SNP molecular markers of SbST1, a gene associated with sorghum stem diameter, and their applications

By detecting SNP1 and SNP2 polymorphisms in the sorghum genome and using KASP technology and specific primer combinations to identify sorghum stem diameter, the problem of difficult identification and breeding in existing technologies has been solved, enabling efficient breeding of sorghum varieties with tall stem diameter and improving sorghum yield and lodging resistance.

CN119913281BActive Publication Date: 2025-10-28INST OF BOTANY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510296819.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-10-28
Estimated Expiration
2045-03-13

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention discloses the SNP molecular markers of the sorghum stem diameter-related gene SbST1 and their applications. This invention relates to the field of molecular biology, specifically to the SNP molecular markers of the sorghum stem diameter-related gene SbST1 and their applications. By detecting the polymorphisms or genotypes of SNP1 and SNP2 in the stem diameter gene SbST1 of tested sorghum varieties, it was found that sorghum varieties with both SNP1 and SNP2 genotypes TT had significantly higher average stem diameters than those with both SNP1 and SNP2 genotypes AA. 78.05% of the haplotype SbST1-Hap1 sorghum varieties had stem diameters greater than 20 mm. This indicates that the molecular marker of sorghum stem diameter using the haplotype SbST1-Hap1 can be used to assist in selection breeding, significantly improving the selection efficiency for taller sorghum varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plants, specifically relating to the SNP molecular marker of SbST1, a gene related to sorghum stem thickness, and its application. Background Technology

[0002] Soil salinization is a widespread problem worldwide, and the loss of land suitable for crop cultivation has become a serious issue for agricultural sustainability. Salt content is one of the most significant environmental stressors, drastically reducing arable land area while also lowering crop yield and quality. Sorghum, previously considered moderately salt-tolerant, is primarily grown in the temperate regions of western and northeastern China. It possesses strong drought, flood, salt, and heat resistance, making it suitable for planting on saline-alkali and arid marginal lands. Sorghum is renowned for its strong resilience and wide adaptability, with salt tolerance being one of its key characteristics. Therefore, planting salt-tolerant sorghum varieties is an effective measure to fully utilize saline-alkali land resources and increase sorghum yield.

[0003] The yield and quality of plant biomass per acre are crucial economic factors in plant biofuel production. Stem diameter is the primary indicator of biomass yield and is itself a key indicator of plant growth. There is a strong correlation between stem weight and stem diameter; varieties with thicker stems are less prone to lodging and can, to some extent, increase aboveground biomass. Researching genes that regulate sorghum stem diameter, obtaining KASP molecular markers closely linked to stem diameter genes, locating and detecting major gene loci for sorghum stem diameter, effectively regulating stem diameter types in sorghum, and breeding new sorghum varieties with desired stem diameter types are of paramount importance for improving sorghum yield and lodging resistance. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to identify or assist in the identification of sorghum stem thickness or how to conduct sorghum breeding.

[0005] To address the above technical problems, this invention first provides the application of a substance for detecting SNP polymorphisms or genotypes in the sorghum genome, or a substance for detecting haplotypes, in any of the following situations:

[0006] (1) To identify or assist in identifying the thickness of sorghum stalks;

[0007] (2) Screening or breeding tall sorghum plants, strains, varieties, or cultivars with thick stems;

[0008] (3) Sorghum breeding;

[0009] (4) Prepare products for identification or auxiliary identification of sorghum stalk diameter;

[0010] (5) Prepare or select products of tall and thick sorghum individual plants, strains, varieties or cultivars;

[0011] (6) Prepare products for sorghum breeding;

[0012] The SNPs are SNP1 and SNP2 in the sorghum genome. SNP1 is the 3583rd nucleotide in SEQ ID No:1 of the sequence listing, and its nucleotide type is G or T. SNP2 is the 7559th nucleotide in SEQ ID No:1 of the sequence listing, and its nucleotide type is A or T.

[0013] In this application, the genotype of SNP1 can be GG, TT, or GT, where GG is a homozygous genotype of SNP1 being G; TT is a homozygous genotype of SNP1 being T; and GT is a heterozygous genotype of SNP1 being both G and T. The genotype of SNP2 can be AA, TT, or AT, where AA is a homozygous genotype of SNP2 being A; TT is a homozygous genotype of SNP2 being T; and AT is a heterozygous genotype of SNP2 being both A and T.

[0014] The haplotype is a polymorphic combination of SNP1 and SNP2 on a single chromosome of sorghum.

[0015] The haplotypes include SbST1-Hap1, SbST1-Hap2, SbST1-Hap3, and SbST1-Hap4.

