An SSR core primer combination, kit and application for identifying the tea tree variety 'Lingtou Dancong'

Abstract

The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea tree variety "Lingtou Dancong". By using the SSR fluorescence labeling detection technology, the present invention screens and obtains 2 pairs of SSR core primers, which can quickly identify and detect "Lingtou Dancong" from other tea tree varieties. The SSR core primer combination disclosed by the present invention can conduct variety identification on "Lingtou Dancong", overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the variety "Lingtou Dancong".

Description

Technical Field

[0001] The present invention relates to the technical field of variety resource identification and germplasm innovation, and in particular to an SSR core primer combination, a kit and an application thereof for identifying the tea variety "Lingtou Dancong". Background Art

[0002] Lingtou Dancong is one of the main tea varieties planted in Guangdong Province. The oolong tea made from it has curved leaves and a yellowish-brown color like that of an eel. It has a floral scent with a hint of honey, a strong and rich aroma, a rich, mellow and sweet taste, a bright orange-red soup, and a bright yellow leaf bottom with red edges.

[0003] At present, the identification of the tea tree variety Lingtou Dancong is based on its morphological characteristics and the experience of the identifier. This method of identification is easily affected by factors such as the identifier's ability, the development stage of Lingtou Dancong, environmental conditions, growth years, and cultivation measures, and there is a technical problem of inaccurate identification results. Therefore, in order to better manage the variety of "Lingtou Dancong", it has become a technical problem that technicians in this field need to urgently solve to establish a set of rapid and effective tea tree variety resource identification methods.

[0004] Molecular marker technology has become the future development direction of variety identification and protection due to its high polymorphism, short testing cycle, and no environmental influence. Therefore, SSR molecular markers have good application prospects in variety-specific evaluation and protection. Summary of the invention

[0005] In order to overcome the above-mentioned defects and shortcomings in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea variety "Lingtou Dancong".

[0006] The first object of the present invention is to provide a SSR core primer combination for identifying the tea variety "Lingtou Dancong".

[0007] The second object of the present invention is to provide the use of the above-mentioned SSR core primer combination in the preparation of an identification product of the tea variety "Lingtou Dancong".

[0008] The third object of the present invention is to provide a product comprising the above-mentioned SSR core primer combination for use in identifying the tea variety "Lingtou Dancong".

[0009] The fourth object of the present invention is to provide a kit for identifying the tea variety "Lingtou Dancong".

[0010] A fifth object of the present invention is to provide a method for identifying the tea variety "Lingtou Dancong".

[0011] To achieve the above object, the present invention provides an SSR core primer combination for identifying the tea tree variety "Lingtou Dancong". The SSR core primer combination includes SSR core primers with nucleotide sequences shown as LT.SSR-1-F, LT.SSR-1-R, LT.SSR-2-F, and LT.SSR-2-R. Among them: The primer sequence of LT.SSR-1-F: CTGCCCTCTCCACCACTTTC; The primer sequence of LT.SSR-1-R: GGCTGCTGGTTCTGTTGTTG; The primer sequence of LT.SSR-2-F: ATGTGACAGCCGGAGTGAAG; The primer sequence of LT.SSR-2-R: GCAGCTGCCTTCAGAGACAT.

[0012] The 5'-end of the SSR core primer shown by the nucleotide sequence LT.SSR-1-F and / or the 5'-end of the SSR core primer shown by the nucleotide sequence LT.SSR-2-F are labeled with a fluorescent reporter group.

[0013] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

[0014] The above SSR core primer combination is used in the preparation of an identification product for the tea tree variety "Lingtou Dancong".

[0015] The product of the above SSR core primer combination is used in the identification of the tea tree variety "Lingtou Dancong".

[0016] A kit for identifying the tea tree variety "Lingtou Dancong" contains the above SSR core primer combination.

[0017] The kit also contains HSTaq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.

[0018] A method for identifying the tea tree variety "Lingtou Dancong" uses the above SSR core primer combination or the above kit for identification.

[0019] A method for identifying the tea tree variety "Lingtou Dancong" includes the following steps:

[0020] S1. Extract the genomic DNA of the tea tree sample to be tested;

[0021] S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification with the above SSR core primer combination;

[0022] S3. Type the PCR amplification product obtained in step S2, and discriminate the bands of the typing result:

[0023] When the nucleotide sequences are used as the SSR core primers LT.SSR-1-F and LT.SSR-1-R to amplify two characteristic bands of 200 bp and 206 bp, and the nucleotide sequences are used as the SSR core primers LT.SSR-2-F and LT.SSR-2-R to amplify two characteristic bands of 189 bp and 192 bp, it indicates that the tea tree sample to be tested is "Lingtou Dancong"; the appearance of other bands indicates that the tea tree sample to be tested is not "Lingtou Dancong".

