Ratio-type electrochemical biosensor preparation and L1CAM type extracellular vesicle detection method

Abstract

The invention provides a ly12 nucleic acid aptamer. The ly12 nucleic acid aptamer contains a single-stranded DNA (deoxyribonucleic acid) with the following sequence: 5 '-HS-SH-(CH2) 6-TMBTTTTTTTAGGATAGGGGGTAGCTGGTCGTGTTTGGGTTTTGGGTCTTG-3', a single-stranded DNA (deoxyribonucleic acid) with the following sequence, a single-stranded DNA (deoxyribonucleic acid) with the following sequence, a single-stranded DNA (deoxyribonucleic acid) with the following sequence, and a single-stranded DNA (deoxyribonucleic acid) with the following sequence, the invention further provides a GE / MB-y12 / MCH / L1CAM-EVs (at) DSPE-PEG ratio type electrochemical biosensor as well as preparation, detection and application of the GE / MB-y12 / MCH / L1CAM-EVs (at) DSPE-PEG ratio type electrochemical biosensor. According to the invention, the oxidation-reduction characteristic of DSPE-PEG molecules is combined with a ratio type electrochemical sensing technology, and a compound formed through DSPE-PEG modification not only realizes stable electrochemical signal output, but also obviously enhances the detection signal of L1CAM-EVs. According to the invention, an electrochemical detection strategy which is sensitive, efficient and simple and convenient to operate is constructed, and a brand new thought and technical support are provided for accurate detection of the L1CAM-EVs.

Description

Technical Field

[0001] The invention belongs to the field of biochemical detection, and specifically relates to a yly12 nucleic acid aptamer, a ratiometric electrochemical biosensor, and a preparation method and application thereof. Background Art

[0002] Brain-derived extracellular vesicles (BDEVs) are heterogeneous double-layer membrane nanovesicles released by a variety of nerve cells in the central nervous system. They carry biomolecular information from their source cells and play an important role in the physiological and pathological states of the brain. By analyzing the number and composition of BDEVs, important process information of neurological diseases can be obtained, which helps in early diagnosis, disease monitoring and treatment strategy evaluation of the disease. Among them, vesicles (L1CAM-EVs) that specifically express L1CAM (neural cell adhesion molecule L1) protein in BDEVs are considered to be important markers for the diagnosis of neurological diseases. Detecting the number and accurate quantification of L1CAM-EVs in plasma is crucial for disease diagnosis, disease course tracking and efficacy evaluation.

[0003] However, current methods for detecting L1CAM-EVs have many limitations. For example, nanoparticle tracking analysis (NTA) cannot distinguish the source of vesicles, and has low sensitivity for detecting low-concentration and small-size vesicles; flow cytometry is difficult to accurately detect all L1CAM-EVs due to insufficient equipment resolution; transmission electron microscopy (TEM) sample preparation is cumbersome and difficult to achieve large-scale sample analysis; Western blot technology only provides relative quantitative information and cannot accurately measure vesicle concentration. Therefore, a method that is simple to operate, highly sensitive and highly specific is urgently needed to achieve accurate quantification of L1CAM-EVs.

[0004] Electrochemical detection has been widely used in the clinical field due to its advantages of rapidity, low cost and simple operation. However, in order to improve the detection sensitivity, existing electrochemical detection methods mostly rely on nucleic acid amplification, nanomaterials or enzyme signal amplification strategies. These complex steps weaken its ease of use and low cost advantages. In recent years, membrane affinity molecules have been used for the separation of EVs due to their high affinity to the phospholipid bilayer of extracellular vesicles. Summary of the invention

[0005] The purpose of the present invention is to provide a ratiometric electrochemical biosensor that can quickly and accurately detect L1CAM-EVs in plasma in order to solve the above technical problems.

[0006] In order to achieve the above invention objectives, the present invention provides a yly12 nucleic acid aptamer, wherein the yly12 nucleic acid aptamer is a single-stranded DNA containing the following sequence: 5'-HS-SH-(CH2)6-T MB TTTTTTTTAGGATAGGGGGT AGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3'.

[0007] On the other hand, the present invention also provides a GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor containing the yly12 nucleic acid aptamer.