[0016] The genotype of SbST1-Hap1 is TTTT, and the genotype of the SNP1 locus of sorghum with genotype TTTT is TT and the genotype of the SNP2 locus is TT; the genotype of SbST1-Hap2 is GGAA, and the genotype of the SNP1 locus of sorghum with genotype GGAA is GG and the genotype of the SNP2 locus is AA; the genotype of SbST1-Hap3 is GGTT, and the genotype of the SNP1 locus of sorghum with genotype GGTT is GGCC and the genotype of the SNP2 locus is TT; the genotype of SbST1-Hap4 is TTAA, and the genotype of the SNP1 locus of sorghum with genotype TTAA is TT and the genotype of the SNP2 locus is AA.

[0017] Using the sorghum genome (BTx623(v3.1) sequence as a reference genome, SNP1 is located in the SbST1 gene, SNP2 is located in the SbST1 gene, the SbST1 gene is located at positions 7684582-7694636 on chromosome 1 of sorghum, and is associated with the sorghum stem thickness. Its nucleotide sequence is the DNA molecule shown in SEQ ID No:1 in the sequence listing.

[0018] This invention also provides a method for identifying or assisting in the identification of sorghum stalk thickness, wherein the method is method A or B:

[0019] Method A includes detecting the genotypes of SNP1 and SNP2 mentioned above in the sorghum to be tested, and identifying or assisting in identifying the sorghum stem diameter based on the genotypes of the sorghum to be tested.

[0020] Method B is to detect the haplotypes mentioned above in the sorghum to be tested, and to identify or assist in identifying the stem diameter of the sorghum based on the haplotypes of the sorghum to be tested. The stem diameter of the sorghum with haplotype SbST1-Hap1 is higher than or can be higher than that of the sorghum with haplotype SbST1-Hap2.

[0021] The genotype of SbST1-Hap1 is TTTT, and the sorghum with genotype TTTT has genotype TT at the SNP1 locus and genotype TT at the SNP2 locus; the genotype of SbST1-Hap2 is GGAA, and the sorghum with genotype GGAA has genotype GG at the SNP1 locus and genotype AA at the SNP2 locus.

[0022] Optionally, the method for identifying or assisting in the identification of sorghum stalk thickness may be any of the following:

[0023] (1) The sorghum (such as sorghum inbred line) to be tested with the genotype TT of SNP1 or / and the genotype TT of SNP2 is or is a candidate for a tall and thick sorghum.

[0024] (2) The average stem diameter of the sorghum (such as sorghum inbred lines) with haplotype SbST1-Hap1 (genotype TTTT) was significantly higher than or candidate higher than that of the sorghum with haplotype SbST1-Hap2 (genotype GGAA).

[0025] As one implementation scheme, the method for identifying or assisting in the identification of sorghum stalk diameter may include the following steps:

[0026] (1) Using the genomic DNA of the sorghum to be tested as a template, KASP was performed using primer combination F1 and primer set F2; the primer combination F1 may consist of primer F1-A, primer F1-B, and primer F1-C; the primer set F2 may include primer F2-A, primer F2-B, and primer F2-C;

[0027] The primer composition F1 consists of primer F1-A, which is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:2 or a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:2 from position 22 to 46.

[0028] The primer composition F1 consists of primer F1-B, which is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3 or a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3 from position 22 to 47.

[0029] The primer composition F1 is a single-stranded DNA molecule whose nucleotide sequence of primer F1-C is SEQ ID No:4;

[0030] Primer F2-A in primer set F2 is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:5 or a single-stranded DNA molecule whose nucleotide sequence is positions 22-47 of SEQ ID No:5;

[0031] Primer F2-B in primer set F2 is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:6 or a single-stranded DNA molecule whose nucleotide sequence is positions 22-47 of SEQ ID No:6;

[0032] Primer F2-C in primer set F2 is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No:7.

[0033] (2) After completing step (1), fluorescence detection is performed to determine the genotypes of the SNP1 and SNP2 sites of the sorghum to be tested;

[0034] (3) Identify the stem diameter of the sorghum to be tested based on the genotype results: The average stem diameter of the sorghum to be tested (such as sorghum inbred lines) with the SNP1 genotype TT or the SNP2 genotype TT is significantly higher than or candidate higher than the stem diameter of the sorghum to be tested with the genotype GGAA (such as sorghum inbred lines).

[0035] The application of the above-mentioned methods for identifying or assisting in the identification of sorghum stem diameter in sorghum breeding is also within the scope of protection of this invention.

[0036] This invention also provides a method for sorghum breeding.

[0037] The sorghum breeding method provided by this invention can be M1:

[0038] The M1 method includes detecting the genotypes of SNP1 and SNP2 in the sorghum genome, selecting sorghum with the genotype TTTT at the two SNP loci of SNP1 and SNP2 as parents for breeding, and the breeding purpose of the method includes selecting sorghum with tall stems and thick stalks.