[0024] The typing method described in step S3 above is to perform capillary electrophoresis on the PCR amplification product; for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O is added to make up 10 μL; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; finally, extension at 60°C for 30 min.

[0025] Advantages and effects of the present invention:

[0026] The present invention discloses an SSR core primer combination, kit and application for identifying the tea tree variety "Lingtou Dancong". The present invention uses the SSR fluorescence labeling detection technology to screen and obtain 2 pairs of SSR core primers, and these 2 pairs of SSR core primers can quickly identify and detect "Lingtou Dancong" from other tea tree varieties. The SSR core primer combination disclosed by the present invention can identify the variety of "Lingtou Dancong", overcome the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the variety of "Lingtou Dancong". Description of the Drawings

[0027] Figure 1 Capillary electrophoresis bands of 23 tea tree varieties / lines amplified by the specific SSR core primers LT.SSR-1-F and LT.SSR-1-R in Example 1.

[0028] Figure 2 Capillary electrophoresis bands of 23 tea tree varieties / lines amplified by the specific SSR core primers LT.SSR-2-F and LT.SSR-2-R in Example 1.

[0029] Figure 3 Capillary electrophoresis bands of 26 tea tree varieties / lines amplified by the specific SSR core primers LT.SSR-1-F and LT.SSR-1-R in Example 2.

[0030] Figure 4 The capillary electrophoresis bands of 26 tea tree varieties / lines amplified by the specific SSR core primers LT.SSR-2-F and LT.SSR-2-R in Example 2. Specific implementation manner

[0031] The present invention will be further described below in conjunction with specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0032] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0033] Example 1 Obtaining the specific primer sequence of "Lingtou Dancong"

[0034] I. Experimental method

[0035] 1. SSR primer design

[0036] The genomic sequences in the tea tree genome database (http: / / tpia.teaplants.cn / ) were retrieved using MISA software to identify SSR loci. 200 pairs of SSR primers were designed in batches using Primer 5.0, and the primers were synthesized by Beijing Yuewei Gene Technology Co., Ltd.

[0037] 2. Extraction of tea tree variety DNA

[0038] Twenty-three tea tree varieties / lines with similar genetic relationships and phenotypes such as "Lingtou Dancong", "Beishan Dancong", "Dancong No. 1", and "Heiye Shuixian" were preliminarily screened. The specific tea tree varieties / lines used for the preliminary screening are shown in Table 1 (obtained from the Guangdong Tea Germplasm Resource Bank).

[0039] Table 1 Twenty-three tea tree varieties / lines used for the preliminary screening

[0040]

[0041] Extract the DNA of the 23 tea tree varieties / lines (Table 1) used for the preliminary screening. The specific steps for DNA extraction are as follows:

[0042] a) Add liquid nitrogen to tea tree leaves and grind them thoroughly. Weigh about 100 mg of the ground powder.

[0043] b) Quickly add 400 μL of buffer GPS and 10 μL of RNase A to the ground powder. After quickly vortexing and mixing, place the centrifuge tube in a 65°C water bath for 15 min, and invert the centrifuge tube several times during the water bath to mix the samples.

[0044] c) Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12,000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12,000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.

[0045] d) Add an equal volume of absolute ethanol and mix well. At this time, flocculent precipitates may appear.

[0046] e) Transfer both the solution and the flocculent precipitates obtained in the previous step to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0047] f) Add 550 μL of deproteinization solution RD to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0048] g) Add 700 μL of washing solution PW to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0049] h) Repeat step g.

[0050] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the collection tube, then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube, and air-dry at room temperature for 5 - 10 min.

[0051] j) Add 50 - 100 μL of elution buffer TB to the RNase-Free adsorption column CR2, let it stand at room temperature for 3 - 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into a centrifuge tube to obtain the tea tree genomic DNA.

[0052] 3. PCR amplification

[0053] Using the tea tree genomic DNA extracted in step 2 above as a template, perform PCR amplification using the SSR fluorescence labeling detection technique. The primers include an upstream primer labeled with a fluorescent reporter group at the 5' end (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and FAM fluorescence labeling is used in the present invention) and a downstream primer. The PCR amplification guided by the upstream primer labeled with a fluorescent reporter group at the 5' end produces a fluorescent PCR product.

[0054] Among them, for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O is added to make up 10 μL.