[0008] On the other hand, the present invention also provides a method for preparing the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor, the method comprising the following steps:

[0009] (1) Pretreatment of gold electrodes;

[0010] (2) Preparation of modified yly12 aptamer-modified gold electrode;

[0011] (3) Modification of MCH antifouling coating;

[0012] (4) modified yly12 aptamer captures L1CAM-EVs;

[0013] (5) DSPE-PEG modified vesicles to form the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor.

[0014] Preferably, in step (1), the pretreatment step of the gold electrode is as follows: polishing the gold electrode with alumina powder with a particle size of 0.3 μm and 0.05 μm until the surface of the gold electrode is as smooth as a mirror, and then ultrasonically cleaning it with deionized water; then cleaning it with 0.1M NaOH solution for 10 minutes, 0.1M HCl solution for 5 minutes, piranha solution for 3 minutes, and then ultrasonically cleaning it with ethanol and deionized water for 5 minutes.

[0015] Preferably, in step (2), the preparation steps of the modified yly12 aptamer-modified gold electrode are as follows: immerse the pretreated gold electrode in a 1 μM modified yly12 aptamer solution and incubate at 4° C. for 12 hours.

[0016] Preferably, in step (3), the modification step of the MCH antifouling coating is as follows: the gold electrode treated in step (2) is soaked in a 0.1 mM MCH solution.

[0017] Preferably, in step (4), the modified yly12 aptamer captures L1CAM-EVs as follows: 10 μL of L1CAM-EVs is drop-coated on the electrode treated in step (3) to capture the target.

[0018] Preferably, in step (5), the DSPE-PEG modified vesicles are as follows: 10 μL of 1 μM DSPE-PEG solution is drop-coated on the electrode surface treated in step (3), incubated at 4° C. for 30 min to form a complex, and then washed with PBS.

[0019] The present invention also provides a method for detecting L1CAM-EVs based on the GE / MB-yly12 / EVs@DSPE-PEG biosensor, the method comprising: fixing the yly12 nucleic acid aptamer on the electrode surface as an affinity capture ligand, using MCH as an anti-fouling coating to block the remaining active sites on the gold electrode surface, and after capturing L1CAM-EVs, modifying the vesicles with DSPE-PEG to form a complex EVs@DSPE-PEG with an electrochemical signal, and then detecting.

[0020] The method of the present invention fixes the yly12 aptamer carrying the methylene blue signal tag on the electrode as an affinity capture ligand to form a first signal molecule, captures L1CAM-EVs and then modifies DSPE-PEG to form a complex EVs@DSPE-PEG to form a second signal molecule and amplifies the detection signal to form a highly efficient amplified ratiometric electrochemical biosensor.

[0021] The present invention provides a ratiometric electrochemical biosensor and detection method for rapidly and accurately detecting L1CAM-EVs in plasma. The method utilizes the yly12 nucleic acid aptamer for the L1CAM protein, extends its sequence and labels it with a methylene blue (MB) signal tag. The yly12 nucleic acid aptamer is fixed on the electrode surface as an affinity capture ligand, and MCH is used as an antifouling coating to block the remaining active sites on the gold electrode surface. Subsequently, the yly12 nucleic acid aptamer captures L1CAM-EVs, and the L1CAM-EVs are modified by DSPE-PEG to form a complex EVs@DSPE-PEG with electrochemical properties, and the electrochemical signal is successfully enhanced by means of the efficient binding ability of DSPE-PEG. In the absence of complex signal amplification, the detection limit of L1CAM-EVs in this platform is calculated to be 8.92×10 2 particles / mL.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] (1) Using the yly12 nucleic acid aptamer targeting the L1CAM protein, extending its sequence and labeling it with a methylene blue (MB) signal tag can effectively avoid interference from other miscellaneous proteins on the surface of exosomes, thereby significantly improving the specificity of plasma L1CAM-EVs detection;

[0024] (2) The DSPE-PEG-modified complex EVs@DSPE-PEG was used as a redox probe and signal amplification probe to construct a ratiometric electrochemical biosensor by significantly amplifying the electrochemical signal.

[0025] (3) The constructed gold electrode GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor based on the electrochemical analysis platform can quickly and accurately detect L1CAM-EVs in plasma. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the structure of DSPE-PEG and the electrochemical properties of the complex EVs@DSPE-PEG.