[0039] As an implementation method, sorghum breeding methods may include the following steps:

[0040] (1) Using the genomic DNA of the sorghum to be tested as a template, KASP was performed using the primer sets F1 and F2 mentioned above;

[0041] (2) After completing step (1), perform fluorescence detection to determine the genotypes of the SNP1 and SNP2 sites of the sorghum to be tested;

[0042] (3) Select sorghum with the SNP1 genotype TT or / and the SNP2 genotype TT for breeding to achieve tall stem diameter.

[0043] The sorghum breeding mentioned above aims to cultivate sorghum varieties with thicker stems.

[0044] The sorghum stem thickness mentioned above specifically refers to the stem thickness at the sorghum maturity stage.

[0045] In the above applications and methods, the sorghum can be a pure-line sorghum inbred line. In the applications and methods described above, sorghum inbred lines can be selected as parents for breeding.

[0046] In the above applications and methods, the stem diameter of the sorghum variety with low stem diameter is relative to the hybrid parent sorghum. If the stem diameters of the two hybrid parent sorghums are the same, the stem diameter of the sorghum variety with high stem diameter can be equal to or higher than the stem diameter of the hybrid parent sorghum; if the stem diameters of the two hybrid parent sorghums are not the same, the stem diameter of the sorghum variety with high stem diameter can be equal to or higher than the hybrid parent sorghum with the higher stem diameter.

[0047] This invention also provides products for detecting SNP polymorphisms or genotypes in the sorghum genome.

[0048] The product provided by this invention for detecting the polymorphism or genotype of SNPs in the sorghum genome is either the substance described above for detecting the polymorphism or genotype of SNP sites in the sorghum genome, or a product containing the substance described above for detecting haplotypes, and the product may be any of the following:

[0049] C1) Products that detect single nucleotide polymorphisms or genotypes related to sorghum stem diameter;

[0050] C2) Identification or auxiliary identification of products with thick sorghum stalks;

[0051] C3) Products used in sorghum breeding;

[0052] C4) Screening or breeding of tall, thick sorghum plants, strains, varieties, or products.

[0053] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0054] Optionally, the substance is D1), D2), or D3):

[0055] D1) The substances described are primer composition F1 and primer set F2 for amplifying sorghum genomic DNA fragments including SNP1 and / or SNP2;

[0056] D2) The substance described is a PCR reagent containing the primer composition described in D1);

[0057] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0058] Optionally, the primer set for amplifying the sorghum genomic DNA fragment including SNP1 may consist of primers F1-A, F1-B, and F1-C; the primer set for the sorghum genomic DNA fragment including SNP2 may consist of primers F2-A, F2-B, and F2-C.

[0059] The primer composition F1 can be a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:2 or a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:2 from position 22 to 46.

[0060] The primer composition F1 can be a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3 or a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3 from position 22 to 47.

[0061] The primer composition F1 can be derived from a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:4.

[0062] The primer composition F2 can be a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:5 or a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:5 from position 22 to 47.

[0063] The primer composition F2 can be a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:6 or a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:6 from position 22 to 47.

[0064] The primer composition F2 can be derived from a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:7.

[0065] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).

[0066] Primer composition F1 can be a primer composition consisting of single-stranded DNA with nucleotide sequences of positions 22-46 of SEQ ID No:2, single-stranded DNA with nucleotide sequences of positions 22-47 of SEQ ID No:3, and single-stranded DNA with nucleotide sequences of SEQ ID No:4. Primer composition F1 can also be a primer set consisting of single-stranded DNA shown in SEQ ID No:2, single-stranded DNA shown in SEQ ID No:3, and single-stranded DNA shown in SEQ ID No:4. SEQ ID No:2 consists of 46 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-46 being the specific sequence; SEQ ID No:3 consists of 47 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-47 being the specific sequence. The primer composition F2 can be a primer composition consisting of single-stranded DNA with nucleotide sequences of positions 22-47 of SEQ ID No:5, single-stranded DNA with nucleotide sequences of positions 22-47 of SEQ ID No:6, and single-stranded DNA with nucleotide sequences of SEQ ID No:7. The primer composition F2 can also be a primer set consisting of single-stranded DNA shown in SEQ ID No:5, single-stranded DNA shown in SEQ ID No:6, and single-stranded DNA shown in SEQ ID No:7. SEQ ID No:5 consists of 47 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-47 being the specific sequence; SEQ ID No:6 consists of 47 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-47 being the specific sequence.

[0067] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 1 of the sequence listing.

