Library construction method, universal joint and kit

Abstract

The embodiment of the invention provides a library construction method, a universal joint and a kit, relates to the technical field of synthetic biology, and is used for constructing a mixed library in which multiple gene segments are directionally connected. The library construction method comprises the following steps: providing a plurality of first initial gene segments; introducing cutting sequences to two ends of each first initial gene segment to obtain a plurality of second initial gene segments; introducing universal joints to two ends of each second initial gene segment to obtain a plurality of target gene segments; wherein the universal joint comprises an identification sequence; performing cutting and connection reaction on the plurality of target gene segments to obtain a mixed library; wherein the plurality of target gene segments are connected according to a set sequence. The library construction method is used for constructing the DNA mixed library.

Description

Technical Field

[0001] The present disclosure relates to the field of synthetic biology technology, and in particular to a library construction method, a universal linker and a kit. Background Art

[0002] Pooled libraries are composed of hundreds, thousands, or even tens of thousands of plasmids, most of which are based on the same backbone sequence and differ only in a small number of regions of interest. Pooled libraries are usually used as single tubes, and all plasmids in the library should be evenly mixed together in principle. Although existing gene assembly methods can solve the problem of constructing a single plasmid containing large fragments of genes in a pooled library, there is still no better solution for the preparation of a pooled library. Summary of the invention

[0003] The purpose of the embodiments of the present disclosure is to provide a library construction method, a universal linker and a kit for directional connection of multiple gene fragments and construction of a mixed library.

[0004] To achieve the above objectives, the embodiments of the present disclosure provide the following technical solutions:

[0005] On the one hand, a library construction method is provided, which includes: providing multiple first initial gene fragments; introducing cutting sequences at both ends of each of the first initial gene fragments to obtain multiple second initial gene fragments; introducing universal adapters at both ends of each of the second initial gene fragments to obtain multiple target gene fragments; wherein the universal adapter includes a recognition sequence; cutting and connecting the multiple target gene fragments to obtain a mixed library; wherein the multiple target gene fragments are connected in a set order.

[0006] The above-mentioned library construction method can determine the directionality of gene fragment connection by introducing cutting sequences at both ends of the gene fragment. By setting a universal linker with a restriction endonuclease recognition sequence, the "GoldenGate" technology can be used to connect multiple gene fragments to obtain a mixed library.

[0007] In some embodiments, the cleavage sequences at both ends of each of the second initial gene fragments are different.

[0008] In some embodiments, among the multiple second initial gene fragments, any two second initial gene fragments connected in a set order are called second initial gene fragment No. 1 and second initial gene fragment No. 2; one of the cutting sequences of the second initial gene fragment No. 1 and one of the cutting sequences of the second initial gene fragment No. 2 are complementary paired after cutting.

[0009] In some embodiments, the step of introducing cutting sequences at both ends of each of the first initial gene fragments comprises: artificial synthesis method or primer amplification method.

[0010] In some embodiments, the universal linker further comprises: a protection sequence and a spacer sequence; the protection sequence, the recognition sequence and the spacer sequence are sequentially connected from the 5' end to the 3' end.

[0011] In some embodiments, the cutting and connecting of the plurality of target gene fragments comprises: using an assembly method of a Golden Gate system to connect the plurality of target gene fragments in a set order to obtain a long-chain gene fragment.

[0012] In some embodiments, the step of cutting and connecting the multiple target gene fragments also includes: providing a vector, using a double enzyme cutting and connection system assembly method, and connecting the long-chain gene fragment and the vector after cutting with the same restriction endonuclease.

[0013] On the other hand, a universal linker is provided, comprising: a recognition sequence, wherein the recognition sequence is used for recognizing a restriction endonuclease cleavage site.

[0014] The universal linker can introduce a restriction endonuclease recognition site into the gene fragment. Under the action of the restriction endonuclease, the gene fragment produces a sticky end, and the gene fragment is connected according to the principle of base complementarity, thereby realizing the construction of a mixed library.

[0015] In some embodiments, the universal linker comprises: a first nucleotide single strand and a second nucleotide single strand, wherein the first nucleotide single strand is complementary to the second nucleotide single strand; the first nucleotide single strand comprises: a protection sequence, the recognition sequence and a spacer sequence connected sequentially from the 5' end to the 3' end.

[0016] In some embodiments, the number of bases in the protection sequence ranges from 3 to 15; in the protection sequence, the ratio of the number of guanine and cytosine to the number of bases in the protection sequence is greater than or equal to 60%; the spacer sequence includes an initial spacer sequence, and the initial spacer sequence includes multiple random bases, each of which is selected from any one of adenine, guanine, cytosine and thymine.

[0017] In some embodiments, the first nucleotide single strand comprises: 5'-GGCTACCACCTGCGAA-3'.

[0018] In some embodiments, the spacer sequence includes: an initial spacer sequence and a connecting base connected to the 3' end of the initial spacer sequence, wherein the connecting base is thymine; the sequence of the first nucleotide single strand is: 5'-GGCTACCACCTGCGAAT-3'.

[0019] In yet another aspect, a kit is provided, comprising: a universal connector as described in any of the above embodiments.

[0020] The above-mentioned kit has the same beneficial technical effects as the universal connector provided in some of the above-mentioned embodiments, which will not be described in detail here. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the present disclosure, the following briefly introduces the drawings required to be used in some embodiments of the present disclosure. Obviously, the drawings described below are only drawings of some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can also be obtained based on these drawings. In addition, the drawings described below can be regarded as schematic diagrams, and are not limitations on the actual size of the product involved in the embodiments of the present disclosure, the actual process of the method, the actual timing of the signal, etc.

[0022] Figure 1 A flowchart of a library construction method provided according to some embodiments of the present disclosure;

[0023] Figure 2 A step diagram of a library construction method provided according to some embodiments of the present disclosure;

[0024] Figure 3 A gel electrophoresis diagram provided according to some embodiments of the present disclosure;

[0025] Figure 4 Another gel electrophoresis diagram provided according to some embodiments of the present disclosure;

[0026] Figure 5 The present invention provides another gel electrophoresis diagram according to some embodiments of the present disclosure. DETAILED DESCRIPTION

[0027] The following will be combined with the accompanying drawings to clearly and completely describe the technical solutions in some embodiments of the present disclosure. Obviously, the described embodiments are only part of the embodiments of the present disclosure, rather than all the embodiments. Based on the embodiments provided by the present disclosure, all other embodiments obtained by ordinary technicians in this field belong to the scope of protection of the present disclosure.

