A pumpkin salt-tolerant molecular marker, a kasp primer combination and application thereof

By developing molecular markers for salt tolerance in pumpkin and their KASP primer combinations, the problems of long identification cycle, high cost, and low accuracy in pumpkin salt tolerance identification have been solved, achieving efficient, accurate, and pollution-free material screening and variety breeding for pumpkin salt tolerance identification.

CN119913280BActive Publication Date: 2025-11-25NINGBO ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510283191.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-11
Publication Date
2025-11-25
Estimated Expiration
2045-03-11

AI Technical Summary

Technical Problem

The breeding of salt-tolerant pumpkin varieties is a long process with high costs and low accuracy, and existing molecular marker-assisted breeding technology has not been effectively applied.

Method used

We developed a molecular marker for salt tolerance in pumpkin and its KASP primer combination. Through genotyping and phenotypic identification, we discovered functional non-synonymous mutation sites that are different from the published salt tolerance sites. We designed related molecular markers and verified their effectiveness in screening for salt tolerance in pumpkin.

Benefits of technology

It significantly improves the efficiency and accuracy of salt tolerance identification in pumpkins, enabling efficient and accurate differentiation between extremely salt-tolerant and salt-sensitive materials, and can be used for pumpkin germplasm resource creation and variety breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005306362020000061
    Figure BDA0005306362020000061
  • Figure BDA0005306362020000062
    Figure BDA0005306362020000062
  • Figure BDA0005306362020000071
    Figure BDA0005306362020000071
Patent Text Reader

Abstract

The application discloses a pumpkin salt-tolerant molecular marker, a KASP primer combination and application thereof, and belongs to the technical field of plant resistance breeding. The sequence of the pumpkin salt-tolerant molecular marker is shown as SEQ ID NO. 1, wherein n is T / C; when n is T, the T genotype corresponds to a salt-sensitive phenotype; when n is C, the C genotype corresponds to a salt-tolerant phenotype; the pumpkin salt-tolerant molecular marker is applied to screening of salt-tolerant pumpkin materials or salt-tolerant pumpkin breeding; the application also discloses a KASP primer combination for detecting the pumpkin salt-tolerant molecular marker, and the sequences are as follows: a salt-sensitive site combined with an upstream primer shown as SEQ ID NO. 2; a salt-tolerant site combined with an upstream primer shown as SEQ ID NO. 3; and a downstream primer shown as SEQ ID NO. 4. The pumpkin salt-tolerant molecular marker and the KASP primer combination of the molecular marker can significantly distinguish between extremely salt-tolerant and salt-sensitive materials, and can be used for creating salt-tolerant Indian pumpkin germplasm resources and breeding varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant resistance breeding technology, and in particular relates to a salt-tolerant molecular marker for Indian pumpkin and its KASP primer combination and application. Background Technology

[0002] Pumpkin, belonging to the Cucurbita genus of the Cucurbitaceae family, is an annual, creeping herbaceous plant. Native to Mexico and Central America, it is widely cultivated worldwide and boasts rich genetic resources. Pumpkins have well-developed root systems, vigorous growth, strong disease resistance, and can grow and develop normally in poor soils, exhibiting strong adaptability and making them an excellent crop for improving saline-alkali soils. Salt stress is one of the most severe abiotic stresses; excessive salt content affects plant growth and development and can even lead to death. Currently, my country has a large area of ​​saline-alkali land, and this area is continuously expanding, seriously restricting the development of modern agriculture. Improving these potentially valuable saline-alkali lands in an economical and environmentally friendly manner is of great significance to the sustainable development of the rural economy. Commonly used improvement methods include irrigation to leach salt, applying lime, and planting salt-tolerant crops. Planting salt-tolerant crops to improve saline-alkali land is a low-cost and highly efficient method, making it both economical and feasible.

[0003] Currently, the breeding of salt-tolerant pumpkin varieties mainly relies on conventional breeding techniques, including field and laboratory salt stress treatments to identify agronomic traits and physiological developmental changes, followed by screening for salt-tolerant materials and breeding related varieties. This process is characterized by long cycles, high costs, and low accuracy. Molecular marker-assisted breeding techniques, which can significantly improve breeding efficiency and accuracy, have not yet been applied. Therefore, developing relevant molecular markers to improve the salt tolerance of pumpkins is of great significance. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker for salt tolerance in pumpkin, along with its KASP primer combination and application, aiming to solve the problems of long identification cycles, high costs, and low accuracy in pumpkin salt tolerance identification. This invention overcomes the shortcomings of existing breeding methods, such as low efficiency, high cost, and insufficient related genes in selecting salt-tolerant pumpkin varieties. Through genotyping and phenotypic identification, a site that can cause a functional non-synonymous mutation, different from previously published salt tolerance sites, is identified. A related molecular marker is developed, and experimental verification shows its significant effectiveness in screening for pumpkin salt tolerance.