[0068] The applications of the aforementioned DNA molecules also fall within the scope of protection of this invention. Specifically, the applications are those found in any of the following:

[0069] (1) To identify or assist in identifying the thickness of sorghum stalks;

[0070] (2) Screening or breeding tall sorghum plants, strains, varieties, or cultivars with thick stems;

[0071] (3) Sorghum breeding;

[0072] (4) Prepare products for identification or auxiliary identification of sorghum stalk diameter;

[0073] (5) Prepare or select products of tall and thick sorghum individual plants, strains, varieties or cultivars;

[0074] (6) Prepare products for sorghum breeding.

[0075] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0076] The substance that detects the SNP polymorphism and genotype or the haplotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers associated with sorghum stem diameter) to prepare a product for identifying sorghum stem diameter varieties.

[0077] This invention identifies two SNPs by analyzing genetic variations in the SbST1 gene in a population of sorghum inbred lines. SNP1 is located in the SbST1 gene, which is associated with stem diameter in the sorghum genome, at position 3583 of SEQ ID No:1. SNP2 is located in the SbST1 gene, which is associated with stem diameter in the sorghum genome, at position 7559 of SEQ ID No:1. The invention provides primer compositions for amplifying sorghum genomic DNA fragments including SNP1 and SNP2, and also provides a method for identifying or assisting in the identification of sorghum stem diameter using these primer compositions.

[0078] The method established in this invention can be used to predict the phenotype of sorghum stem diameter, to perform early screening of sorghum to be screened, and to be used for molecular marker-assisted breeding of sorghum. It has important application value in the research of discovering sorghum germplasm resources with thicker stems and breeding sorghum varieties with tall stems. Detailed Implementation

[0079] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0080] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0081] The 210 sorghum inbred line associations in the following examples were provided by the research group of Jing Haichun at the National Key Laboratory of High-Efficiency Design and Utilization of Forage Germplasm, Institute of Botany, Chinese Academy of Sciences. Detailed information on these associations has been recorded in: Xiaoyuan Wu, et al. Genomic footprints of sorghum domestication and breeding selection for multiple end uses. Molecular Plant, 2022, VOLUME 15, ISSUE 3, P537-551 (DOI: https: / / doi.org / 10.1016 / j.molp.2022.01.002). Germplasm resource information can also be obtained from the SorGSD website (https: / / ngdc.cncb.ac.cn / sorgsd / ). Detailed information on the varieties is shown in Table 1.

[0082] Example 1: Discovery of SNP molecular markers associated with sorghum stem diameter

[0083] I. Statistics on stem diameter of the test materials

[0084] 1. Cultivation of test materials

[0085] In 2021, 210 sorghum inbred line related population germplasm resources were planted in farmland soil in the Agricultural High-tech Zone of Dongying City, Shandong Province, China. A randomized complete block design was adopted. The experimental plot was 3m long and 2m wide, with 5 rows of 10 plants per row, a plant spacing of 0.3m, a row spacing of 0.5m, and normal irrigation.

[0086] 2. Statistical analysis of stem diameter of the tested materials

[0087] After the 210 sorghum inbred line populations were fully mature, three plants were selected from each material, and the stem diameter of the main stem of each plant was counted. The average of the three replicates was taken as the final result of the stem diameter of the sample, as shown in Table 1.

[0088] II. Discovery of SNP molecular markers related to the SbST1 gene

[0089] 1. Whole-genome sequencing of 210 sorghum inbred line associated populations

[0090] Whole-genome sequencing data of 210 sorghum inbred line populations were provided by the research group of Jing Haichun at the National Key Laboratory of Efficient Design and Utilization of Forage Germplasm, Institute of Botany, Chinese Academy of Sciences.

[0091] 2. Discovery of SNP molecular markers related to gene SbST1

[0092] Based on genome-wide association analysis (GWAS) of the aboveground dry weight and genotype data of sorghum inbred lines, a haplotype combination of the gene SbST1 associated with sorghum stem diameter was identified. This haplotype combination includes two SNP loci: SNP1 corresponds to position 7691104 on chromosome 1 of the sorghum inbred line BTx623, with nucleotides of G or T, corresponding to position 3583 of SEQ ID No:1 in the sequence listing; SNP2 corresponds to position 7687128 on chromosome 1 of the sorghum inbred line BTx623, with nucleotides of T or A, corresponding to position 7559 of SEQ ID No:1 in the sequence listing. In the sequence listing, k represents g or t, and w represents t or a.

[0093] The genotyping results for each sorghum variety are shown in Table 1. The results show that there are two genotypes at SNP1: GG or TT. Genotype GG is homozygous for SNP1 with the genotype G, and genotype TT is homozygous for SNP1 with the genotype T. There are two genotypes at SNP2: AA or TT. Genotype AA is homozygous for SNP2 with the genotype A, and genotype TT is homozygous for SNP2 with the genotype T.

