Application of APK protein in regulating alfalfa resistance to pythium root rot

Abstract

The application discloses application of APK protein in regulation of alfalfa resistance to pythium root rot. The application provides a protein, named MtAPK mutant protein, which is as follows: (a1) a protein obtained by replacing the 20th amino acid residue in SEQ ID NO: 1 with an amino acid residue simulating a non-phosphorylated form; or (a2) a fusion protein obtained by connecting a tag to the N terminal or / and C terminal of the protein in (a1). The application further provides a method for cultivating a transgenic plant with improved resistance to root rot, comprising the following steps: mutating a gene encoding an MtAPK protein in the genomic DNA of a receptor plant into a gene encoding an MtAPK mutant protein to obtain a transgenic plant with improved resistance to root rot; and the MtAPK protein is a protein shown in SEQ ID NO: 1.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and relates to application of APK protein in regulation of alfalfa resistance to pythium root rot. BACKGROUND

[0002] Alfalfa is a high-quality forage with the longest cultivation time and the largest cultivation area in the world, and is an important source of nutrition for animal husbandry and dairy industry. When infected by pythium, a large number of alfalfa plants will die, directly affecting the planting density and yield of alfalfa. Even if the plants do not die, their growth will be inhibited, growing slowly, with reduced branching, and the overall yield of alfalfa will be greatly reduced. The content of nutrients in alfalfa infected by pythium changes, and the quality of alfalfa decreases, affecting the nutritional value and palatability of alfalfa as feed, and thus reducing the economic value of alfalfa.

[0003] Pythium belongs to oomycetes, and pythium can produce oospores in infected plant tissues. These oospores can survive in the soil for many years even without host plants, which is an important source of infection in field production systems. Once the environmental conditions are suitable, the transmission and pathogenicity of pythium infection are very fast, and the efficacy of conventional chemical pesticides is limited. Therefore, using genetic improvement and molecular breeding to cultivate new varieties to control the occurrence of diseases is the most economical and effective measure, and is also the only way for the development of forage industry in the future. SUMMARY

[0004] The application aims to provide application of APK protein in regulation of alfalfa resistance to pythium root rot.

[0005] The application provides a protein, named MtAPK mutant protein, which is as follows (a1) or (a2):

[0006] (a1) a protein obtained by replacing the 20th amino acid residue in SEQ ID NO: 1 with an amino acid residue simulating a non-phosphorylated form;

[0007] (a2) a fusion protein obtained by connecting a tag to the N terminus or / and C terminus of the protein in (a1).

[0008] The amino acid simulating a non-phosphorylated form is alanine (Ala), glycine (Gly), valine (Val) or leucine (Leu).

[0009] When the amino acid simulating a non-phosphorylated form is alanine, the MtAPK mutant protein is as shown in SEQ ID NO: 4. The protein as shown in SEQ ID NO: 4 is named MtAPK S20A protein.

[0010] The tag can be specifically as shown in Table 1.

[0011] Sequences of the tags of Table 1

[0012] Tag Residue Sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0013] The present application also provides a protein-related biological material, which is described in any one of (b1) to (b4) below:

[0014] (b1) a nucleic acid molecule encoding the MtAPK mutant protein;

[0015] (b2) an expression cassette containing the nucleic acid molecule of (b1);

[0016] (b3) a recombinant vector containing the nucleic acid molecule of (b1) or a recombinant vector containing the expression cassette of (b2);

[0017] (b4) a recombinant microorganism containing the nucleic acid molecule of (b1) or a recombinant microorganism containing the expression cassette of (b2) or a recombinant microorganism containing the recombinant vector of (b3).

[0018] The nucleic acid molecule encoding the MtAPK mutant protein can be specifically a gene encoding the MtAPK mutant protein.