[0028] Unless the context requires otherwise, throughout the specification and claims, the term "including" is to be interpreted as an open, inclusive meaning, that is, "including, but not limited to". In the description of the specification, the terms "one embodiment", "some embodiments", "exemplary embodiments", "examples" or "some examples" and the like are intended to indicate that specific features, structures, materials or characteristics associated with the embodiment or example are included in at least one embodiment or example of the present disclosure. The schematic representations of the above terms do not necessarily refer to the same embodiment or example. In addition, the specific features, structures, materials or characteristics described may be included in any one or more embodiments or examples in any appropriate manner.

[0029] In the following, the terms "first" and "second" are used for descriptive purposes only and are not to be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of the features. In the description of the embodiments of the present disclosure, unless otherwise specified, "plurality" means two or more.

[0030] “At least one of A, B, and C” has the same meaning as “at least one of A, B, or C” and both include the following combinations of A, B, and C: A only, B only, C only, the combination of A and B, the combination of A and C, the combination of B and C, and the combination of A, B, and C.

[0031] “A and / or B” includes the following three combinations: A only, B only, and a combination of A and B.

[0032] As used herein, "about," "substantially," or "approximately" includes the stated value and an average value that is within an acceptable range of variation from the particular value as determined by one of ordinary skill in the art taking into account the measurements in question and the errors associated with the measurement of the particular quantity (i.e., the limitations of the measurement system).

[0033] As used herein, "parallel", "perpendicular", and "equal" include the situations described and situations similar to the situations described, and the range of the similar situations is within the acceptable deviation range, wherein the acceptable deviation range is determined by a person of ordinary skill in the art taking into account the measurement in question and the errors associated with the measurement of a particular quantity (i.e., the limitations of the measurement system). For example, "parallel" includes absolute parallelism and approximate parallelism, wherein the acceptable deviation range of approximate parallelism may be, for example, a deviation within 5°; "perpendicular" includes absolute perpendicularity and approximate perpendicularity, wherein the acceptable deviation range of approximate perpendicularity may also be, for example, a deviation within 5°. "Equal" includes absolute equality and approximate equality, wherein the acceptable deviation range of approximate equality may be, for example, the difference between the two equalities is less than or equal to 5% of either one.

[0034] In the present application, DNA (deoxyribonucleic acid) is a long-chain polymer, the constituent units of which are four deoxynucleotides, namely, adenine deoxynucleotide (dATP), thymine deoxynucleotide (dTTP), cytosine deoxynucleotide (dCTP), and guanine deoxynucleotide (dGTP). Deoxynucleotides are composed of phosphate, deoxyribose, and bases; among them, there are four main bases, namely A (adenine), G (guanine), C (cytosine), and T (thymine).

[0035] In this application, RNA (Ribonucleic Acid) is a genetic information carrier present in biological cells and some viruses and viroids. Its main function in the body is to guide protein synthesis. RNA is a macromolecular polymer composed of ribonucleotides, which are composed of phosphate, ribose and bases; among them, there are four main bases, namely A (adenine), G (guanine), C (cytosine) and U (uracil).

[0036] Synthetic biology is the transformation of biological systems by using engineering ideas and methods to solve problems in energy, materials, health and the environment. In recent years, with the great progress made in technologies such as gene editing and gene synthesis, synthetic biology has developed rapidly and has received widespread attention in the fields of biomedicine, energy and new materials. Long gene fragments and super-large plasmids constructed by synthetic biology technology can serve large-scale metabolic pathway research, chromosome research and genome research, etc., thus facilitating the study of gene function, metabolic pathway function, etc. However, so far, there are many difficulties in the synthesis of super-large plasmids, especially in the preparation of mixed libraries by connecting multiple gene fragments.

[0037] Pooled libraries are composed of hundreds, thousands, or even tens of thousands of plasmids, most of which are based on the same backbone sequence and differ only in a small number of areas of interest. Pooled libraries are usually used as single tubes, and all plasmids in the library should be evenly mixed together in principle. There are several different types of pooled libraries, including cDNA, shRNA, barcoding, phage display, and gRNA libraries. Although existing gene assembly methods, including Gateway, In-fusion, Golden Gate, and Gibson Assembly, can solve the problem of constructing a single plasmid containing large fragments of genes in a pooled library, there is still no better solution for the preparation of a pooled library.

[0038] Among them, single tube refers to single tube genetic engineering, which refers to the use of recombinant DNA technology to insert specific genes into the chromosomes of target organisms so that they express the required specific proteins or produce the expected biological effects. This technology is widely used in agriculture, medicine and industry.

[0039] Although mixed libraries include hundreds, thousands, or even tens of thousands of vectors with different functional gene sequences, they all share the same plasmid vector backbone, so the construction scheme can refer to a single plasmid.

[0040] The first construction scheme is a relatively simple and effective method, which is to first construct each functional gene plasmid separately, and then mix and concentrate them in strict accordance with the same molar ratio to obtain a mixed library with extremely high uniformity.

[0041] The second construction scheme is to construct a single functional gene plasmid, replace the functional gene with other types of functional genes containing homologous ends by using restriction endonuclease-mediated DNA shuffling, and then obtain a mixed library under the action of DNA ligase.

[0042] Among them, restriction endonuclease is an endonuclease that hydrolyzes double-stranded DNA at a specific nucleotide sequence. Restriction endonuclease is an endonuclease that can recognize and cut specific double-stranded DNA sequences in organisms. It is an enzyme that can cut foreign DNA, that is, it can limit the invasion of foreign DNA and make it lose its vitality, but it has no damaging effect on its own DNA, which can protect the original genetic information of the cell. Since this cutting action is carried out inside the DNA molecule, it is called restriction endonuclease. Restriction endonucleases are generally composed of the first letter of the genus name of the microorganism and the first two letters of the species name, and the fourth letter represents the strain (strain). Type I restriction endonucleases can catalyze both the methylation of host DNA and the hydrolysis of non-methylated DNA; while type II restriction endonucleases only catalyze the hydrolysis of non-methylated DNA.

[0043] DNA shuffling is an in vitro homologous recombination technique. A group of homologous genes with different sources but the same function are digested into random fragments with nuclease I. These random fragments form a library and are used as primers and templates for PCR (Polymerase Chain Reaction) amplification. When a gene copy fragment is used as a primer for another gene copy, template exchange occurs, and recombination occurs. After being introduced into the body, positive mutants are selected as a new round of in vitro recombination.