[0094] The haplotypes formed by SNP1 and SNP2 include SbST1-Hap1, SbST1-Hap2, SbST1-Hap3, and SbST1-Hap4.

[0095] Among them, the genotype of SbST1-Hap1 is TTTT, and the genotype of the SNP1 locus of sorghum with genotype TTTT is TT and the genotype of the SNP2 locus is TT; the genotype of SbST1-Hap2 is GGAA, and the genotype of the SNP1 locus of sorghum with genotype GGAA is GG and the genotype of the SNP2 locus is AA; the genotype of SbST1-Hap3 is GGTT, and the genotype of the SNP1 locus of sorghum with genotype GGTT is GG and the genotype of the SNP2 locus is TT; the genotype of SbST1-Hap4 is TTAA, and the genotype of the SNP1 locus of sorghum with genotype TTAA is TT and the genotype of the SNP2 locus is AA.

[0096] Therefore, the genotypes of SNP1 or SNP2, or the haplotypes formed by SNP1 and SNP2, are selected to identify or assist in the identification of sorghum stem diameter in different lines. The specific criteria for determination are as follows:

[0097] 1) The stem diameter of the sorghum (e.g., sorghum inbred lines) whose SNP1 genotype is TT or / and whose SNP2 genotype is TT is higher than or candidate higher than that of the sorghum (e.g., sorghum inbred lines) whose SNP1 genotype is GG or / and whose SNP2 genotype is AA.

[0098] 2) The stem diameter of the sorghum (such as sorghum inbred lines) to be tested, SbST1-Hap1 (genotype TTTT), is higher than or candidate to be higher than that of SbST1-Hap2 (genotype GGAA). Among them, the SNP1 genotype of sorghum in SbST1-Hap1 is TT and the SNP2 genotype is TT, while the SNP1 genotype of sorghum in SbST1-Hap2 is GG and the SNP2 genotype is AA.

[0099] III. Design and establishment of specific primers for SbST1-related SNP molecular markers

[0100] 1. Design of genome-specific primers for haplotype combination-related SNP sites

[0101] The specific primer sequences for SNP1 (SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6 and SEQ ID No:7 in the sequence listing) were all synthesized by Zhongyu Gold Label (Beijing) Biotechnology Co., Ltd.

[0102] The primer set F1 for identifying SNP1 site polymorphism is as follows:

[0103] Specific primer F1-A (SEQ ID No:2):

[0104] 5'- GAAGGTGACCAAGTTCATGCT CCGCTCCATAATTATATCCTTTGGC-3'

[0105] Specific primer F1-B (SEQ ID No:3):

[0106] 5'- GAAGGTCGGAGTCAACGGATT GCCGCTCCATAATTATATCCTTTGGA-3'

[0107] Universal primer F1-C (SEQ ID No:4):

[0108] 5'-TTGTCATCTATGGGAGGATCCTTTTTCAT-3'

[0109] The primer set F2 for identifying SNP2 polymorphism is as follows:

[0110] Specific primer F2-A (SEQ ID No:5):

[0111] 5'- GAAGGTGACCAAGTTCATGCT CTCACCTTCAGGGATATCATTTGTAT-3'

[0112] Specific primer F2-B (SEQ ID No:6):

[0113] 5'- GAAGGTCGGAGTCAACGGATT CTCACCTTCAGGGATATCATTTGTAA-3'

[0114] Universal primer F2-C (SEQ ID No:7):

[0115] 5'-TTACTCACATTTATGTTCTTCCATAGGGTT-3'

[0116] The primer set F1 for identifying SNP1 polymorphism was designed based on the antisense strand of sequence SEQ ID No:1, and the primer set F2 for identifying SNP2 polymorphism was designed based on the antisense strand of sequence SEQ ID No:1.

[0117] The underlined sequences in primers F1-A and F2-A are FAM sequences; the underlined sequences in primers F1-B and F2-B are HEX sequences.

[0118] The single-stranded DNA molecules shown in SEQ ID No:2 and SEQ ID No:4 amplify the fragment with the complementary base "C" to the G base at the SNP1 site in SEQ ID No:1. The fluorescent signal of the fluorescent group bound to the FAM sequence in the template can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument.

[0119] The single-stranded DNA molecules shown in SEQ ID No:3 and SEQ ID No:4 amplify the fragment with the complementary base "A" to the T base at the SNP1 site of SEQ ID No:1. The fluorescent signal of the fluorescent group bound to the HEX sequence in the template can be read using an ELISA reader or a real-time PCR instrument.