[0019] Specifically, the gene encoding the MtAPK mutant protein is as follows (c1) or (c2) or (c3):

[0020] (c1) a DNA molecule obtained by mutating a codon encoding the 20th amino acid residue in a DNA molecule encoding the protein shown in SEQ ID NO: 1 to a codon encoding an amino acid mimicking a non-phosphorylated form from a codon encoding serine;

[0021] (c2) a DNA molecule derived from alfalfa, having 95% or more identity to (c1) and encoding the MtAPK mutant protein;

[0022] (c3) a DNA molecule hybridizing to the nucleotide sequence defined in (c1) under stringent conditions and encoding the MtAPK mutant protein.

[0023] The stringent conditions can be hybridization at 65°C in a solution of 0.1x SSPE (or 0.1x SSC), 0.1% SDS, and washing the membrane in a DNA or RNA hybridization experiment.

[0024] The amino acid mimicking a non-phosphorylated form is alanine (Ala), glycine (Gly), valine (Val), or leucine (Leu).

[0025] The 20th amino acid residue in SEQ ID NO: 1 is serine.

[0026] As an example, a codon encoding serine is TCT.

[0027] As an example, a codon encoding alanine is GCT, GCC, GCA, or GCG.

[0028] As an example, a codon encoding glycine is GGT, GGC, GGA, or GGG.

[0029] As an example, a codon encoding valine is GTT, GTC, GTA, or GTG.

[0030] As an example, a codon encoding leucine is TTA, TTG, CTT, CTC, CTA, or CTG.

[0031] When the mutant protein is MtAPK S20A protein, the gene encoding the mutant protein is named MtAPK S20A gene.

[0032] As an example, the MtAPK S20A gene is as follows (d1) or (d2) or (d3):

[0033] (d1) a DNA molecule whose coding sequence is shown in SEQ ID NO: 5;

[0034] (d2) a DNA molecule derived from Medicago sativa and having more than 95% identity to (d1) and encoding the MtAPK S20A protein;

[0035] (d3) a DNA molecule hybridizing to the nucleotide sequence defined in (d1) under stringent conditions and encoding the MtAPK S20A protein.

[0036] The stringent conditions can be hybridization at 65°C in a solution of 0.1 x SSPE (or 0.1 x SSC), 0.1% SDS, and washing the membrane in a DNA or RNA hybridization experiment.

[0037] The present application also provides use of the MtAPK mutant protein or the gene encoding the MtAPK mutant protein in regulating the disease resistance of a plant to root rot.

[0038] The regulation is positive regulation.

[0039] Substituting the MtAPK protein with the MtAPK mutant protein enhances the disease resistance of a plant to root rot.

[0040] Substituting the gene encoding the MtAPK protein with the gene encoding the MtAPK mutant protein enhances the disease resistance of a plant to root rot.

[0041] The application also provides the use of the MtAPK mutant protein or the gene encoding the MtAPK mutant protein in regulating the resistance of a plant to Phytophthora.

[0042] The regulation is positive regulation.

[0043] Replacing the MtAPK protein with the MtAPK mutant protein enhances the disease resistance of a plant to Phytophthora.

[0044] Replacing the gene encoding the MtAPK protein with the gene encoding the MtAPK mutant protein enhances the disease resistance of a plant to Phytophthora.

[0045] The application also provides the use of the above protein-related biological material in the preparation of a transgenic plant with improved disease resistance to root rot.

[0046] The application also provides the use of the above protein-related biological material in the preparation of a transgenic plant with improved resistance to Phytophthora.

[0047] The application also provides a method for cultivating a transgenic plant with improved disease resistance to root rot, comprising the following steps: introducing a gene encoding a MtAPK mutant protein into a recipient plant to obtain a transgenic plant with improved disease resistance to root rot.

[0048] The application also provides a method for cultivating a transgenic plant with improved resistance to Phytophthora, comprising the following steps: introducing a gene encoding a MtAPK mutant protein into a recipient plant to obtain a transgenic plant with improved resistance to Phytophthora.

[0049] The application also provides a method for cultivating a transgenic plant with improved disease resistance to root rot, comprising the following steps: mutating a gene encoding a MtAPK protein (i.e., a MtAPK gene) in the genomic DNA of a recipient plant into a gene encoding a MtAPK mutant protein to obtain a transgenic plant with improved resistance to root rot.