[0044] PCR (Polymerase Chain Reaction) uses a DNA segment as a template, and with the participation of DNA polymerase and nucleotide substrate, the segment of DNA is amplified to a sufficient amount for structural and functional analysis. The PCR principle is to amplify a DNA segment between two known sequences, similar to the replication process of natural DNA. Using the DNA molecule to be amplified as a template and a pair of oligonucleotide fragments complementary to the 5' end and 3' end of the template as primers, under the action of DNA polymerase, the semi-conservative replication mechanism is extended along the template chain until the new DNA synthesis is completed. Repeating this process can amplify the target DNA segment.

[0045] The third construction scheme uses the error-prone PCR method, which is to adjust the PCR reaction conditions, such as using low-fidelity DNA polymerase (Mutazyme II DNA polymerase) to change the mutation errors in the amplification process of the functional gene fragment, thereby randomly introducing mutations into the gene at a certain frequency, and then connecting it to the vector to obtain a random mutant mixed library of the same functional gene.

[0046] The above three methods have their own advantages and disadvantages and can only be applied to the construction of specific mixed libraries. The first construction scheme has low throughput and can only be used to construct mixed libraries with less than 100 species and extremely high uniformity requirements. It is often used in small batch experiments where the sequence is known and it is only used as a control to verify the functional differences of the target gene.

[0047] In comparison, the library obtained by the second construction scheme has a larger library throughput and can be applied to the construction of mixed libraries containing thousands of plasmids. However, this method requires that all functional gene fragments contain the same homologous ends, which not only increases the synthesis cost, but also easily introduces errors during subsequent PCR amplification. In addition, the mixed library constructed using the second method has the problem of low uniformity, so it is only suitable for screening experiments of functional genes.

[0048] Compared with the first two methods, libraries constructed using error-prone PCR are often limited to the screening of functional mutants of specific protein molecules, such as obtaining proteases with specific catalytic activity.

[0049] Based on this, Figure 1 As shown, the embodiments of the present disclosure provide a library construction method, comprising steps R1 to R4.

[0050] R1: Provide a plurality of first initial gene fragments.

[0051] The first initial gene fragment, for example, includes three gene fragments, represented as: L gene, M gene and N gene, and the library construction method provided by the embodiment of the present disclosure is used to realize the connection of L gene, M gene and N gene, and the order of setting L gene, M gene and N gene is: L gene, M gene and N gene are connected in sequence to obtain the long-chain gene fragment of LMN. Among them, L gene includes: L1 fragment and L2 fragment, M gene includes: M1 fragment, M2 fragment, M3 fragment and M4 fragment, and N gene includes: N1 fragment and N2 fragment.

[0052] For example, the sequence of the L1 segment is:

[0053] ATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACC.

[0054] The sequence of the L2 fragment is:

[0055] TTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTG.

[0056] The sequence of the M1 fragment is:

[0057] ATGGGGGTGGATTCGTGGTCGGAGGTCTCGACACAGCTGGGAGATGAGTGAATTTCATAATTATAACTTGGATCTGAAGAAGAGTGATTTTTCAACACGATGGCAAAAGCAAAGATGTCCAGTAGTCAAAAGCAAATGTAGAGAAAATGCATCT.

[0058] The sequence of the M2 fragment is:

[0059] TGGTTTCTGAAGAGAGAGACAAGAAGAGTACATTGAAGAGAAGAAGAGAGTGGACATTTGTCGGGAAACTCCTAACATATGCCCCCATTCTGGAGAGAACACAGAGTACGACACAATCCCTCACACTAAT AGAACAATCCTAAAGGAAGATCCAGCAAATACGGTTTACTCCACTGTGGAAATACCGAAAAAGATGGAAAATCCCCACTCACTGCTCACGATGCCAGACACACCAAGGCTATTTGCCTATGAGAATGTTATC.

[0060] The sequence of the M3 fragment is:

[0061] AAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTG.

[0062] The sequence of the M4 fragment is:

[0063] AGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCC.

[0064] The sequence of the N1 fragment is:

[0065] TACTTCCTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGGCAGCGACCCGGAAACAGCGTATCACTGAGACCGAGTCGCCTTATCAGGAGCTCCAGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAACCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGCAGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAA.

[0066] The sequence of the N2 fragment is:

[0067] CTGTGCGCACGCCCACGCCGCAGCCCCGCCCAAGAAGATGGCAAAGTCTACATCAACATGCCAGGCAGGGGCCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGCAGAGAAGGAAGAAC CCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAA.

[0068] The library construction method provided by the embodiment of the present disclosure is used to realize the connection of L gene, M gene and N gene, that is, to realize the connection of any fragment in each gene with any fragment in another gene. The L gene includes 2 fragments: L1 fragment and L2 fragment, the M gene includes 4 fragments: M1 fragment, M2 fragment, M3 fragment and M4 fragment, and the N gene includes 2 fragments: N1 fragment and N2 fragment. Therefore, there can be a total of 2×4×2=16 connection products. After connection, a long-chain gene fragment is obtained, and the length of the long-chain gene fragment ranges from 500bp to 900bp.

[0069] The size unit of DNA fragments is base pairs, and commonly used units are bp (base pairs), Kbp (kilobase pairs) and Mbp (megabase pairs). Here, the size unit of DNA fragments is bp (base pairs), which means that the number of base pairs contained in the DNA fragments obtained above is 500 to 900.

[0070] The following is an illustration of the connection of two fragments, and the connection of three or more fragments can be understood by reference.

[0071] For example, the L1 segment in the L gene and the M1 segment in the M gene are connected. For the convenience of representation, the two complementary sequences of the L1 segment in the L gene are represented as L 基因 and L 互补 , that is, L 基因 and L 互补 The bases are complementary and paired to form a double-stranded L1 segment in the L gene. The two complementary sequences of the M1 segment in the M gene are represented as M 基因 and M 互补 , that is, M基因 and M 互补 The bases are complementary and paired to form a double-stranded M1 fragment in the M gene. In order to achieve the connection between the L1 fragment in the L gene and the M1 fragment in the M gene, the L1 fragment in the L gene and the M1 fragment in the M gene need to be processed to determine the directionality of the connection, and the specific steps are as shown in R2.

[0072] R2: Figure 2 As shown, cutting sequences are introduced at both ends of each first initial gene fragment to obtain multiple second initial gene fragments.

[0073] Furthermore, in each second initial gene fragment, the two cleavage sequences are different. Among the plurality of second initial gene fragments, any two second initial gene fragments connected in a set order are called the first second initial gene fragment and the second second initial gene fragment. One of the cleavage sequences of the first second initial gene fragment and one of the cleavage sequences of the second second initial gene fragment are complementary paired after cleavage.