[0120] The fragment with complementary base A at the SNP2 site in the antisense strand of the single-stranded DNA molecule amplification sequence listed in SEQ ID No:1 (SEQ ID No:5 and SEQ ID No:7) is the fragment with SNP2 site A in the sequence listing SEQ ID No:1. The fluorescent signal of the fluorescent group bound to the FAM sequence in the template can be read by an enzyme-linked immunosorbent assay (ELISA) reader or a real-time PCR instrument.

[0121] The fragment with complementary base T at the SNP2 site in the antisense strand of the single-stranded DNA molecule amplification sequence listed in SEQ ID No:1 (SEQ ID No:6 and SEQ ID No:7) can be read by an ELISA reader or a real-time PCR instrument to detect the fluorescent signal of the fluorescent group bound to the HEX sequence in the template.

[0122] 2. Establishment of a method for detecting sorghum stem diameter using KASP molecular markers

[0123] 1) DNA extraction

[0124] Genomic DNA was extracted from the tested sorghum variety, dissolved in ddH2O, and used as a template for PCR amplification.

[0125] 2) PCR amplification and fluorescence signal detection

[0126] Using SNP primer sets F1 and F2 from step 1, PCR amplification was performed on the template obtained in step 1) to detect the polymorphism (nucleotide type) and genotype of the SNP site; the PCR products of primer sets F1 and F2 were read using a Douglas-Araya high-throughput automated fluorescence signal scanner, and the fluorescence signal was processed using Douglas-Kraken software.

[0127] Preparation of primer mixture: First, dilute primers F1-A, F1-B, and F1-C with ddH2O to a concentration of 100 mmol·L⁻¹. -1 Primer solutions F1-A, F1-B, and F1-C were obtained separately. 60 μL of each primer solution was taken, along with 150 μL of each primer solution, and 230 μL of 10 mM Tris-HCl was added to obtain primer mixture F1. Primer solutions F2-A, F2-B, and F2-C were obtained using the same method. 60 μL of each primer solution was taken, along with 150 μL of each primer solution, and 230 μL of 10 mM Tris-HCl was added to obtain primer mixture F2.

[0128] The 2μL PCR reaction system for quantitative PCR consisted of: 50ng genomic DNA, 0.02μL primer mixture, 0.6μL LGC 1×KASP Mix (Low Rox), and the remainder ddH2O. The program was edited and run according to the operating manuals for the Douglas-Nexar and Soellex water bath systems, and the data was saved.

[0129] Using the SNP1 primer set F1 and SNP2 primer set F2 from step 1, PCR amplification was performed on the template obtained in step 2.1 to detect the polymorphism (nucleotide type) and genotype of the SNP1 and SNP2 sites. The PCR products of primer set F1 and primer set F2 were read using an ELISA reader or a real-time PCR instrument, and the fluorescence signal was processed using the online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ).

[0130] The results are as follows:

[0131] If the PCR product of the F1 primer set shows only the fluorescence signal of the fluorescent group that binds to the FAM sequence, then the genotype of the sorghum SNP1 locus to be tested is GG (i.e., the homozygous type of SNP1 locus in the sorghum genome is G); if it shows only the fluorescence signal of the fluorescent group that binds to the HEX sequence, then the genotype of the sorghum SNP1 locus to be tested is TT (i.e., the homozygous type of SNP1 locus in the sorghum genome is T); if it shows both the fluorescence signal of the fluorescent group that binds to the FAM sequence and the fluorescence signal of the fluorescent group that binds to the HEX sequence, then the genotype of the sorghum SNP1 locus to be tested is GT (i.e., the heterozygous type of SNP1 locus in the sorghum genome is G and T).

[0132] If the PCR product of the F2 primer set shows only the fluorescence signal of the fluorescent group that binds to the FAM sequence, then the genotype of the sorghum SNP2 locus to be tested is AA (i.e., homozygous for SNP2 locus A in the sorghum genome); if it shows only the fluorescence signal of the fluorescent group that binds to the HEX sequence, then the genotype of the sorghum SNP2 locus to be tested is TT (i.e., homozygous for SNP2 locus T in the sorghum genome); if it shows both the fluorescence signal of the fluorescent group that binds to the FAM sequence and the fluorescence signal of the fluorescent group that binds to the HEX sequence, then the genotype of the sorghum SNP2 locus to be tested is AT (i.e., heterozygous for SNP2 locus A and T in the sorghum genome).

[0133] Determine the genotype associated with gene SbST1 to identify or assist in the identification of stem diameter in tested sorghum varieties:

[0134] 1) The stem diameter of the sorghum (e.g., sorghum inbred lines) whose SNP1 genotype is TT or / and whose SNP2 genotype is TT is higher than or candidate higher than that of the sorghum (e.g., sorghum inbred lines) whose SNP1 genotype is GG or / and whose SNP2 genotype is AA.