[0050] The application also provides a method for cultivating a transgenic plant with improved resistance to Phytophthora, comprising the following steps: mutating a gene encoding a MtAPK protein in the genomic DNA of a recipient plant into a gene encoding a MtAPK mutant protein to obtain a transgenic plant with improved resistance to Phytophthora.

[0051] The MtAPK protein is a protein as shown in SEQ ID NO: 1.

[0052] Illustratively, the MtAPK gene is as follows (e1) or (e2) or (e3) or (e4):

[0053] (e1) a DNA molecule encoding a sequence as shown in SEQ ID NO: 2;

[0054] (e2) a DNA molecule as shown in SEQ ID NO: 3;

[0055] (e3) a DNA molecule derived from Medicago sativa and having more than 95% identity to (e1) or (e2) and encoding the MtAPK protein;

[0056] (e4) a DNA molecule hybridizing to the nucleotide sequence defined in (e1) or (e2) under stringent conditions and encoding the MtAPK protein.

[0057] The stringent conditions can be hybridization in a solution of 0.1 x SSPE (or 0.1 x SSC), 0.1% SDS at 65°C and washing the membrane in a DNA or RNA hybridization experiment.

[0058] Introducing the gene encoding the MtAPK mutant protein into the recipient plant is specifically achieved by introducing a recombinant vector.

[0059] The recombinant vector can be specifically a recombinant expression vector.

[0060] Illustratively, the recombinant expression vector can be specifically a recombinant plasmid as follows: taking pCAMBIA1381 vector as the starting vector, inserting the DNA molecule as shown in SEQ ID NO: 8 between EcoRI and Sail enzyme cutting sites, and inserting the gene encoding the MtAPK mutant protein between Sail and Bglll enzyme cutting sites, to obtain the recombinant plasmid.

[0061] Any of the above mentioned Phytophthora is Phytophthora medicaginis.

[0062] Any of the above mentioned Phytophthora is Phytophthora medicaginis 44390 strain.

[0063] Any of the above mentioned plant is a legume.

[0064] Any of the above mentioned plant is a Medicago plant.

[0065] Any of the above mentioned plant is Medicago polymorpha.

[0066] Any of the above mentioned plant is Medicago polymorpha R108 ecotype.

[0067] Any of the above mentioned plant is Medicago polymorpha Tntl insertion mutant NF7291, Medicago polymorpha Tntl insertion mutant NF15395 or Medicago polymorpha Tntl insertion mutant NF15906.

[0068] Any of the above plants is a homozygous Tnt1 insertion mutant in the selfed progeny of Medicago truncatula Tnt1 insertion mutant NF7291, a homozygous Tnt1 insertion mutant in the selfed progeny of Medicago truncatula Tnt1 insertion mutant NF15395, or a homozygous Tnt1 insertion mutant in the selfed progeny of Medicago truncatula Tnt1 insertion mutant NF15906.

[0069] The inventors obtained Medicago truncatula Tnt1 insertion mutants from Medicago truncatula Mutant Database, and screened and identified Mtapk mutants (NF7291, NF15395, NF15906) therefrom. Homozygous mutant plants exhibit curled leaves, dwarf plants, shortened root length, and activated immune response in the plant body.

[0070] The 20th amino acid residue (serine) of Medicago truncatula MtAPK protein can be phosphorylated by MtVIK protein kinase, and the phosphorylation state of MtAPK protein affects the resistance of the plant to pathogenic bacteria. In the absence of inoculation of Phytophthora, the growth and development of gene complementation plants (ProMtAPK:MtAPK / Mtapk, ProMtAPK:MtAPK S20A / Mtapk and ProMtAPK:MtAPK S20D / Mtapk) have no significant difference compared with wild type plants, indicating that the simulated phosphorylated form and the simulated non-phosphorylated form of the 20th amino acid residue (serine) of MtAPK protein do not affect growth and development. In the case of inoculation of Phytophthora, the resistance of ProMtAPK:MtAPK S20A / Mtapk plants to Phytophthora is significantly enhanced, the resistance of ProMtAPK:MtAPK / Mtapk plants to Phytophthora has no significant difference, and the resistance of ProMtAPK:MtAPK S20D / Mtapk plants to Phytophthora is weak. It is indicated that the simulated non-phosphorylated form of MtAPK protein can improve the resistance of the plant to Medicago truncatula Phytophthora.