[0027] Figure 2 Potential diagram for verifying DSPE-PEG, EVs@DSPE-PEG, and EVs in SWV experiment.

[0028] Figure 3 This is the potential diagram of the MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG modified electrode.

[0029] Figure 4 Cyclic voltammogram of the electrochemical biosensor in a standard solution of brain-derived extracellular vesicles.

[0030] Figure 5 Schematic diagram of the preparation process of GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor and the detection of L1CAM-EVs.

[0031] Figure 6 The current standard curve constructed for the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor to detect different concentrations of L1CAM-EVs.

[0032] Figure 7 Statistical analysis of L1CAM-EVs levels in the plasma of AD, MCI and healthy controls. DETAILED DESCRIPTION

[0033] In order to better illustrate the technical purpose, technical solution and advantages of the present invention, the present invention is further described below in conjunction with the accompanying drawings and specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention, rather than to limit the scope of the present invention.

[0034] The blood was collected from the Department of Laboratory Medicine of Guangdong Provincial Hospital of Traditional Chinese Medicine, using the remaining specimens from patients and healthy examinees. The implementation of the project was approved by the Ethics Committee of Guangdong Provincial Hospital of Traditional Chinese Medicine (Ethics No. ZE2024-189-01).

[0035] 1. Modification and synthesis of yly12 aptamers

[0036] 1.1 Synthesis of modified yly12 aptamers

[0037] The aptamer yly12 that specifically binds to the L1CAM protein has a secondary structure that forms a stem-loop to recognize the L1CAM protein, and the nucleotide sequence is as follows: 5'-AGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3'.

[0038] On the basis of maintaining the above sequence, in order to improve the stability of the DNA aptamer, 9 thymine deoxyribonucleotides (T) were added to one end. On this basis, the synthesis of yly12 nucleic acid aptamer was carried out. In order to enable the nucleic acid aptamer to be connected to the gold electrode, -SH modification (dithiol hexaalkane modification) was performed at the 5' end for annealing. In addition, the methylene blue (MB) signal tag was modified on the first thymine deoxynucleotide (T) of the extended chain to form an electrical signal. The modified aptamer was synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0039] The modified complete yly12 aptamer sequence is as follows:

[0040] 5'-HS-SH-(CH2)6-T MB TTTTTTTTAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3'.

[0041] 2. Preparation of GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor

[0042] 2.1 Preparation of DSPE-PEG solution

[0043] 2 mg of DSPE-PEG was dissolved in 10 mL of PBS solution to form a 100 μM concentration stock solution, and then 10 μL of the 100 μM stock solution was taken and diluted to 1 mL with PBS to form a 1 μM DSPE-PEG solution.

[0044] 2.2 Preparation of modified yly12 aptamer solution

[0045] The modified yly12 nucleic acid aptamer was added to a certain amount of TE buffer to prepare a 100 μM stock solution. 5 μL of the stock solution was added to 455 μL of pure water to dilute it to a 1 μM working solution.

[0046] 2.3 Extraction of L1CAM-EVs

[0047] Remove the plasma sample and place it on ice for later use. Centrifuge the plasma sample at 2000×g for 20 minutes at room temperature to remove cells and debris. Transfer the required volume of clarified plasma to a new test tube and add 0.5 volume of 1× PBS. Vortex the sample to mix the sample with PBS thoroughly. Add 0.2 volume (total volume = plasma + PBS) of exosome precipitation reagent (Total Exosome Isolation Kit (from Plasma), Cat. No. 4484450, Invitrogen) to the sample. TM After standing at room temperature for 10 min, the sample was centrifuged at 10,000 × g for 5 min at room temperature. The supernatant was then removed by aspiration and reconstituted with PBS.

[0048] L1CAM-EVs were isolated from total EVs using immunoprecipitation. The suspended total EVs were treated with 4 μg of L1CAM antibody (Cat. No. 67115-1-Ig, Wuhan Tri-Tac) in 50 μL 3% BSA-PBS and incubated at 4°C with gentle rotation for 1 hour. Subsequently, 15 μL of streptavidin Ultralink resin (Cat. No. 53113, ThermoScientific) mixed with 25 μL 3% BSA was added. TM ), and the mixture was incubated with gentle rotation at 4 °C for another 30 min. After incubation, the mixture was centrifuged at 200 × g for 10 min at 4 °C, and the supernatant was discarded. The resulting precipitate was suspended in 50 μL 0.1 M glycine-HCl (pH 2.5-3.0) and mixed vigorously for 30 s. The solution was then centrifuged at 4500 × g for 5 min at 4 °C. The supernatant containing the isolated vesicles was carefully collected and its pH was adjusted to neutral using 1× PBS (pH 8.0). Finally, the enriched L1CAM-EVs were stored at -80 °C for future use.