[0055] The reaction conditions for PCR amplification are as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0056] 4. Genotyping detection

[0057] Capillary electrophoresis detection: Add 9 μL of the mixture of molecular weight internal standard and formamide (volume ratio 0.5:8.5) and 1.0 μL of PCR product to each well of the 96-well plate; denature at 95°C for 3 min, and perform genotyping detection using 3730XL DNA analyzer.

[0058] 5. Data analysis

[0059] Import the original data file obtained by 3730XL DNA analyzer into the analysis software genemapper ID 3.2 for band discrimination analysis.

[0060] II. Experimental results

[0061] Two pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely LT.SSR-1-F, LT.SSR-1-R, LT.SSR-2-F, and LT.SSR-2-R. The primer sequences are shown in Table 2.

[0062] Table 2 Specific SSR core primer sequences

[0063]

[0064] The capillary electrophoresis band statistical results of these 2 pairs of specific SSR core primers amplifying 23 tea tree varieties / lines (Table 1) are shown in Table 3 and Figures 1 - 2 as follows. The results show that characteristic bands appeared in "Lingtou Dancong", specifically:

[0065] (1) The specific SSR core primers LT.SSR-1-F and LT.SSR-1-R amplified two characteristic bands of 200 bp and 206 bp;

[0066] (2) The specific SSR core primers LT.SSR-2-F and LT.SSR-2-R amplified two characteristic bands of 189 bp and 192 bp.

[0067] The above results indicate that two pairs of specific SSR core primers can amplify characteristic bands for the tea cultivar 'Lingtou Dancong', so 'Lingtou Dancong' can be distinguished from the other 22 closely related tea cultivars / lines with similar phenotypes.

[0068] Table 3 Statistical results of capillary electrophoresis bands of two pairs of specific SSR core primers for 23 tea cultivars / lines

[0069]

[0070] Example 2

[0071] Further verification of two pairs of specific SSR core primers

[0072] I. Experimental method

[0073] Two pairs of specific SSR core primers LT.SSR-1-F and LT.SSR-1-R, LT.SSR-2-F and LT.SSR-2-R for identifying 'Lingtou Dancong' obtained by screening were further verified. Twenty-five tea cultivars currently popularized and applied in production were selected for amplification detection simultaneously with 'Lingtou Dancong'. The specific 26 tea cultivars are shown in Table 4.

[0074] Table 4 Twenty-six tea cultivars currently popularized and applied in production

[0075]

[0076] The methods for DNA extraction, PCR amplification, genotyping detection, and data analysis of tea cultivar DNA were carried out according to Example 1.

[0077] II. Experimental results

[0078] The statistical results of capillary electrophoresis bands of two pairs of specific SSR core primers for amplifying 26 tea cultivars (Table 4) are shown in Table 5 and Figures 3 - 4 as follows. The results indicate that only 'Lingtou Dancong' showed characteristic bands, specifically:

[0079] (1) Two pairs of specific SSR core primers LT.SSR-1-F and LT.SSR-1-R amplified two characteristic bands of 200 bp and 206 bp;

[0080] (2) Two pairs of specific SSR core primers LT.SSR-2-F and LT.SSR-2-R amplified two characteristic bands of 189 bp and 192 bp.

[0081] The above results indicate that 2 pairs of specific SSR core primers can amplify specific allelic loci for the tea cultivar 'Lingtou Dancong'. Therefore, 'Lingtou Dancong' can be distinguished from the other 25 tea cultivars that are currently popularized and applied in production.

[0082] Table 5 Capillary electrophoresis band statistics of 26 popularized and applied tea cultivars

[0083]

[0084] Example 3

[0085] A method for identifying 'Lingtou Dancong' using a specific SSR core primer combination

[0086] 1. Extract the DNA of the tea cultivar 'Lingtou Dancong' according to the method of Example 1;

[0087] 2. Using the DNA extracted in step 1 as a template, perform PCR amplification with 2 pairs of specific SSR core primers LT.SSR-1-F and LT.SSR-1-R, LT.SSR-2-F and LT.SSR-2-R. The sequences of the 2 pairs of specific SSR core primers are as follows, and the 5' ends of the upstream primers are all labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):

[0088] LT.SSR-1-F: CTGCCCTCTCCACCACTTTC;

[0089] LT.SSR-1-R: GGCTGCTGGTTCTGTTGTTG;

[0090] LT.SSR-2-F: ATGTGACAGCCGGAGTGAAG;

[0091] LT.SSR-2-R: GCAGCTGCCTTCAGAGACAT;

[0092] 3. The PCR amplification method is carried out according to Example 1:

[0093] Perform genotyping detection and data analysis on the PCR products obtained in step 2. Both the genotyping detection and data analysis methods are carried out according to Example 1.