[0071] The present application provides a valuable resource for breeding new germplasm of Medicago truncatula resistant to Medicago truncatula Phytophthora root rot. BRIEF DESCRIPTION OF DRAWINGS

[0072] Figure 1 It is an illustration of the insertion position of the three mutants in Example 1 and a comparison of the phenotypes of homozygous mutants in the selfed progeny of the three mutants with wild type plants.

[0073] Figure 2 It is a PCR identification figure for identifying homozygous mutants from plants in the selfed progeny of the three mutants in Example 1.

[0074] Figure 3 PCR identification and related sequencing results in Example 3.

[0075] Figure 4 Population photos embodying plant survival rate in Example 3.

[0076] Figure 5 Plant individual photos and plant trait detection results in Example 3.

[0077] Figure 6 Related result graphs in Example 4.

[0078] Figure 7 Related result graphs in Example 5. DETAILED DESCRIPTION

[0079] The present application will be further described in conjunction with the specific embodiments, and the embodiments given are only for the purpose of illustrating the present application, but not for limiting the scope of the present application. The embodiments provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not constitute any limitation on the present application in any way.

[0080] The experimental methods in the following examples are all routine methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified. In the following examples, quantitative experiments were set up in triplicate, and the results were averaged, unless otherwise specified. The data analysis in the examples was performed using SPSS and GraphPad Prism, and the experimental results were expressed as mean ± standard deviation, and two-way comparisons were performed using one-way ANOVA, Kruskal-Wallis, and nonparametric test Tukey’s test. In the examples, plant height refers to the length from the top of the plant to the root tip (i.e., plant height = height of aboveground part + length of root), unless otherwise specified. In the examples, the meaning of light-dark alternating culture is “16 hours light / 8 hours dark”, unless otherwise specified. The flowerpot specifications are 9 cm in diameter and 11 cm in height. The culture medium is a mixture of 5 parts by volume of vermiculite and 2 parts by volume of perlite.

[0081] Medicago truncatula R108 (Medicago truncatula R108 ecotype), also referred to as wild type plant or wild type alfalfa, is denoted as WT or wild type or R108. Both Medicago truncatula R108 and pCAMBIA1381 vector are described in Jinling Liu, Hong Chen, Li Liu, Xiangzhao Meng, Qianwen Liu, Qinyi Ye, Jiangqi Wen, Tao Wang, Jiangli Dong. A cargo sorting receptor mediates chloroplast protein trafficking through the secretory pathway. The Plant Cell. 2024 Sep 3;36(9):3770-3786. which is publicly available from the applicant and only for the purpose of repeating the experiments of the present invention.

[0082] The Phytophthora medicaginis used in the examples is the 44390 strain, which is described in Zhang Zhengguang, Wang Yuanchao, Zheng Xiaobo. rDNA ITS sequence analysis of Phytophthora sojae and Phytophthora medicaginis. Shengwu Xitong, 2003, 22(4): 542-548.

[0083] Solid SH3a medium (1 L): SH macro mother liquor (10x) 100 mL, SH micro mother liquor (1000x) 1 mL, SH organic mother liquor (1000x) 1 mL, EDFS iron salt mother liquor (50x) 20 mL, Myo-inositol 0.1 g, 2,4-D stock solution (10 mg / mL) 0.4 mL, 6-BAP stock solution (1 mg / mL) 0.5 mL, sucrose 30 g, agar 8 g, the rest is water; pH value is 5.85. The difference between liquid SH3a medium and solid SH3a medium is only that the liquid SH3a medium does not contain agar.