[0005] The objective of this invention is achieved through the following technical solution:

[0006] A salt-tolerant molecular marker for pumpkin, the sequence of which is shown in SEQ ID NO.1:

[0007] AATTCTTAGTAAATCATTAGTTATTTGGGGTTGGGATGTTGGGATGTTGGGTGTT nCTTTTTCT ACTTATTCTATGATTTGATTGTTTTCAGTTGTTTTTAGTGTTTGCA;

[0008] Where n is T / C; when n is T, the phenotype corresponding to the T genotype is salt sensitive; when n is C, the phenotype corresponding to the C genotype is tolerant.

[0009] The above-mentioned molecular markers for salt tolerance in pumpkins are used in the screening of salt-tolerant pumpkin materials or in the breeding of salt-tolerant pumpkins.

[0010] Preferably, the pumpkin is at least one of Chinese pumpkin or Indian pumpkin.

[0011] A KASP primer combo for detecting molecular markers of salt tolerance in pumpkin was designed and obtained targeting the aforementioned molecular markers of salt tolerance in pumpkin. Its sequence is as follows:

[0012] The salt-sensitive site binds to the upstream primer as shown in SEQ ID NO.2:

[0013] 5'-GAAGGTGACCAAGTTCATGCTGGATGTTGGGATGTTGGGTGTTT-3';

[0014] The salt-tolerant site binds to the upstream primer as shown in SEQ ID NO.3:

[0015] 5'-GAAGGTCGGAGTCAACGGATTGGATGTTGGGATGTTGGGTGTTC-3';

[0016] The downstream primer is shown in SEQ ID NO.4:

[0017] 5'-TGCAAACACTAAAAACAACTGAAAACA-3'.

[0018] A kit for detecting salt tolerance in pumpkin, comprising the above-mentioned KASP primer combination for detecting molecular markers of salt tolerance in pumpkin.

[0019] The above-mentioned KASP primer combination for detecting molecular markers of salt tolerance in pumpkin is applied in the screening of salt-tolerant pumpkin materials or in the breeding of salt-tolerant pumpkins.

[0020] A method for screening salt-tolerant pumpkin materials, using the aforementioned KASP primer combination for detecting molecular markers of salt tolerance in pumpkin, includes the following steps:

[0021] (1) Extract genomic DNA from the parts of the pumpkins to be screened;

[0022] (2) Using the above-mentioned KASP primer combination for detecting molecular markers of salt tolerance in pumpkin, the genomic DNA of pumpkin was amplified and detected by a real-time PCR instrument;

[0023] (3) The salt tolerance sensitivity of the pumpkin to be screened is determined by the amplification detection results. If the detection results of the mutation sites of the molecular markers are all C, the pumpkin to be screened is a homozygous salt-tolerant material; if the detection results of the mutation sites of the molecular markers are all T, the pumpkin to be screened is a homozygous salt-sensitive material; if the detection results of the mutation sites of the molecular markers are C and T, the pumpkin to be screened is a heterozygous salt-tolerant material.

[0024] Preferably, in step (3), the determination of the salt tolerance sensitivity of the pumpkin to be screened by amplification detection results specifically includes:

[0025] If the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the upstream primer (SEQ ID NO.2) at the salt-sensitive site, then the pumpkin to be screened is a homozygous salt-tolerant material; if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the upstream primer (SEQ ID NO.3) at the salt-tolerant site, then the pumpkin to be screened is a homozygous salt-sensitive material; otherwise, the pumpkin to be screened is a heterozygous salt-tolerant material.

[0026] Preferably, the pumpkin material parts mentioned in step (1) include the detection parts such as leaves.