[0049] 2.4 Pretreatment of gold electrode (GE)

[0050] First, the gold electrode was carefully polished with alumina powder with a particle size of 0.3 μm and 0.05 μm until the surface of the gold electrode was as smooth as a mirror, and then ultrasonically cleaned with deionized water. After that, it was cleaned with 0.1M NaOH solution for 10 minutes, 0.1M HCl solution for 5 minutes, piranha solution (31% H2O2 / concentrated H2SO4 mixed in a volume ratio of 1:3) for 3 minutes, and then ultrasonically cleaned with ethanol and deionized water for 5 minutes for use. The conditions for ultrasonic cleaning are: frequency of 40kHz, cleaning time of 5-10 minutes, and temperature controlled at room temperature (20-25°C).

[0051] 2.5 Preparation of modified yly12 aptamer-modified gold electrode

[0052] The pretreated gold electrode was immersed in the modified yly12 aptamer solution (1 μM) and incubated at 4°C for 12 hours. The gold electrode modified with yly12 nucleic acid aptamer (GE / yly12) was washed three times with deionized water and PBS respectively and stored in PBS for further use. Thus, GE / MB-yly12 was formed.

[0053] 2.6 Modification of MCH antifouling coating

[0054] The gold electrode was immersed in 0.1 mM MCH (6-mercapto-1-hexanol) solution to occupy the sites where the aptamer was not bound and prevent nonspecific binding. Thus, GE / MB-yly12 / MCH was formed.

[0055] 2.7 Modified yly12 aptamer captures L1CAM-EVs

[0056] 10 μL of L1CAM-EVs was drop-coated on the electrode to capture the target, forming GE / MB-yly12 / MCH / L1CAM-EVs.

[0057] 2.8 Formation of GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG complex

[0058] 10 μL of 1 μM DSPE-PEG solution was drop-coated on the GE / MB-yly12 / MCH surface, incubated at 4°C for 30 min to form a complex, and then washed with PBS. Thus, a GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor was formed.

[0059] Figure 5 The preparation process of GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor is shown.

[0060] 2.9 Characterization of GE / MB-yly12 / MCH / EVs@DSPE-PEG electrochemical biosensor

[0061] Cyclic voltammetry was used to examine the electroactive [Fe(CN)6] 3- / 4- Whether the sensing interface is successfully prepared in KCl solution (0.1 M) where the probe exists. 3- / 4- The electron transfer efficiency between the electrode and the bare gold electrode is very high, with a strong, reversible and clear current peak. Figure 4 As shown, the electrochemical biosensor is 8 Cyclic voltammogram of 100 particles / mL brain-derived extracellular vesicles standard solution, with a scan rate of 50 mv / s. Figure 4 In the figure, curve a shows the current response of the bare gold electrode (GE), curve b shows that the current decreases after the immobilization of the yly12 nucleic acid aptamer, and curve c shows that the peak current decreases slightly after the introduction of the antifouling coating MCH. This is due to the negative charge and steric hindrance of MCH on [Fe(CN)6] 3- / 4- The repulsive effect resulted in a decrease in the peak current, indicating that the GE / MB-yly12 / MCH biosensor was successfully constructed and could effectively detect L1CAM-EVs. Figure 4 As shown in curve d, the current further decreased; as shown in curve e, with the formation of EVs@DSPE-PEG complex after modification with DSPE-PEG, the current gradually decreased, and finally a ratiometric electrochemical biosensor was formed. 3- / 4- The electrochemical cyclic voltammetry analysis was carried out in the (1:1) solution with a test frequency of 10 -2 ~10 5 Hz, amplitude is 10mV / s.