[0084] Solid SH9 medium (1 L): SH macro mother liquor (10x) 100 mL, SH micro mother liquor (1000x) 1 mL, SH organic mother liquor (1000x) 1 mL, EDFS iron salt mother liquor (50x) 20 mL, Myo-inositol 0.1 g, sucrose 20 g, agar 8 g, the rest is water; pH value is 5.85.

[0085] Solid 1 / 2MS medium (1 L): MS macro mother liquor (20x) 25 mL, MS micro mother liquor (200x) 5 mL, MS organic mother liquor (200x) 5 mL, MS iron salt mother liquor (200x) 5 mL, sucrose 20 g, agar 8 g, the rest is water; pH value is 5.85.

[0086] Solid V8 medium (1 L): contains 100 mL V8 juice (American V8 fruit and vegetable juice), 2.5 g calcium carbonate and 15 g agar, the rest is water.

[0087] The formula of each mother liquor used in the preparation of the medium or the commercially available source of the storage solution is shown in Table 2 and Table 3.

[0088] Table 2

[0089]

[0090] Table 3

[0091]

[0092]

[0093] The nucleotide sequences of the primers involved in the examples are shown in Table 4.

[0094] Table 4

[0095] apk F’ GGCTCTTTACGCAAAACTCTC apk R’ AACAATGACAATGAAAGTGGGTA apk F ATTGTTTGATGCTTCTTGGTT apk R TGTTCACAAAGATTCCACCC Tnt1-F TACTCCAGACATTTTTATTTTTCAC APKpro-F GCAGGAATTCGACAGAGTTCATTTGTGCTTT APK-R TTTCCAAGGAAGTTTAAAAGC

[0096] Example 1, Obtaining and phenotype detection of Medicago truncatula Mtapk mutant

[0097] Medicago truncatula Tnt1 insertion mutant NF7291 (referred to as mutant NF7291), Medicago truncatula Tnt1 insertion mutant NF15395 (referred to as mutant NF15395) and Medicago truncatula Tnt1 insertion mutant NF15906 (referred to as mutant NF15906) are all obtained by inserting Tnt1 transposon into the genomic DNA of wild type alfalfa, and are all obtained from Medicago truncatula Mutant Database (https: / / medicago-mutant.dasnr.okstate.edu / mutant / database.php; contact email: jiangqi.wen@okstate.edu).

[0098] The insertion position of Tnt1 transposon in the genomic DNA of mutant NF7291 is between the 104th and 105th nucleotides of the MtAPK gene (genotype: heterozygous). The insertion position of Tnt1 transposon in the genomic DNA of mutant NF15395 is between the 306th and 307th nucleotides of the MtAPK gene (genotype: heterozygous). The insertion position of Tnt1 transposon in the genomic DNA of mutant NF15906 is between the 1892th and 1893th nucleotides of the MtAPK gene (genotype: heterozygous). The schematic diagram of the insertion position is shown in Fig. A. The above position intervals are counted from the A of the start codon ATG of the MtAPK gene as the 1st position. Figure 1

[0099] The Tnt1 insertion mutant (mutant NF7291 or mutant NF15395) of Medicago truncatula is self-crossed and the seeds are harvested. The seeds are cultivated into plants, and then the leaves of the plants are taken and the genomic DNA is extracted. The genomic DNA is used as a template, and primer pair 1 (consisting of Tnt1-F and apk R', and the target fragment size is 1319 bp or 1117 bp) and primer pair 2 (consisting of apk F' and apk R', and the target fragment size is 666 bp) are used for PCR identification, respectively. If a plant shows the target amplification product using primer pair 1 and does not show the target amplification product using primer pair 2, the plant is a homozygous Tnt1 insertion mutant. The identification results of the progeny plants of NF7291 are shown in Fig. A, and the identification results of the progeny plants of NF15395 are shown in Fig. B. The lanes marked by the dashed boxes correspond to the homozygous Tnt1 insertion mutants. Figure 2 Figure 2