[0027] Compared with the prior art, the technical solution of the present invention has the following advantages:

[0028] 1. The KASP primer combination of the present invention for detecting molecular markers of salt tolerance in pumpkin is obtained by identifying salt tolerance in seedlings of two parents (salt-tolerant and salt-sensitive) and their reciprocal cross F1, discovering that salt tolerance is dominantly inherited, then resequencing the two parents, screening for differential loci, constructing a genetic linkage map for the F2 generation, performing QTL mapping, performing bioinformatics analysis on the QTL intervals, screening for functional mutation sites, and validating through natural populations to obtain primers designed for pumpkin salt tolerance-related gene loci.

[0029] 2. No identical pumpkin salt tolerance sites were found in the mutation sites of this invention after a search.

[0030] 3. The experimental results of this invention show that the pumpkin salt tolerance molecular marker and the KASP primer combination of the molecular marker can achieve complete consistency between the gene detection results and the salt tolerance phenotype results during the screening and detection of pumpkin salt tolerance. It can be seen that the pumpkin salt tolerance molecular marker and the KASP primer combination of the molecular marker can significantly distinguish between extremely salt-tolerant and salt-sensitive materials, and can be used for the creation of salt-tolerant Indian pumpkin germplasm resources and variety breeding.

[0031] 4. The molecular marker-based KASP primer combination of the present invention is used for screening salt-tolerant materials and breeding varieties of pumpkin, and has the characteristics of high efficiency, high accuracy and no pollution. Detailed Implementation

[0032] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention. In addition, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those of ordinary skill in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.

[0033] Currently, the identification of salt tolerance in pumpkins suffers from drawbacks such as long time cycle, high cost, and low accuracy. In order to solve the above technical problems, this invention proposes a molecular marker for salt tolerance in pumpkins, its KASP primer combination, and its application.

[0034] Example 1:

[0035] Experimental materials: a salt-tolerant pumpkin material P74, a salt-sensitive material P54, and their reciprocal crosses F1, F2 obtained by self-pollination of F1, and the derived F2:3 family population. The two parental materials are described in the article "Zhang Leichen, Xing Nailin, Ying Quansheng, et al. Screening of different types of salt-tolerant pumpkin materials [J]. Chinese Melon and Vegetable, 2017, 30(6):5". The public may obtain this melon variety from the applicant within twenty years from the date of application, solely for the purpose of repeating the relevant experiments of this invention.

[0036] Experimental Procedure: P74, P54, F1, and F2 seeds were soaked, germinated, and sown in plug trays. Salt tolerance was assessed at the one-leaf-one-heart stage. The assessment method involved treating the seeds with 240 mmol / L sodium chloride for one week and then examining the salt damage index, revealing that salt tolerance in pumpkin was a predominantly dominant trait. DNA samples were taken from leaves of the parents, F1, and F2 individual plants. Resequencing of both parents was performed to detect differential loci between them. A chi-square test of the segregation ratio was conducted on the loci in the F2 population, filtering out markers with p < 0.001, and constructing a high-density genetic linkage map of 1968 loci. After F2 transplanting, self-pollination was performed to obtain F2:3 families. After sowing, salt tolerance was assessed again at the seedling stage, comparing the F2 and F2:3 families with the parents and F1, and examining the salt damage index. Phenotypic and genetic linkage map data from the F2 and F2:3 families were combined, and QTL scanning was performed using MapQTL5 software with the Interval Mapping method to locate phenotypic traits. The results showed that one site located at the EcoRI-1740 SNP was repeatedly detected; the corresponding molecular marker for pumpkin salt tolerance at this SNP site is shown in SEQ ID NO.1:

[0037] AATTCTTAGTAAATCATTAGTTATTTGGGGTTGGGATGTTGGGATGTTGGGTGTT n CTTTTTCT ACTTATTCTATGATTTGATTGTTTTCAGTTGTTTTTAGTGTTTGCA;

[0038] Where n is T / C; when n is T, the phenotype corresponding to the T genotype is salt sensitive; when n is C, the phenotype corresponding to the C genotype is tolerant.

[0039] Furthermore, this pumpkin salt tolerance molecular marker is tightly linked to the gene CmaCh04G000710.1, and the CmaCh04G000710.1 gene shares a highly homologous domain with Gnk2. Gnk2 is associated with environmental stress and participates in reactive oxygen species metabolism. Therefore, this gene is preliminarily identified as a pumpkin salt tolerance-related gene.

[0040] Specifically, the mutation site of the aforementioned molecular marker is a nucleotide C→T mutation at position 339451 on chromosome 4 of the pumpkin reference genome, as published in the literature “Sun H et al. (2017) Karyotypestability and unbiased fractionation in the paleo-allotetraploid Cucurbitagenomes. Molecular Plant 10:1293-1306”.