[0074] Exemplarily, the three gene segments connected in a set order are: L1 segment, M1 segment and N1 segment. Taking the example that the second initial gene segment No. 1 is the L1 segment in the L gene and the second initial gene segment No. 2 is the M1 segment in the M gene, the cleavage sequences introduced at both ends of the L1 segment in the L gene are different, and the cleavage sequences introduced at both ends of the M1 segment in the M gene are different. The preformed segment is L1-M1-N1. 基因 The 5' end to the 3' end of the L1 fragment in the L gene is the first direction, then the connection order is set to be the M1 fragment in the M gene connected to the downstream of the L1 fragment in the L gene along the first direction, and the cleavage sequence of the pre-connection end of the M1 fragment in the M gene and the L1 fragment in the L gene needs to be designed to be complementary after cleavage. For example, the L1 fragment in the L gene and the M1 fragment in the M gene form the following sequence.

[0075] 5'-GGATCC-L 基因 -AGCG-3'

[0076] 3'-CCTAGG-L 互补 -TCGC-5'.

[0077] Among them, L 基因 The 5' end cleavage sequence is GGATCC, L 基因 The cleavage sequence at the 3' end is AGCG.

[0078] 5'-AGCG-M 基因 -TCAG-3'

[0079] 3'-TCGC-M 互补 -AGTC-3'.

[0080] Among them, M基因 The cleavage sequence at the 5' end is AGCG, M 基因 The cleavage sequence at the 3' end is TCAG.

[0081] The cleavage sequences at the 3' end of the M1 fragment in the M gene and the 5' end of the L1 fragment in the L gene are complementary to each other after cleavage, so that the L1 fragment in the L gene and the M1 fragment in the M gene can be connected in a set order. The specific connection method is introduced in the subsequent content and will not be described in detail here.

[0082] It should be noted that the cut of the two single strands of DNA cut by the restriction endonuclease has several protruding nucleotides, which are complementary to each other. Such a cut is called a sticky end. The sticky ends with complementary bases hybridize and pair under certain conditions.

[0083] Exemplarily, the cleavage sequences are introduced at both ends of each first initial gene fragment, including: artificial synthesis method or primer amplification method.

[0084] It should be noted that when designing a gene, an appropriate number of additional bases can be added immediately after the first and last positions of the gene, such as 2, 5, 8, etc., to form an integer multiple of 3 with the first four sticky ends, and then translated into amino acids (3 bases as a codon, transcribed and translated into one amino acid), avoiding shift of the reading frame and causing gene expression errors.

[0085] R3: Figure 2 As shown, universal adapters are introduced at both ends of each second initial gene fragment to obtain multiple target gene fragments; wherein the universal adapter includes a recognition sequence.

[0086] The universal linker includes a recognition sequence for a restriction endonuclease, wherein the restriction endonuclease is a restriction endonuclease that can produce sticky ends, and the recognition sequence can induce the recognition, binding and cleavage of the restriction endonuclease and the cleavage of the cleavage sequence. For example, the restriction endonuclease can include any one of TALEN, ZNF, CRISPR-Cpf1, AarI, AlwNI, BbsI, BbvI, BcoDI, BfuAI, BglI, BsaI, BsaXI, BsmAI, BsmBI, BsmFI, BspMI, BspQI, BtgZI, DraIII, FokI, PflMI, SfaNI, and SfiI.

[0087] Exemplary, the sequence of the universal linker is:

[0088] 5'-GGCTACCACCTGCGAAt-3'

[0089] 3′-CCGATGGTGGACGCTT-5′.

[0090] Among them, CACCTGC is the recognition sequence of AarI enzyme. The design of universal linker is described in the following content, which will not be described here.

[0091] In order to achieve the connection between the second initial gene fragment and the universal adapter, an adenine (A) is added to the 3' end of multiple second initial gene fragments. That is, an a base (same as A base) is uniformly added to the 3' end of each second initial gene fragment, and a complementary t base (same as T base) is not added at its complementary position.

[0092] For example, taking the L1 fragment in the L gene and the M1 fragment in the M gene as examples, the sequences after adding an adenine at the 3' end are as follows: For the convenience of representation, the added adenine is represented as a.

[0093] 5'-GGATCC-L 基因 -AGCGa-3'

[0094] 3'-aCCTAGG-L 互补 -TCGC-5'.

[0095] 5'-AGCG-M 基因 -TCAGa-3'

[0096] 3'-aTCGC-M 互补 -AGTC-3'.

[0097] Exemplarily, the target gene fragment obtained after the L1 fragment in the L gene is connected to the universal adapter is as follows.

[0098] GGCTACCACCTGCGAAt-GGATCC-L 基因 -AGCGa-TTCGCAGGTGGTAGCC

[0099] CCGATGGTGGACGCTT-aCCTAGG-L 互补 -TCGC-tAAGCGTCCACCATCGG.

[0100] The target gene fragment obtained after connecting the M1 fragment in the M gene with the universal adapter is as follows.

[0101] GGCTACCACCTGCGAAt-AGCG-M 基因 -TCAGa-TTCGCAGGTGGTAGCC

[0102] CCGATGGTGGACGCTT-aTCGC-M 互补 -AGTC-tAAGCGTCCACCATCGG.

[0103] In the process of library construction, the introduction of universal adapters can introduce only one adapter sequence into the multi-gene fragments to achieve the sequential connection of different gene fragments. That is, in the process of library construction, the adapters used are the same, which can save costs and processes.

[0104] R4: Cutting and connecting multiple target gene fragments to obtain a mixed library, wherein the multiple target gene fragments are connected in a set order.

[0105] The step of cutting and connecting the multiple target gene fragments includes: using the Golden Gate system assembly method to connect the multiple target gene fragments in a set order to obtain a long-chain gene fragment.

[0106] Among them, the assembly method of the "Golden Gate" system is to use the "Golden Gate" cloning method in the same reaction system using type IIS restriction endonucleases and DNA ligases to connect multiple target gene fragments in a set order, thereby achieving "seamless" connection of multiple gene fragments in one step.

[0107] Exemplarily, AarI enzyme is used as restriction endonuclease, and the recognition sequence of AarI enzyme is CACCTGC. The target gene fragment obtained by L1 fragment in L gene and M1 fragment in M ​​gene forms the following sequence including sticky ends under the action of AarI enzyme.

[0108] GGATCC-L 基因

[0109] GG-L 互补 -TCGC.

[0110] AGCG-M 基因

[0111] M 互补 -AGTC.

[0112] Under the action of ligase, the L1 fragment in the L gene and the M1 fragment in the M gene are connected, and the obtained long-chain gene fragment is as follows.