[0135] 2) The stem diameter of the sorghum (such as a sorghum inbred line) to be tested, SbST1-Hap1 (genotype TTTT), is higher than or candidate to be higher than that of SbST1-Hap2 (genotype GGAA). The sorghum of SbST1-Hap1 has an SNP1 genotype of TT and an SNP2 genotype of TT. The sorghum of SbST1-Hap2 has an SNP1 genotype of GG and an SNP2 genotype of AA.

[0136] Example 2: Application of SNP molecular markers of the SbST1 gene, which is significantly associated with sorghum stem diameter.

[0137] Sorghum samples to be tested: 210 sorghum inbred line related populations

[0138] I. Sorghum Stalk Diameter Measurement

[0139] The method was the same as in Example 1. The results showed that 210 sorghum inbred lines were planted in farmland soil in the Agricultural High-tech Zone of Dongying City, Shandong Province, China. There were significant differences in stem diameter among different sorghum varieties, ranging from 10.13 to 32.47 mm. Among them, 103 sorghum inbred lines had stem diameters exceeding 20 mm, accounting for approximately 49.05% of the associated population.

[0140] II. Molecular identification or auxiliary identification of sorghum inbred lines stem diameter

[0141] Genomic DNA was extracted from the sorghum stalks to be tested and dissolved in ddH2O as a template. PCR amplification was performed using genome-specific primers (SNP1 primer set F1 and primer set F2) from the haplotype combinations (SNP1 and SNP2 sites) in Example 1 to obtain polymorphic information of SbST1 gene-related genotypes, thereby determining the SbST1-related genotypes of the sorghum stalks to be tested, and thus identifying or assisting in the identification of the stem diameter of the tested sorghum varieties.

[0142] The genotypes of SNP1 and SNP2 loci and the sorghum stem diameters of the 210 sorghum samples tested are shown in Tables 1 and 2. The SNP1 locus of the tested sorghum samples contained two genotypes, GG and TT, and the SNP2 locus contained two genotypes, AA and TT.

[0143] The test results showed that among the 210 sorghum varieties, 32 out of 41 varieties with the TTTT genotype (haplotype SbST1-Hap1) had stem diameters greater than 20 mm, and 78.05% of the TTTT genotype varieties had stem diameters greater than 20 mm. Among the 164 varieties with the GGAA genotype (haplotype SbST1-Hap2), 95 had stem diameters less than 20 mm, and 57.93% of the GGAA genotype varieties had stem diameters less than 20 mm. Four varieties had the GGTT genotype, and one variety had the TTAA genotype. This indicates that using the TTTT genotype (haplotype SbST1-Hap1) to breed tall-stem-diameter sorghum varieties and eliminate short-stem-diameter sorghum varieties with the GGAA genotype (haplotype SbST1-Hap2), and using it as an SNP molecular marker for stem diameter-assisted selection, is indeed effective.

[0144] Table 1. Stem thickness trait and genotypes of two SNP loci in 210 sorghum inbred lines.

[0145]

[0146]

[0147]

[0148]

[0149]

[0150] Note: IS: Sweet Sorghum; IG: Grain Sorghum; LG: Grain Sorghum; AL: unknown; LB: Broom Sorghum.

[0151] Example 2 uses GraphPad Prism v8.0 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0152] At a significance level of 0.05, the largest mean is labeled with a lowercase Latin letter 'a'. This mean is then compared to all other means in descending order. If the difference from the largest mean is not significant, it is labeled with the same letter 'a', until a mean with a significant difference is labeled with the letter 'b'. The mean labeled 'b' is then compared to all the larger means above it. If the difference is not significant, it is labeled with the letter 'b' again, until a significant difference is labeled with the letter 'c'. This process is repeated until all means have been labeled and compared. Means sharing even one letter are considered insignificant; means without sharing a letter are considered significant.

[0153] A significant difference analysis was performed on the stem diameter of the four haplotypes. There was a highly significant difference between the homozygous sorghum genotype SbST1-Hap1 (genotype TTTT) and the homozygous sorghum genotype SbST1-Hap2 (genotype GGAA) (P<0.001). There were only 4 homozygous sorghum samples corresponding to genotype GGTT and only 1 homozygous sorghum sample corresponding to genotype TTAA, which are rare haplotypes. Due to the small number of samples, they were not statistically significant.

[0154] Table 2. Stem diameter and differences among 210 sorghum inbred lines corresponding to different haplotypes of gene SbST1.

