / ATTTTAACTTGCTATTTCTAGCTCTAAAACCTAATGTGTGTGTGTTGTGT and overlapping extension PCR. Subsequently, the correct pTEF-AC was constructed through seamless cloning, transformation and identification and sequencing. Its structural schematic is shown in the figure. Figure 7 As shown, Figure 8 Agarose gel electrophoresis and Figure 9 According to the Sanger sequencing results, the recombinant gRNA vector pTEF-AC was successfully constructed.
[0049] The present invention designed and constructed a pTEF-AC expression vector based on the sequence on the yeast genome, and named it gRNA-AC.
[0050] 2. Functional Verification of ABE Base Editing
[0051] gRNA-AC was transferred into N-ABE / GS115 and C-ABE / GS115 competent cells by electroporation, and positive clones were screened on YPDS Z+ solid plates. Then, 10 single clones were picked and the AC target sequence was amplified using primers AC-F2 / R2 (AAGTCTTTGTTTCAGGTCGTC / CGGTGCTGAATAAGTCCCAA) and sent for sequencing analysis to analyze the editing of base A on the target. The experiment was repeated three times. Sanger sequencing results showed that both N-ABE and C-ABE could achieve base A to base G mutation ( Figure 10 ). The specific statistical analysis results of base editing of N-ABE and C-ABE are as follows. Figure 11As shown, the editing windows of both N-ABE and C-ABE are A3-A14. In N-ABE, the editing efficiency at positions A5 and A6 is 6% (94% vs 88%) and 20% (85% vs 65%) higher than that of C-ABE. The editing efficiency at other positions is as follows: A3 (25% vs 21.67%), A10 (35.67% vs 35%), A12 (25% vs 18.33%), and A14 (7.67% vs 6.67%). Only at position A8 is the editing efficiency of N-ABE lower by 28.33% compared to C-ABE (16.67% vs 45%). These results indicate that the overall editing efficiency of N-ABE is higher than that of C-ABE, but the editing windows of both ABE systems based on ABE8e are wider. For gene therapy, especially for the treatment of genetic diseases caused by single nucleotide variants, a wide base editing window can lead to misediting at off-target sites, increasing potential side effects and risks. Therefore, to obtain a base editing tool with a more precise and specific targeting range, we directed the modification of the ABE8e nuclease through N-ABE self-evolution.
[0052] Example 3. Acquisition of adenosine deaminase mutants
[0053] 1. Construction of gRNA-ABEs Mutation Library
[0054] Targeting ABE8e 1-501 48 pairs of primers were designed based on the full-length nucleotide sequence to construct 48 targeting gRNAs for ABE8e. First, the fragments containing the targeting sequence were obtained by overlapping extension PCR with 48 pairs of primers, and restriction endonucleases were used to Afl Ⅱ The pTEF vector was digested with a single enzyme and purified and recovered. Then, these 48 fragments were inserted into the pTEF vector by seamless cloning to obtain recombinant products. The 48 recombinant products were transformed into TOP10 competent cells, and the positive clones were identified by primers gRNA-F / 3AOX (AGTAAGCTCGTCTCAGATCTTAAG / GCAAATGGCATTCTGACATCC) and sequenced to obtain 48 ABE8e 1-501 Recombinant gRNAs with full gene coverage were generated. These 48 gRNAs were mixed in equal amounts to generate the gRNA-ABEs mutation library. The sequences of the 48 primer pairs targeting ABE8e are shown in Table 1, and the targeting sequences of the 48 gRNA-ABEs are shown in Table 2.
[0055] Table 1. ABE8e targeting primer sequences
[0056]
[0057] Table 2. ABE8e targeting sequences
[0058]
[0059]
[0060] 2. Electroporation of gRNA-ABEs plasmid library into N-ABE competent cells
[0061] The gRNA-ABEs plasmid library was transformed into N-ABE competent cells by electroporation, and positive clones were screened on YPDS Z+ solid plates. The ABE8e mutant sequence was amplified using primers GAP-F / GAP-R (CGTCGCTGGCAATAATAGCG / TGGCGATCGGTATTGCCCAGA) and sequenced. We obtained 51 ABEs carrying the ABE8e mutant.