[0041] Based on the mutation site sequence of this molecular marker, a KASP primer combination was designed to detect the molecular marker of salt tolerance in pumpkin, and its sequence is as follows:

[0042] The salt-sensitive site binds to the upstream primer as shown in SEQ ID NO.2:

[0043] 5'-GAAGGTGACCAAGTTCATGCTGGATGTTGGGATGTTGGGTGTTT-3';

[0044] The salt-tolerant site binds to the upstream primer as shown in SEQ ID NO.3:

[0045] 5'-GAAGGTCGGAGTCAACGGATTGGATGTTGGGATGTTGGGTGTTC-3'

[0046] The downstream primer is shown in SEQ ID NO.4:

[0047] 5'-TGCAAACACTAAAAACAACTGAAAACA-3'.

[0048] Example 2:

[0049] Experimental materials: 27 germplasm resources of Indian pumpkin, which are described in the article "Zhang Leichen, Xing Nailin, Ying Quansheng, et al. Screening of salt-tolerant materials of different types of pumpkin [J]. Chinese Vegetables, 2017, 30(6):5".

[0050] After sowing these 27 materials, genomic DNA was extracted from leaves, and the concentration was measured using a NanoDrop 2000. Each DNA stock solution was diluted to 20 ng / µl. The extracted genomic DNA was amplified and detected using the KASP primer combination described in Example 1 for detecting molecular markers of salt tolerance in pumpkin.

[0051] Configure the PCR reaction system as follows: 2μL of 2xTaq DNA Polymerase Mix, 1μL of SNP Primer Mix (4x), and 2μL of DNA sample.

[0052] The PCR steps are shown in Table 1.

[0053] Table 1 PCR steps

[0054]

[0055] SNP locus detection used the fluorophores FAM and VIC to distinguish between two isogenetic loci. The passive reference dye ROX was used to correct for signal differences between wells due to reaction volume errors. The relevant excitation and emission wavelengths are shown in Table 2. The reading software was an LGC OEMGA device.

[0056] Table 2 shows the relevant excitation and emission wavelengths.

[0057]

[0058] The PCR amplification results were analyzed using LGC_OMEGA's genotyping software (Kluster Caller). The relative fluorescence values ​​(VIC and FAM) for each PCR reaction well were obtained. Based on the relative fluorescence values, the samples were clustered, and the genotypes were further determined according to the sample clusters and fluorescence patterns. The statistical results of the measured sample genotypes and phenotypes are shown in Table 3.

[0059] Table 3 Sample Genotypes and Phenotypes

[0060]

[0061] The results showed that the genotype and phenotype were completely consistent. The salt tolerance index of all 10 C / C genotypes was less than 10%, the salt tolerance index of the 10 genotypes with genotypes C / T, C / C, and T / T was between 10-20%, and the salt tolerance index of the 7 T / T genotypes was greater than 20%. This indicates that although other salt tolerance-related genes exist in Indian pumpkin besides the gene associated with this marker, this marker can significantly distinguish between extremely salt-tolerant and salt-sensitive materials, and can be used for the creation of salt-tolerant Indian pumpkin germplasm resources and variety breeding.

[0062] Compared with the prior art, the technical solution of the present invention has the following advantages:

[0063] 1. The KASP primer combination of the present invention for detecting molecular markers of salt tolerance in pumpkin is obtained by identifying salt tolerance in seedlings of two parents (salt-tolerant and salt-sensitive) and their reciprocal cross F1, discovering that salt tolerance is dominantly inherited, then resequencing the two parents, screening for differential loci, constructing a genetic linkage map for the F2 generation, performing QTL mapping, performing bioinformatics analysis on the QTL intervals, screening for functional mutation sites, and validating through natural populations to obtain primers designed for pumpkin salt tolerance-related gene loci.

[0064] 2. No identical pumpkin salt tolerance sites were found in the mutation sites of this invention after a search.

[0065] 3. The experimental results of this invention show that the pumpkin salt tolerance molecular marker and the KASP primer combination of the molecular marker can achieve complete consistency between the gene detection results and the salt tolerance phenotype results during the screening and detection of pumpkin salt tolerance. It can be seen that the pumpkin salt tolerance molecular marker and the KASP primer combination of the molecular marker can significantly distinguish between extremely salt-tolerant and salt-sensitive materials, and can be used for the creation of salt-tolerant Indian pumpkin germplasm resources and variety breeding.