[0113] GGATCC-L 基因 -AGCG-M 基因

[0114] GG-L 互补 -TCGC-M 互补 -AGTC.

[0115] It can be understood that the above example is an illustrative description of the connection of two gene fragments, and a long-chain gene fragment composed of multiple gene fragments can be obtained by referring to the above method.

[0116] The step of cutting and connecting multiple target gene fragments also includes: providing a vector, using a double enzyme cutting and connection system assembly method, and connecting the long-chain gene fragment and the vector after cutting with the same restriction endonuclease.

[0117] Exemplarily, the vector is linearized using BamHI and XbaI enzymes to obtain a linear vector, and the long-chain gene fragment formed by LMN is digested using BamHI and XbaI enzymes, and then the linear vector and the LMN long-chain gene fragment after digestion are connected to obtain a circular plasmid library.

[0118] The long gene fragments in the circular plasmid library are then amplified and enriched to identify the connection status.

[0119] Exemplarily, the long gene fragment on the circular plasmid is amplified and enriched by using primers using the PCR (Polymerase Chain Reaction) method to identify the connection status.

[0120] The library construction method provided in the embodiments of the present disclosure can set the direction of gene fragment connection by introducing cutting sequences at both ends of the gene fragments, and can use the "Golden Gate" technology to connect multiple gene fragments to obtain a mixed library by setting a universal linker with a restriction endonuclease recognition sequence.

[0121] In some embodiments, the embodiments of the present disclosure further provide a universal linker, which includes: a recognition sequence, and the recognition sequence is used to recognize the restriction endonuclease cleavage site.

[0122] The restriction site is a specific sequence of bases on the DNA that the restriction endonuclease can recognize and cut into two segments. Moreover, the restriction site is uniquely determined by the selected restriction endonuclease.

[0123] The universal linker provided in the embodiments of the present disclosure includes a recognition sequence of a restriction endonuclease cleavage site. After the universal linker is connected to the gene fragment, under the action of the restriction endonuclease, the gene fragment can be cut in a set manner to produce sticky ends. Then, according to the principle of base complementarity, the sticky ends of the two gene fragments are complementary and connected, thereby realizing the connection of the gene fragments. The specific method for constructing a DNA mixed library refers to the above content and will not be repeated here.

[0124] Exemplary, restriction endonucleases include any one of TALEN, ZNF, CRISPR-Cpf1, AarI, AlwNI, BbsI, BbvI, BcoDI, BfuAI, BglI, BsaI, BsaXI, BsmAI, BsmBI, BsmFI, BspMI, BspQI, BtgZI, DraIII, FokI, PflMI, SfaNI and SfiI. Among them, TALEN, ZNF and CRISPR-Cpf1 are artificial restriction endonucleases, and AarI, AlwNI, BbsI, BbvI, BcoDI, BfuAI, BglI, BsaI, BsaXI, BsmAI, BsmBI, BsmFI, BspMI, BspQI, BtgZI, DraIII, FokI, PflMI, SfaNI and SfiI are type II restriction endonucleases.

[0125] In some examples, the universal linker includes a first nucleotide strand and a second nucleotide strand, and the first nucleotide strand is complementary to the second nucleotide strand. The first nucleotide strand includes: a protection sequence, a recognition sequence, and a spacer sequence connected sequentially from the 5' end to the 3' end.

[0126] In some examples, the number of bases in the protection sequence ranges from 3 to 15.

[0127] Exemplarily, the number of bases in the protection sequence is 3, 5, 8, 10, 12 or 15, etc., which is not limited here.

[0128] The setting of the number of bases of the protection sequence ranging from 3 to 15 can ensure the stability of the binding of the restriction endonuclease to the restriction site, thereby ensuring the activity of the restriction endonuclease.

[0129] In some examples, in the protection sequence, the ratio of the number of guanine and cytosine to the number of bases in the protection sequence is greater than or equal to 60%.

[0130] That is, the CG content in the protection sequence is ≥60%, and the CG is connected by three hydrogen bonds when complementary pairing, and the connection is relatively stable. This setting is also to ensure the stability of the restriction endonuclease binding to the restriction site, thereby ensuring the activity of the restriction endonuclease.

[0131] In some examples, the spacer sequence includes an initial spacer sequence and a connecting base, the connecting base is connected to the 3' end of the initial spacer sequence, and the initial spacer sequence includes a plurality of random bases, each of which is selected from any one of adenine (A), guanine (G), cytosine (C) and thymine (T). The connecting base is thymine.

[0132] In the step of constructing the DNA mixed library, after the restriction endonuclease is selected, not only the specific restriction site is determined, but also the number of bases contained in the spacer sequence is indirectly determined. According to the restriction endonuclease used in the embodiment of the present disclosure, the spacer sequence can be a sequence including 4 bases, and the initial spacer sequence can be a sequence including 3 bases.

[0133] The spacer sequence is used to connect the recognition sequence and the cleavage sequence. According to the cleavage characteristics of the selected restriction endonuclease, it is ensured that the cleavage site of the restriction endonuclease is located at the cleavage sequence, thereby obtaining complementary sticky ends after cleavage.

[0134] Exemplarily, in the step of constructing a mixed DNA library, AarI enzyme is used as a restriction endonuclease, and the recognition sequence of AarI enzyme is CACCTGC. For example. The sequence of the first nucleotide single strand of the universal linker includes: 5'-GGCTACCACCTGCGAA-3'. Among them, GGCTAC is a protection sequence, CACCTGC is a recognition sequence, GAA is an initial spacer sequence, and the initial spacer sequence is 3 bases. In order to achieve the connection between the universal linker and the gene fragment, a t will be introduced into the 3' of the first nucleotide single strand of the universal linker, and t is a connecting base. The initial spacer sequence of 3 bases is formed into a spacer sequence of 4 bases. The spacer sequence is cut off in the subsequent reaction, and the sticky end of the cleavage sequence is retained.

[0135] Therefore, when no connecting base is introduced at the 3' end of the first nucleotide single strand, the sequence of the universal adapter is:

[0136] 5'-GGCTACCACCTGCGAA-3'

[0137] 3′-CCGATGGTGGACGCTT-5′.

[0138] Among them, 5'-GGCTACCACCTGCGAA-3' is the first nucleotide single strand, 3'-CCGATGGTGGACGCTT-5' is the second nucleotide single strand, and the first nucleotide single strand and the second nucleotide single strand are complementary and paired to form a universal linker.

[0139] In some examples, a thymine is attached to the 3' end of the first nucleotide single strand, and the initial spacer sequence of 3 bases is formed into a spacer sequence of 4 bases.