[0062] 2.10 Detection of L1CAM-EVs using GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG electrochemical biosensor

[0063] Total plasma exosomes were extracted using a plasma exosome extraction kit (Invitrogen), and L1CAM-EVs were extracted using L1CAM antibody. Nanoparticle tracking analysis (NTA) was then performed to detect the concentration of extracted brain-derived exosomes. L1CAM-EVs were diluted with PBS to a concentration of 2.1×10 10 The L1CAM-EVs storage solution was prepared with PBS to a concentration of 2.1×10 3 -2.1×108 The linearity and sensitivity of the L1CAM-EVs solution with a concentration of 100 particles / mL were evaluated, and the linear range of the detection method was then established.

[0064] MB-yly12 / MCH modified gold electrode was dripped with 10 μL L1CAM-EVs for 30 min, washed with deionized water and PBS three times to remove nonspecific adsorption, and then 10 μL (1 μM) DSPE-PEG redox signal amplification electrochemical probe was added to the electrode surface. The solution on the electrode surface was naturally air-dried, then washed with deionized water and PBS three times, and then SWV test was performed. Electrochemical square wave voltammetry analysis was performed in 1xPBS, pH = 7.4 solution, and the test frequency was 10 -2 ~10 5 Hz, with an amplitude of 10mV / s.

[0065] 3. Characterization and electrochemical property verification of DSPE-PEG, EVs@DSPE-PEG, and EVs

[0066] 3.1 Verification of the redox properties of DSPE-PEG in electrolyte solution

[0067] The electrochemical properties of DSPE-PEG were studied in 1×PBS. See the schematic diagram of the experiment for details. Figure 1 .

[0068] The SWV (square wave voltammetry) response of a bare gold electrode in a 1 μM DSPE-PEG solution shows a peak current of approximately 0.3 V, corresponding to the electrochemical redox signal of DSPE-PEG. DSPE-PEG is an amphiphilic molecule composed of hydrophobic DSPE (stearoylphosphatidylethanolamine) and hydrophilic PEG (polyethylene glycol). The amide bond between DSPE and PEG can provide an electrochemical signal in the electrolyte solution, forming a redox potential, such as Figure 2 shown.

[0069] Electrochemical square wave voltammetry was performed in 1× PBS solution at a test frequency of 10 -2 ~10 5 Hz, the amplitude of the square wave is between 10 and 50 mV, the step voltage range is between 1 and 5 mV, usually set to 2 mV, and the voltage range is set to -0.2 V to 0.7 V for quantitative analysis.

[0070] 3.2 Verification of the redox properties of EVs@DSPE-PEG in electrolyte solution

[0071] The electrochemical properties of EVs@DSPE-PEG were studied in 1× PBS.

[0072] 1 μM DSPE-PEG solution was modified in EVs with a particle concentration of 1 nM (obtained by extraction according to the method 2.3 above) to obtain the optimal DSPE-PEG modified EVs ratio and form a complex. The specific operation is: 20 μL of 1× PBS solution containing 1 μM DSPE-PEG was coated on a screen-printed gold electrode and analyzed by square wave voltammetry (SWV). Then, 20 μL EVs@DSPE-PEG solution (1 nM EVs, 1 μM DSPE-PEG) was analyzed under the same SWV conditions. The experimental parameters of SWV were: potential scanning range from -0.1V to 0.8V, step potential of 2mV, amplitude of 20mV, and frequency of 20Hz.

[0073] The results showed that an obvious peak current appeared on the electrode surface at about 0.3 V, indicating that the EVs@DSPE-PEG complex had a significant redox signal, such as Figure 2 shown.

[0074] 3.3 Verification of the redox properties of EVs in electrolyte solutions

[0075] The electrochemical properties of EVs were investigated in 1× PBS.

[0076] Validation was performed on the electrode by directly detecting 1 nM EVs in PBS. SWV analysis was performed on a single EV solution (1 nM). The experimental parameters for SWV were: potential scan range from -0.1 V to 0.8 V, step potential of 2 mV, amplitude of 20 mV, and frequency of 20 Hz.

[0077] The SWV results showed no peak current, confirming that EVs alone in the solution have no redox properties and cannot generate electrical signals, such as Figure 2 shown.