[0094] 4. Result interpretation:

[0095] If the amplification products of the 2 pairs of specific SSR core primers respectively show the following characteristic bands, it indicates that the tea cultivar to be tested is 'Lingtou Dancong'; if the following characteristic bands do not appear respectively, it indicates that the tea cultivar to be tested is not 'Lingtou Dancong':

[0096] (1)Two characteristic bands of 200 bp and 206 bp were amplified by the specific SSR core primers LT.SSR-1-F and LT.SSR-1-R;

[0097] (2)Two characteristic bands of 189 bp and 192 bp were amplified by the specific SSR core primers LT.SSR-2-F and LT.SSR-2-R.

[0098] Example 4

[0099] A kit for identifying the tea cultivar "Lingtou Dancong"

[0100] I. Composition

[0101] (1)2 pairs of specific SSR core primers, with the 5' ends of the upstream primers labeled with fluorescent reporter groups (the fluorescent reporter groups can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):

[0102] LT.SSR-1-F: CTGCCCTCTCCACCACTTTC;

[0103] LT.SSR-1-R: GGCTGCTGGTTCTGTTGTTG;

[0104] LT.SSR-2-F: ATGTGACAGCCGGAGTGAAG;

[0105] LT.SSR-2-R: GCAGCTGCCTTCAGAGACAT;

[0106] (2)HSTaq DNA polymerase, dNTPs, 10× Buffer, positive control reference, negative control reference, ultrapure water.

[0107] II. Usage method

[0108] Detection and result interpretation are carried out according to the method of Example 3.

[0109] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. An SSR core primer combination for identifying the tea tree variety "Lingtou Dancong", characterized in that, The SSR core primer combination described above comprises SSR core primers with nucleotide sequences shown as LT.SSR-1-F, LT.SSR-1-R, LT.SSR-2-F, and LT.SSR-2-R; wherein: the primer sequence of LT.SSR-1-F is CTGCCCTCTCCACCACTTTC; the primer sequence of LT.SSR-1-R is GGCTGCTGGTTCTGTTGTTG; the primer sequence of LT.SSR-2-F is ATGTGACAGCCGGAGTGAAG; the primer sequence of LT.SSR-2-R is GCAGCTGCCTTCAGAGACAT.

2. The SSR core primer combination according to claim 1, wherein The 5'-end of the SSR core primer shown by the nucleotide sequence LT.SSR-1-F and / or the 5'-end of the SSR core primer shown by the nucleotide sequence LT.SSR-2-F are labeled with a fluorescent reporter group.

3. The SSR core primer combination according to claim 2, characterized in that, The fluorescent reporter group is FAM, HEX, TAMRA, or ROX.

4. Application of the SSR core primer combination according to any one of claims 1 to 3 in the preparation of an identification product for the tea tree variety "Lingtou Dancong".

5. Use of a product containing the SSR core primer combination according to any one of claims 1 to 3 in identifying the tea cultivar "Lingtou Dancong", characterized in that, When the SSR core primers with nucleotide sequences shown as LT.SSR-1-F and LT.SSR-1-R amplify two characteristic bands of 200 bp and 206 bp, and the SSR core primers with nucleotide sequences shown as LT.SSR-2-F and LT.SSR-2-R amplify two characteristic bands of 189 bp and 192 bp, it indicates that the tested tea tree sample is "Lingtou Dancong"; the appearance of other bands indicates that the tested tea tree sample is not "Lingtou Dancong".

6. A kit for identifying the tea tree variety "Lingtou Dancong", characterized in that, Comprises the SSR core primer combination according to any one of claims 1 to 3.

7. The kit according to claim 6, wherein, The kit further comprises HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference, a negative control reference, and ultrapure water.

8. A method for identifying the tea tree variety "Lingtou Dancong", characterized in that, Using the SSR core primer combination according to any one of claims 1 to 3 or the kit according to any one of claims 6 to 7 for identification, when the SSR core primers with nucleotide sequences shown as LT.SSR-1-F and LT.SSR-1-R amplify two characteristic bands of 200 bp and 206 bp, and the SSR core primers with nucleotide sequences shown as LT.SSR-2-F and LT.SSR-2-R amplify two characteristic bands of 189 bp and 192 bp, it indicates that the tested tea tree sample is "Lingtou Dancong"; the appearance of other bands indicates that the tested tea tree sample is not "Lingtou Dancong".

9. The method according to claim 8, wherein Including the following steps: S1. Extract the genomic DNA of the tested tea tree sample. S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification with the SSR core primer combination according to any one of claims 1 to 3. S3. Type the PCR amplification products obtained in step S2 and discriminate the bands of the typing results.

Images