[0140] The purpose of connecting a thymine to the 3' end of the first nucleotide single strand is to connect the universal adapter to the gene fragment. For the connection between the universal adapter and the gene fragment, please refer to the above content and will not be repeated here.

[0141] Exemplarily, when a linking base is introduced at the 3' end of the first nucleotide single strand, the sequence of the universal adapter is:

[0142] 5'-GGCTACCACCTGCGAAT-3'

[0143] 3′-CCGATGGTGGACGCTG-5′.

[0144] For the convenience of representation, thymine is represented as t, that is, the sequence of the universal linker is:

[0145] 5'-GGCTACCACCTGCGAAt-3'

[0146] 3′-CCGATGGTGGACGCTT-5′.

[0147] The sequence of the first nucleotide single strand of the universal linker includes: 5'-GGCTACCACCTGCGAACt-3', wherein GGCTAC is a protection sequence, CACCTGC is a recognition sequence, and GAAt is a spacer sequence.

[0148] The embodiment of the present disclosure also provides a kit, which includes: the universal linker provided in any of the above embodiments. The kit also includes a restriction endonuclease that can generate sticky ends.

[0149] Exemplary restriction endonucleases include any one of TALEN, ZNF, CRISPR-Cpf1, AarI, AlwNI, BbsI, BbvI, BcoDI, BfuAI, BglI, BsaI, BsaXI, BsmAI, BsmBI, BsmFI, BspMI, BspQI, BtgZI, DraIII, FokI, PflMI, SfaNI and SfiI.

[0150] Exemplarily, the kit further includes: ligase, DNA polymerase, reaction buffer and primers.

[0151] For example, the ligase includes T4 DNA ligase.

[0152] For example, DNA polymerases include Taq DNA polymerase.

[0153] For example, the primers include F1 and R1, wherein the sequence of F1 is: TTCGCCTGTGATTGAGGATCC, and the sequence of R1 is: TTGTACAAGAAAGCTGGGTCTAGA.

[0154] According to the library construction method and universal linker provided in the embodiments of the present disclosure, the following examples are provided.

[0155] 1) Add cutting sequences at both ends of multiple first initial gene fragments.

[0156] Provide multiple first initial gene fragments, for example, multiple first initial gene fragments include: L gene, M gene and N gene, and the introduction of L gene, M gene and N gene is referred to the above content, which will not be repeated here. Add cutting sequences at both ends of the first initial gene fragment to obtain multiple second initial gene fragments.

[0157] The directions of connecting the multiple first initial gene fragments are set by setting the cutting sequence. For a detailed description, please refer to the above content and will not be repeated here.

[0158] 2) The second initial gene fragment is added with reaction a.

[0159] First, prepare the following reaction system:

[0160] Components Volume / Mass Reaction buffer 5μL L / M / N gene fragment mixture 40μL dATP MIX 1μL Taq DNA polymerase 1μL Enzyme-free water Make up to 50 μL

[0161] For example, the above reaction system is quickly prepared on ice. Biological reagents such as enzymes need to be kept at low temperatures to ensure their activity. Mixing on ice can greatly reduce reaction by-products (ice means the reaction has not started).

[0162] For example, the concentration of the L / M / N gene fragment mixture is 20.2 ng / μL.

[0163] Among them, dATP (Deoxyadenosine triphosphate, 3'-deoxyadenosine, also known as deoxyadenosine triphosphate) is used as the raw material for adding A to the end.

[0164] Taq DNA polymerase (Taq DNA Polymerase), referred to as Taq enzyme, is one of the most commonly used DNA polymerases. Taq DNA polymerase is a highly thermostable DNA polymerase derived from the thermophilic bacterium Thermus aquaticus, with a half-life of more than 40 minutes when incubated at 95°C. The molecular weight of Taq enzyme is 94kDa. Taq enzyme can catalyze the polymerization of deoxynucleotides in the 5' to 3' direction that depends on the DNA template. Taq enzyme has no 3' to 5' exonuclease activity and has very low 5' to 3' exonuclease activity. Since Taq enzyme has no 3' to 5' exonuclease activity, it acts as a nucleotidyl transferase in the DNA polymerization process, which will eventually result in 3'-dA overhangs at the 3' end of the PCR product, that is, a 3' sticky end with an A.

[0165] Enzyme-free water refers to water without nuclease and protease activity.

[0166] After the preparation is completed, mix on a vortex machine for 15 seconds, centrifuge on a microcentrifuge for 3 seconds to 5 seconds, and keep warm at 72°C for 5 minutes to 10 minutes.

[0167] This step is to add an extra a base to the 3' end of the synthesized gene to facilitate ligation with the universal adapter in the next step.

[0168] 3) Connect the universal adapter to the second initial gene fragment:

[0169] Prepare the following reaction system:

[0170] Components Volume / Mass L / M / N gene pool 50μL Universal connector 2.5μL Ligation Enhancer 1μL Connection master mix 30μL

[0171] The gene pool is the sum of all genes in a population, and the L / M / N gene pool here refers to a mixed solution of L gene, M gene, and N gene. Ligation Enhancer and ligation premix can use the corresponding solutions in commercially available kits.

[0172] Exemplarily, the concentration of the universal linker is 20 μmol / L. The sequence of the universal linker can refer to the above content and will not be repeated here.

[0173] Ligation Master Mix is ​​a PCR premix containing Taq DNA polymerase, dNTPs, standard Taq enzyme reaction buffer, enzyme stabilizer and bromophenol blue dye, suitable for conventional PCR applications. When used, only templates and primers need to be added to the product solution to perform PCR reactions, which greatly simplifies the operation process, reduces contamination during PCR operations, and can be purchased directly.

[0174] After preparation, vortex and mix for 15 seconds, centrifuge for 3-5 seconds, and immediately perform the following procedure on a PCR instrument (ThermoSimpliAmp PCR):

[0175] Temperature(℃) Time (min) 20 15

[0176] For example, the cover temperature of the PCR instrument (Thermo SimpliAmp PCR) is set to 75°C to prevent the system from backflowing due to uneven heating.

[0177] Then, the product is purified, including steps: (a) to (k).

[0178] (a) Add 110 μL of magnetic bead solution to the above reaction product.

[0179] For example, the volume of the magnetic bead solution is 1.18 times the volume of the reaction product.

[0180] (b) After adding the magnetic beads, pipette and mix well for 15 to 20 times and let stand at room temperature for 5 minutes.

[0181] (c) Place on a magnetic rack and let stand for 5 to 10 minutes.

[0182] (d) Carefully remove the supernatant.