[0155] Haplotype genotype Number of varieties (pieces) Average stem diameter ± standard deviation (mm) SbST1-Hap1 TTTT 41 <![CDATA[22.73±4.792 a ]]> SbST1-Hap2 GGAA 164 <![CDATA[19.10±3.958 b ]]> SbST1-Hap3 GGTT 4 19.51±5.93 SbST1-Hap4 TTAA 1 18.98

[0156] The results showed that there was a highly significant difference in stem diameter between the homozygous TT sorghum genotype of SNP1 and the homozygous GG sorghum genotype (P<0.0001). The stem diameter of sorghum with the TT genotype of SNP1 was significantly higher or potentially higher than that of sorghum with the GG genotype of SNP1. Similarly, there was a highly significant difference in stem diameter between the homozygous TT sorghum genotype of SNP2 and the homozygous AA sorghum genotype (P<0.0001). The stem diameter of sorghum with the TT genotype of SNP2 was significantly higher or potentially higher than that of sorghum with the AA genotype of SNP2.

[0157] Table 3. Stem diameter and differences among 210 sorghum inbred lines corresponding to different genotypes at the two SNP loci of gene SbST1.

[0158]

[0159] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Application of substances that detect SNP polymorphisms, genotypes, or haplotypes in the sorghum genome in any of the following: (1) To identify or assist in identifying the thickness of sorghum stalks; (2) Screening or breeding tall sorghum plants, strains, varieties, or cultivars with thick stems; (3) Prepare products for identification or auxiliary identification of sorghum stalk diameter; (4) Prepare or select products of tall and thick sorghum individual plants, strains, varieties or cultivars; The SNPs are SNP1 and SNP2. SNP1 is the 3583rd nucleotide of SEQ ID No:1 in the sequence listing, and its nucleotide type is G or T. SNP2 is the 7559th nucleotide of SEQ ID No:1 in the sequence listing, and its nucleotide type is A or T. The haplotype is a polymorphic combination of SNP1 and SNP2 on one chromosome of sorghum; The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying sorghum genomic DNA fragments including SNP1 and / or SNP2; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

2. The application according to claim 1, characterized in that: The primer composition for amplifying the sorghum genomic DNA fragment including SNP1 consists of primers F1-A, F1-B, and F1-C; the primer composition for amplifying the sorghum genomic DNA fragment including SNP2 consists of primers F2-A, F2-B, and F2-C. The primer F1-A is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:2 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-46 of SEQ ID No:2 in the sequence listing; The primer F1-B is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-47 of SEQ ID No:3 in the sequence listing; The primer F1-C nucleotide sequence is a single-stranded DNA molecule of SEQ ID No:4 in the sequence listing; The primer F2-A is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:5 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-47 of SEQ ID No:5 in the sequence listing; The primer F2-B is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:6 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-47 of SEQ ID No:6 in the sequence listing; The primer F2-C nucleotide sequence is the single-stranded DNA molecule of SEQ ID No:7 in the sequence listing.

3. The application according to claim 1 or 2, characterized in that: The sorghum mentioned is a sorghum inbred line.

4. A method for identifying or assisting in the identification of sorghum stalk diameter, wherein the method is Method A and Method B: Method A includes detecting the genotypes of SNP1 and SNP2 in claim 1 in the sorghum to be tested, and identifying or assisting in identifying the sorghum stem diameter based on the genotypes of the sorghum to be tested; the stem diameter of the sorghum to be tested with the SNP1 genotype TT or / and the SNP2 genotype TT is higher than or candidate higher than that of the sorghum to be tested with the SNP1 genotype GG or / and the SNP2 genotype AA; Method B is to detect the haplotype in claim 1 of the sorghum to be tested, and to identify or assist in identifying the sorghum stem diameter based on the haplotype of the sorghum to be tested. The stem diameter of sorghum SbST1-Hap1 is higher than or candidate to be higher than that of sorghum SbST1-Hap2. The genotype of SbST1-Hap1 is TTTT, and the sorghum with genotype TTTT has genotype TT at the SNP1 locus and genotype TT at the SNP2 locus; the genotype of SbST1-Hap2 is GGAA, and the sorghum with genotype GGAA has genotype GG at the SNP1 locus and genotype AA at the SNP2 locus.

5. The method according to claim 4, characterized in that: The sorghum mentioned is a sorghum inbred line.

6. The application of the method according to claim 4 or 5 in the selection and breeding of tall and thick sorghum.

7. A method for sorghum breeding, characterized by: The method includes detecting the genotype of SNP1 or / and SNP2 as described in claim 1 in the sorghum genome, selecting the homozygous TT type of SNP1 or / and the homozygous TT type of SNP2 as parental breeding, and the breeding objective of the method includes selecting sorghum with tall stems and thick stalks.