[0066] 4. The molecular marker-based KASP primer combination of the present invention is used for screening salt-tolerant materials and breeding varieties of pumpkin, and has the characteristics of high efficiency, high accuracy and no pollution.

[0067] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A molecular marker for salt tolerance in pumpkin, characterized in that: The sequence of the molecular marker is shown in SEQ ID NO.1: AATTCTTAGTAAATCATTAGTTATTTGGGTTGGGATGTTGGGATGTTGGGTGTT n CTTTTTCTACTTTATTCTATGATTTGATTGTTTTCAGTTGTTTTTAGTGTTTGCA; Where n is T / C; when n is T, the phenotype corresponding to the T genotype is salt sensitive; when n is C, the phenotype corresponding to the C genotype is tolerant. The pumpkin in question is an Indian pumpkin.

2. The application of a pumpkin salt-tolerant molecular marker in the screening of pumpkin salt-tolerant materials or in pumpkin salt-tolerant breeding, characterized in that: The sequence of the molecular marker is shown in SEQ ID NO.1: AATTCTTAGTAAATCATTAGTTATTTGGGTTGGGATGTTGGGATGTTGGGTGTT n CTTTTTCTACTTTATTCTATGATTTGATTGTTTTCAGTTGTTTTTAGTGTTTGCA; Where n is T / C; when n is T, the phenotype corresponding to the T genotype is salt sensitive; when n is C, the phenotype corresponding to the C genotype is tolerant. The pumpkin in question is an Indian pumpkin.

3. A KASP primer combination for detecting molecular markers of salt tolerance in pumpkin, characterized in that: The salt-tolerant molecular marker for pumpkin described in claim 1 was designed and obtained, with the following sequence: The salt-sensitive site binds to the upstream primer as shown in SEQ ID NO.2; The salt-tolerant site binds to the upstream primer as shown in SEQ ID NO.3; The downstream primer is shown in SEQ ID NO.

4.

4. A reagent kit for detecting the salt tolerance of pumpkin, characterized in that: Includes the KASP primer combination for detecting molecular markers of salt tolerance in pumpkin as described in claim 3.

5. The application of the KASP primer combination for detecting molecular markers of salt tolerance in pumpkin as described in claim 3 in the screening of salt-tolerant pumpkin materials or in the breeding of salt-tolerant pumpkin, wherein the pumpkin is Indian pumpkin.

6. A method for screening salt-tolerant materials from pumpkins, characterized in that: The application of the KASP primer combination for detecting molecular markers of salt tolerance in pumpkin as described in claim 3 includes the following steps: (1) Extract genomic DNA from the parts of the pumpkin to be screened; (2) Using the above-mentioned KASP primer combination for detecting molecular markers of salt tolerance in pumpkin, the genomic DNA of pumpkin was amplified and detected by a real-time PCR instrument; (3) The salt tolerance sensitivity of the pumpkin to be screened is determined by the amplification detection results. If the detection results of the mutation sites of the molecular markers are all C, the pumpkin to be screened is a homozygous salt-tolerant material; if the detection results of the mutation sites of the molecular markers are all T, the pumpkin to be screened is a homozygous salt-sensitive material; if the detection results of the mutation sites of the molecular markers are C and T, the pumpkin to be screened is a heterozygous salt-tolerant material. The pumpkin in question is an Indian pumpkin.

7. The method for screening salt-tolerant pumpkin materials according to claim 6, characterized in that: In step (3), the determination of the salt tolerance sensitivity of the pumpkin to be screened by the amplification detection results is as follows: if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the upstream primer SEQ ID NO.2 that binds to the salt-sensitive site, then the pumpkin to be screened is a homozygous salt-tolerant material; if the fluorescence signal color of the PCR amplification result is consistent with the fluorescence adapter color of the upstream primer SEQ ID NO.3 that binds to the salt-tolerant site, then the pumpkin to be screened is a homozygous salt-sensitive material. Otherwise, the pumpkins to be screened are hybrid salt-tolerant materials.

8. The method for screening salt-tolerant pumpkin materials according to claim 6, characterized in that: The pumpkin material parts mentioned in step (1) include the leaf detection parts.

Citation Information

Patent Citations

  • Indel molecular marker closely linked to photoperiod insensitivity in pumpkins and application thereof

    US20200199673A1