[0183] (e) Add 200 μL of 80% (v / v%) freshly prepared ethanol solution, mix by pipetting 15 to 20 times, and let stand at room temperature for 30 seconds.

[0184] Use ethanol solution to wash away residual salts and proteins in the solution.

[0185] (f) Place on a magnetic rack and let stand for 3 minutes.

[0186] (i) Carefully remove the supernatant and add 200 μL of 80% (v / v%) freshly prepared ethanol solution. Then, place on the magnetic stand for 30 seconds.

[0187] During this process, do not allow the liquid or gun tip to impact the magnetic beads. Touching or impacting the beads will break them up, causing incomplete and uneven subsequent drying, which will affect the elution efficiency.

[0188] (j) Carefully remove the supernatant and place at room temperature for 5 to 10 minutes until the surface of the magnetic beads has no obvious gloss.

[0189] (k) Add 30 μL of enzyme-free water and mix by pipetting 15 to 20 times. Let stand at room temperature for 5 min and transfer 28 μL to a new tube.

[0190] This step is to connect the second initial gene fragment and the universal adapter to obtain the target gene fragment and introduce restriction endonuclease recognition sequences on both sides of the gene.

[0191] 4) Connect the target gene fragments.

[0192] 4.1. Use the “Golden Gate” cloning technology to construct a mixed library of LMN long-chain gene fragments.

[0193] Prepare the following reaction system:

[0194] Components Volume / Mass L gene / M gene / N gene 225ng T4 DNA Ligase Buffer 2μL PaqCI restriction enzyme 15U(1.5μL) PaqCI Catalyst 0.5μL T4 DNA Ligase 1000U(0.5μL) Enzyme-free water Make up to 20 μL

[0195] For example, the concentration of L gene / M gene / N gene in the liquid is 21.6 ng / μL, the concentration of PaqCI restriction endonuclease is 10 U / μL, the concentration of PaqCI catalyst is 20 μmol / L, and the concentration of T4 DNA ligase is 2000 U / μL.

[0196] Among them, the size of enzyme activity, that is, the amount of enzyme, is expressed in enzyme activity units (U). In 1961, the Enzyme Commission of the International Biochemical Society proposed the use of a unified "International Unit" (IU) to express enzyme activity, which is stipulated as follows: Under optimal conditions (25°C), the amount of enzyme required to catalyze 1 micromole (μmol) of substrate into product per minute is defined as one activity unit, that is, 1IU = 1μmol / min. In other words, the enzyme content can be expressed by the number of enzyme activity units per gram or milliliter of enzyme preparation (U / g or U / ml), where U is the abbreviation of IU.

[0197] U / μL is a unit of concentration, which means the unit of enzyme activity per microliter of liquid. It is a commonly used unit for drugs. U stands for unit, and U / μL means how many units of drug are contained in each microliter of the drug.

[0198] It should be noted that PaqCI restriction endonuclease and AarI enzyme have exactly the same recognition sequence and cleavage characteristics and are different names for the same enzyme.

[0199] This step uses the IIS type restriction enzyme PaqCI to recognize the universal linker sequences on both sides of the gene fragment, thereby cutting at specific sites to produce four-base sticky ends; then the gene fragments with reverse complementary sticky ends will hybridize and complement each other, forming a complete long-chain DNA under the action of ligase.

[0200] Then, set the following reaction program on a PCR instrument (Thermo SimpliAmp PCR) and quickly add the above mixture.

[0201]

[0202] 4.2) Rubber cutting and recycling.

[0203] The ligation product was detected by 1% agarose gel electrophoresis at 120 V for 30 min. The DNA fragments of the corresponding size bands were purified and recovered by using an agarose gel DNA recovery kit according to the instructions.

[0204] 4.3) PCR amplification.

[0205] The product of the previous step is amplified using F1 and R1 as primers, thereby amplifying the successfully connected LMN long fragment.

[0206] Exemplarily, the sequence of F1 is TTCGCCTGTGATTGAGGATCC. The sequence of R1 is: TTGTACAAGAAAGCTGGGTCTAGA.

[0207] The experiments were performed using commercially available kits.

[0208] Prepare the following reaction system:

[0209] Components Volume / Mass PrimeSTAR Max Premix (2X) 20μL Primer F1 solution 1μL Primer R1 solution 1μL Previous step purification 5μL Enzyme-free water Make up to 40 μL

[0210] For example, the concentration of the primer F1 solution is 10 μmol / L, and the concentration of the primer R1 solution is 10 μmol / L.

[0211] After the preparation is completed, mix on a vortex machine for 15 seconds and centrifuge in a microcentrifuge for 3 seconds to 5 seconds.

[0212] Then, set the following reaction program on a PCR instrument (Thermo SimpliAmp PCR) and quickly add the above mixture.

[0213]

[0214] After the above procedures, the amplified and enriched LMN long-chain gene fragments were obtained. Figure 3 As shown, it is diffuse in the target segment (500bp-900bp), indicating that the LMN gene connection effect is good.

[0215] 5) Construction of recombinant vector.

[0216] 5.1) Double restriction enzyme digestion of vector and long-chain gene fragment.

[0217] In this step, BamHI and XbaI enzymes are used to linearize the vector to obtain a linear vector. Figure 4 As shown, it can be seen that the band is single and bright, indicating that the linearization effect of the vector is good. The LMN long-chain gene fragment is digested at the beginning and end using BamHI enzyme and XbaI enzyme.

[0218] Prepare the following reaction system:

[0219] Components Volume / Mass BamHI solution 10U(0.5μL) XbaI solution 10U(0.1μL) <![CDATA[rCutSmart TM Buffer]]> 5μL Vector or long gene fragment 1 μg Ultrapure water Make up to 50 μL

[0220] For example, the concentration of the BamHI solution is 20 U / μL, and the concentration of the XbaI solution is 100 U / μL.

[0221] rCutSmart TM Buffer for rCutSmart TMBuffer, more than 215 enzymes are 100% active in a single buffer (rCutSmart buffer), greatly simplifying the establishment of double enzyme digestion reaction system. Since rCutSmart buffer already contains recombinant albumin, it reduces the number of sample tubes, sample addition steps and possible problems. In addition, many DNA modification enzymes are also 100% active in rCutSmart buffer, thus avoiding the subsequent purification step.

[0222] After the preparation is completed, mix on a vortexer for 15 seconds, centrifuge on a microcentrifuge for 3 to 5 seconds, and then incubate at 37°C for 1 hour.

[0223] 5.2) Rubber cutting and recycling.