[0078] 3.4 Verification of ratiometric signals of MB-yly12 and EVs@DSPE-PEG modified electrodes

[0079] The MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG modified electrode showed two oxidation peaks at -0.3 V and 0.3 V relative to the silver chloride reference electrode ( Figure 3 , curve a). In contrast, the MB-yly12 / MCH / L1CAM-EVs modified electrode without DSPE-PEG only showed a -0.3 V peak ( Figure 3 , curve b), while no peak was observed on the MCH / L1CAM-EVs@DSPE-PEG electrode without MB-yly12 modification ( Figure 3, curve c). These results indicate that the -0.3 V peak corresponds to the redox potential of methylene blue (MB), while the 0.3 V peak is related to the redox potential of EVs@DSPE-PEG.

[0080] Using MB-derived peak current as reference and DSPE-PEG current as output signal, the ratio (I DSPE / I MB ) enables ratiometric detection of L1CAM-EVs. In addition, the higher DSPE-PEG current compared with MB is due to the presence of multiple DSPE-PEG tags on each L1CAM-EV, which improves the sensitivity.

[0081] 4. Performance evaluation and clinical application of GE / MB-yly12 / MCH / EVs@DSPE-PEG electrochemical biosensor

[0082] 4.1 Electrochemical detection platform of L1CAM-EVs based on MB-yly12 aptamer

[0083] The yly12 nucleic acid aptamer targeting L1CAM protein was used to extend its sequence and label it with methylene blue (MB) signal tag. The yly12 nucleic acid aptamer was immobilized on the electrode surface as an affinity capture ligand, and MCH was used as an antifouling coating to block the remaining active sites on the gold electrode surface. Subsequently, the yly12 nucleic acid aptamer captured L1CAM-EVs, and L1CAM-EVs were modified by DSPE-PEG to form a complex EVs@DSPE-PEG with electrochemical properties, and the electrochemical signal was successfully amplified with the help of the efficient binding ability of DSPE-PEG.

[0084] The GE / MB-yly12 / MCH / EVs@DSPE-PEG electrochemical ratio biosensor of the present invention has good detection performance, short analysis time and low cost. Figure 5 Shown is a schematic diagram of the preparation process of the GE / MB-yly12 / MCH / EVs@DSPE-PEG electrochemical biosensor of the present invention and the detection of L1CAM-EVs.

[0085] 4.2 Performance evaluation of GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor

[0086] In order to verify that the constructed GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor platform can be used for the quantitative detection of brain-derived extracellular vesicles, a standard curve of brain-derived extracellular vesicles extracted from plasma was established using the platform at a concentration of 2.1×10 3particles / mL-2.1×10 8 particles / mL, as the concentration increases I DSPE / I MB The value also increases accordingly. Net current ratio change value (I DSPE / I MB ) changes in a linear relationship with the concentration of L1CAM-EVs (e.g. Figure 6 As shown), the relationship satisfies the equation Y = 0.2699lg [EVs] + 0.4496 (R 2 =0.9916). In addition, the total detection time of the biosensor was about 35 min, which was shorter than that of the ELISA-based method.

[0087] In order to further evaluate the selectivity of the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratio electrochemical biosensor, extracellular vesicles derived from L-02, RWPE-1 and BEAS-2B cells were selected to evaluate the selectivity of the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratio electrochemical biosensor of the present invention.

[0088] When pure brain-derived extracellular vesicles (L1CAM-EVs) or a mixture containing L1CAM-EVs (Mixture) were present in the test sample, I DSPE / I MB When exosomes from other sources were used as analytes, I DSPE / I MB The values ​​did not change significantly. The results showed that the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor of the present invention has a high specificity for L1CAM-EVs.

[0089] 4.3 GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor for detection of actual samples

[0090] NTA (Nanoparticle Tracking Analysis) is the current mainstream method for detecting exosomes. However, NTA cannot distinguish vesicles from different sources, such as whether they come from the brain. In addition, NTA may have difficulty detecting smaller vesicles, such as vesicles smaller than 30 nanometers. Due to the low content of L1CAM-EVs, the detection limit of NTA is usually around 1×10 6 particles / mL, and low concentrations of L1CAM-EVs were difficult to detect.