[0062] Example 4. Verification of the base editing function of adenosine deaminase mutants
[0063] gRNA-AC was electroporated into 51 ABEs competent cells carrying the ABE8e mutant, and positive clones were screened on YPDS Z+ solid plates. Ten single clones were then picked and the AC sequence was amplified using primers AC-F2 / R2 (AAGTCTTTGTTTCAGGTCGTC / CGGTGCTGAATAAGTCCCAA) and sequenced to analyze the editing of the target base A. Statistical analysis showed that one ABE carrying the ABE8e mutant showed a narrower editing window and more precise editing of the base A at position 5 ( Figure 12 ).like Figure 12 As shown, ABEham has efficient base editing similar to that of N-ABE only at position A5, with an efficiency of up to 97.5%. Compared with N-ABE, the base editing efficiencies of A6 (27.5% vs 92.5%), A3 (2% vs 35%), A8 (1% vs 17.5%), A10 (2.5% vs 37.5%), A12 (0% vs 32.5%) and A14 (0% vs 12.5%) in ABEham are significantly reduced. The above results indicate that ABEham is highly efficient and specific for base A at position 5 in the target sequence.
[0064] To further analyze the editing efficiency and editing window of ABE, we transferred gRNA-AC into N-ABE and ABEham competent cells, and performed high-throughput sequencing analysis on all positive clones screened on YPDS Z+ solid plates. Figure 13 As shown in Figure 2, compared with N-ABE, only the editing efficiency of the fifth base A to base G in the editing window of ABEham is higher, which is 88.89%. Moreover, the editing efficiency of each A site of ABEham is significantly lower than that of N-ABE, just like Sanger sequencing. The high-throughput sequencing results are basically consistent with the above Sanger sequencing results. In addition, the sequence of the ABE8e mutant in ABEham was sequenced and analyzed, and the results are as follows: Figure 14 As shown, the ABE8e mutant sequence carries base mutations at two sites, resulting in amino acid mutations of C141R and L144P. The modified ABEham can achieve editing of specific bases within a narrow editing window. This editor has advantages in certain specific gene therapies, such as genetic diseases caused by single nucleotide mutations. Although its editing window is narrow, this type of editor may have higher editing accuracy and specificity. For studies that require precise control of the location and number of gene mutations, such as single-base mutations in specific genes or precise replacement of specific sequences, this base editor with a narrow editing window will become an ideal choice. At the same time, it also shows great potential in preventing misediting of non-target sites, which is expected to reduce potential side effects and risks.
Claims
1. An adenosine deaminase mutant, characterized in that: The adenosine deaminase mutant is obtained by performing C141R and L144P mutations on the wild type sequence shown in SEQ ID NO.
1.
2. A polynucleotide encoding the adenosine deaminase mutant according to claim 1, characterized in that: The sequence of the polynucleotide is shown in SEQ ID NO.
2.
3. A Pichia pastoris base editor, characterized in that The Pichia pastoris base editor is A DNA molecule composition, comprising a first expression plasmid and a second expression plasmid, wherein the first expression plasmid contains a polynucleotide encoding an nCas9 protein and a polynucleotide encoding the adenosine deaminase mutant according to claim 1, and the second expression plasmid contains a gRNA, wherein the amino acid sequence of the nCas9 protein is as shown in SEQ ID NO. 3, and the spacer sequence of the gRNA is 20 nt in length.
4. The Pichia pastoris base editor according to claim 3, wherein The sequence of the polynucleotide encoding the adenosine deaminase mutant is shown in SEQ ID NO.2, and the sequence of the polynucleotide encoding the nCas9 protein is shown in SEQ ID NO.
4. The polynucleotide encoding the adenosine deaminase mutant and the polynucleotide encoding the nCas9 protein are separated by a sequence encoding (GGGGS). 10 The polynucleotides of the linked peptides are linked.
5. The Pichia pastoris base editor according to claim 4, wherein The polynucleotide encoding the adenosine deaminase mutant in the first expression plasmid is located at the 5′ end of the polynucleotide encoding the nCas9 protein and is fused to the polynucleotide encoding the nCas9 protein by encoding (GGGGS). 10 The polynucleotides of the connecting peptide are connected, wherein the 5′ end of the polynucleotide encoding the adenosine deaminase mutant is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5, and the 3′ end of the gene encoding the nCas9 protein is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.
5.
6. The Pichia pastoris base editor according to claim 4, wherein The polynucleotide encoding the nCas9 protein in the first expression plasmid is located at the 5' end of the polynucleotide encoding the adenosine deaminase mutant and is connected to the polynucleotide encoding the adenosine deaminase mutant by encoding (GGGGS) 10 The polynucleotide of the connecting peptide is connected, wherein the 3′ end of the polynucleotide encoding the nCas9 protein is provided with a polynucleotide encoding a nuclear localization signal peptide as shown in SEQ ID NO.5.
Citation Information
Patent Citations
Base editing system for realizing C to A and C to G base mutation and application thereof
CN111763686A
Single-base editing tool TaC9-ABE and application thereof
CN113774085A