[0224] The enzyme digestion products were separated and identified by 1% agarose gel electrophoresis, and the linearized vector segments were purified and recovered. Compared with the non-linearized vector, the linearized vector showed slower running speed on the electrophoresis band.

[0225] 5.3) The vector is connected to the LMN long-chain gene fragment.

[0226] Prepare the following reaction system:

[0227] Components Usage Linearized vector X Enzyme digestion of LMN long gene fragment 1X~5X T4 DNA Ligase 1U~5U(0.1μL~0.5μL) T4 DNA Ligase Buffer 2μL Ultrapure water Make up to 10 μL

[0228] Where X is the number of moles. For example, the concentration of T4 DNA ligase is 10 U / μL.

[0229] After preparation, mix on a vortexer for 15 seconds, centrifuge on a microcentrifuge for 3 to 5 seconds, and then store at 16°C overnight or at room temperature for 30 minutes.

[0230] 5.4) Pick the grown colonies into a 5 mL test tube, culture them at 37°C and 180 rpm (revolutions per minute) overnight, then expand the culture at a ratio of 1:100, extract the plasmid, and store at -20°C for later use.

[0231] 5.5) Use primers F1 and R1 to amplify the target long-chain gene fragment LMN in the vector, and perform electrophoresis detection to observe the appearance of bright bands in the target range.

[0232] Prepare the following reaction system:

[0233] Components Volume / Mass PrimeSTAR Max Premix (2X) 20μL Primer F1 solution 1μL Primer R1 solution 1μL Circular plasmid 2μL Enzyme-free water Make up to 40 μL

[0234] Then, set the following reaction program on a PCR instrument (Thermo SimpliAmp PCR) and quickly add the above mixture.

[0235]

[0236] The products were detected by gel electrophoresis to evaluate the types of long-chain gene fragments connected to the vector.

[0237] Gel electrophoresis Figure 5 As shown, 1 is a mixed plasmid library constructed using the embodiment of the present disclosure. It can be seen from the figure that there are diffuse bands, indicating that the plasmid library covers multiple types. 2 is the corresponding vector after restriction digestion. It can be seen from the figure that the vector band is single. 3 is a mixed plasmid library constructed using a commercially available kit (Gibson kit, commercially available). 4 is the vector after restriction digestion corresponding to the commercially available kit (Gibson kit). 6 is the product of the L / M / N three-fragment connection (i.e., the LMN long-chain gene fragment). 7 is the L / M / N three-fragment connection product amplified from 1. 8 is the L / M / N three-fragment connection product amplified from 3. 7 and 8 show by amplifying the target bands that in the plasmid library constructed using the embodiments of the present disclosure, the distribution of connected gene fragments is narrower and there are fewer impurity bands, while the library constructed using the commercially available kit (Gibson kit) has more random connection products and the distribution of impurity bands is extremely broad. This proves that the library construction method provided by the embodiments of the present disclosure can successfully construct a mixed library formed by connecting multiple gene fragments, and has better specificity than the method of the commercially available kit.

[0238] Therefore, the library construction method provided by the implementation of the present disclosure can realize the construction of a super-large mixed library.

[0239] The above is only a specific embodiment of the present disclosure, but the protection scope of the present disclosure is not limited thereto. Any changes or substitutions that can be thought of by any person skilled in the art within the technical scope disclosed in the present disclosure should be included in the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure should be based on the protection scope of the claims.

Claims

1. A method for constructing a library, characterized in that: include: Providing a plurality of first initial gene fragments; Introducing cutting sequences at both ends of each of the first initial gene fragments to obtain a plurality of second initial gene fragments; Introducing universal adapters at both ends of each of the second initial gene fragments to obtain multiple target gene fragments; wherein the universal adapter includes a recognition sequence; The multiple target gene fragments are subjected to cutting and ligation reaction to obtain a mixed library; wherein the multiple target gene fragments are ligated in a set order.

2. The library construction method according to claim 1, characterized in that The cleavage sequences at both ends of each of the second initial gene fragments are different.

3. The library construction method according to claim 2, characterized in that Among the multiple second initial gene fragments, any two second initial gene fragments connected in a set order are called second initial gene fragment No. 1 and second initial gene fragment No. 2; one of the cutting sequences of the second initial gene fragment No. 1 and one of the cutting sequences of the second initial gene fragment No. 2 are complementary paired after cutting.

4. The library construction method according to any one of claims 1 to 3, characterized in that: The step of introducing cutting sequences at both ends of each of the first initial gene fragments includes: artificial synthesis method or primer amplification method.

5. The library construction method according to any one of claims 1 to 3, characterized in that: The universal linker further comprises: a protection sequence and a spacer sequence; the protection sequence, the recognition sequence and the spacer sequence are sequentially connected from the 5' end to the 3' end.

6. The library construction method according to any one of claims 1 to 3, characterized in that: The cutting and connecting reaction of the plurality of target gene fragments comprises: using the Golden Gate system assembly method to connect the plurality of target gene fragments in a set order to obtain a long-chain gene fragment.

7. The library construction method according to claim 6, characterized in that The cutting and connecting reaction of the plurality of target gene fragments also includes: providing a vector, adopting an assembly method of a double enzyme cutting and connecting system, and connecting the long-chain gene fragment and the vector after cutting with the same restriction endonuclease.

8. A universal joint, characterized in that: include: Recognition sequence, the recognition sequence is used to recognize the restriction endonuclease cleavage site.

9. The universal joint according to claim 8, characterized in that: include: a first nucleotide single strand and a second nucleotide single strand, wherein the first nucleotide single strand is complementary to the second nucleotide single strand; The first nucleotide single strand includes: a protection sequence, the recognition sequence and a spacer sequence sequentially connected from the 5' end to the 3' end.

10. The universal joint according to claim 9, characterized in that: The number of bases in the protection sequence ranges from 3 to 15; In the protection sequence, the ratio of the number of guanine and cytosine to the number of bases in the protection sequence is greater than or equal to 60%; The spacer sequence includes an initial spacer sequence, and the initial spacer sequence includes: a plurality of random bases, each of which is selected from any one of adenine, guanine, cytosine and thymine.

11. The universal joint according to claim 9 or 10, characterized in that: The first nucleotide single strand includes: 5'-GGCTACCACCTGCGAA-3'.

12. The universal joint according to claim 9 or 10, characterized in that: The spacer sequence includes: an initial spacer sequence and a connecting base connected to the 3' end of the initial spacer sequence, wherein the connecting base is thymine; the sequence of the first nucleotide single chain is: 5'-GGCTACCACCTGCGAAT-3'.

13. A kit, characterized in that: include: A universal joint as claimed in any one of claims 8 to 12.

Images