[0091] Samples to be tested: (1) AD group: plasma samples from 25 patients with Alzheimer's disease who visited Guangdong Provincial Hospital of Traditional Chinese Medicine from August 2023 to April 2024, including 15 males and 10 females with an average age of 74 years old. All patients met the diagnostic criteria for Alzheimer's disease; (2) MCI group: plasma samples from 18 patients with mild cognitive impairment who visited Guangdong Provincial Hospital of Traditional Chinese Medicine from August 2023 to April 2024, including 7 males and 11 females with an average age of 60 years old. All patients met the diagnostic criteria for Alzheimer's disease; (3) Non-AD group (normal control): plasma samples from 25 normal elderly people, all of whom were normal elderly people undergoing physical examinations in the hospital and not patients with Alzheimer's disease. All samples were obtained by fasting venous separation of serum and stored at -80°C. This study was approved by the Ethics Committee of Guangdong Provincial Hospital of Traditional Chinese Medicine (Ethics Number: ZE2024-189-01).

[0092] The above samples were tested using the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor of the present invention. The test results are shown in Figure 7 As shown, the increase in the proportion of L1CAM-EVs occurred in elderly AD patients, and the proportions in the AD group and MCI group were higher than those in the non-AD group (Control), P<0.05. The differences in the current ratios of the two groups were statistically significant, P<0.05. In the AD group, the sensitivity of the GE / MB-yly12 / MCH / EVs@DSPE-PEG ratiometric electrochemical biosensor of the present invention was good, and the detection rate could reach 8.92×10 2 particles / mL.

[0093] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A yly12 nucleic acid aptamer, characterized in that: The yly12 nucleic acid aptamer is a single-stranded DNA containing the following sequence: 5'-HS-SH-(CH2)6-T MB TTTTTTTTAGGATAGGGGGTAGCTCGGTCGTGTTTTTGGGTTGTTTGGTGGGTCTTCTG-3'.

2. A GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor, characterized in that Contains the yly12 nucleic acid aptamer according to claim 1.

3. The method for preparing the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor according to claim 2, characterized in that: The method comprises the following steps: (1) Pretreatment of gold electrodes; (2) Preparation of modified yly12 aptamer-modified gold electrode; (3) Modification of MCH antifouling coating; (4) modified yly12 aptamer captures L1CAM-EVs; (5) DSPE-PEG modified vesicles to form the GE / MB-yly12 / MCH / L1CAM-EVs@DSPE-PEG ratiometric electrochemical biosensor.

4. The method according to claim 3, characterized in that Preferably, in step (1), the pretreatment step of the gold electrode is as follows: polishing the gold electrode with alumina powder with a particle size of 0.3 μm and 0.05 μm until the surface of the gold electrode is as smooth as a mirror, and then ultrasonically cleaning it with deionized water; then cleaning it with 0.1M NaOH solution for 10 minutes, 0.1M HCl solution for 5 minutes, piranha solution for 3 minutes, and then ultrasonically cleaning it with ethanol and deionized water for 5 minutes.

5. The method according to claim 3, characterized in that: In the step (2), the preparation steps of the modified yly12 aptamer-modified gold electrode are as follows: the pretreated gold electrode is immersed in a 1 μM modified yly12 aptamer solution and incubated at 4° C. for 12 hours.

6. The method according to claim 3, characterized in that In the step (3), the modification step of the MCH antifouling coating is as follows: the gold electrode treated in the step (2) is soaked in a 0.1 mM MCH solution.

7. The method according to claim 3, characterized in that In the step (4), the modified yly12 aptamer captures L1CAM-EVs as follows: 10 μL L1CAM-EVs are dripped onto the electrode treated in step (3) to capture the target.

8. The method according to claim 3, characterized in that In step (5), the DSPE-PEG modified vesicles are as follows: 10 μL of 1 μM DSPE-PEG solution is drop-coated on the electrode surface treated in step (3), incubated at 4° C. for 30 min to form a complex, and then washed with PBS.

9. A method for detecting L1CAM-EVs based on the GE / MB-yly12 / L1CAM-EVs@DSPE-PEG biosensor according to claim 2, characterized in that: The method comprises: fixing the yly12 nucleic acid aptamer described in claim 1 on the electrode surface as an affinity capture ligand, using MCH as an anti-fouling coating to block the remaining active sites on the gold electrode surface, and after capturing L1CAM-EVs, modifying the vesicles with DSPE-PEG to form a complex EVs@DSPE-PEG with an electrochemical signal, and then detecting.

10. Use of the yly12 nucleic acid aptamer according to claim 1 in the preparation of an electrochemical biosensor.

Images