[0100] The Tnt1 insertion mutant NF15906 of Medicago truncatula is self-crossed and the seeds are harvested. The seeds are cultivated into plants, and then the leaves of the plants are taken and the genomic DNA is extracted. Primer pair 3 (consisting of Tnt1-F and apk R, and the target fragment size is 1078 bp) and primer pair 4 (consisting of apk F and apk R, and the target fragment size is 609 bp) are used for PCR identification, respectively. If a plant shows the target amplification product using primer pair 3 and does not show the target amplification product using primer pair 4, the plant is a homozygous Tnt1 insertion mutant. The identification results of the progeny plants of NF15906 are shown in Fig. C. The lanes marked by the dashed boxes correspond to the homozygous Tnt1 insertion mutants. Figure 2

[0101] Compared with the wild-type plants, the homozygous Tnt1 insertion mutants screened from the progeny plants have obvious growth and development defects (see Fig. 3). Figure 1 ​​​​B), which is characterized by dwarf, leaf curling, root length shortening, and immune response activation in plant body. To further clarify the influence of MtAPK gene mutation on plant growth and development, the phenotype of homozygous Tnt1 insertion mutant was statistically analyzed, and the plant height, aboveground height and root length of wild type plant and homozygous Tnt1 insertion mutant grown for three weeks under normal growth conditions were counted respectively. The results are shown in Table 1. Figure 1 C, D and E. The plant height, aboveground height and root length of homozygous Tnt1 insertion mutant were significantly lower than those of wild type plant, which indicated that MtAPK gene mutation significantly inhibited the growth and development of plant.

[0102] Example 2, construction of recombinant expression vector

[0103] MtAPK gene promoter (as shown in SEQ ID NO: 8) was inserted between EcoRI and SalI enzyme cutting sites, and the target gene was inserted between SalI and BglII enzyme cutting sites to obtain the recombinant plasmid. The recombinant plasmid has been sequenced and verified. The 20th serine (Ser, S) of MtAPK protein was mutated to alanine (Ala, A) to simulate the non-phosphorylated form. The 20th serine (Ser, S) of MtAPK protein was mutated to aspartic acid (Asp, D) to simulate the persistent phosphorylated form.

[0104] When the target gene is MtAPK gene (as shown in SEQ ID NO: 2), the obtained recombinant plasmid is named as pCAMBIA1381-ProMtAPK:MtAPK plasmid.

[0105] When the target gene is MtAPK S20A gene (as shown in SEQ ID NO: 5), the obtained recombinant plasmid is named as pCAMBIA1381-ProMtAPK S20A :MtAPK plasmid.

[0106] When the target gene is MtAPK S20D gene (as shown in SEQ ID NO: 7), the obtained recombinant plasmid is named as pCAMBIA1381-ProMtAPK S20D :MtAPK plasmid.

[0107] Example 3, obtaining and identification of Medicago truncatula transgenic material

[0108] I. Preparation of trans-MtAPK gene material

[0109] 1. Preparation of recombinant Agrobacterium.

[0110] The pCAMBIA1381-ProMtAPK:MtAPK plasmid was introduced into EHA105 Agrobacterium to obtain recombinant Agrobacterium.

[0111] 2. Preparation of infection solution

[0112] The recombinant Agrobacterium obtained in step 1 was inoculated into liquid YEP medium containing 75 mg / L rifampicin and 50 mg / L kanamycin, and cultured at 28°C with 230 rpm shaking until the OD 600nm value was 0.6-0.8. Then, the bacteria were collected by centrifugation at 5000 rpm for 6 min, resuspended in liquid SH3a medium containing 0.1 mM acetosyringone, and the OD 600nm value was 0.6-0.8, which was the infection solution.

[0113] 3. Preparation of explants

[0114] The mutant NF15395 was self-crossed and seeds were harvested, and the seeds were cultivated into plants. When the plants grew for 3 weeks, the leaves of the plants were taken, cut into 0.5 cm 2 in size, which were the explants.

[0115] 4. Infection

[0116] The explants prepared in step 3 were placed in a sealed container containing the infection solution, mixed well, then vacuumized (-0.1 pka, 30 min), then cultured at room temperature, in the dark, at 80 rpm for 1.5 h. Then, the explants were taken out, the bacterial solution on the surface was removed with sterile water filter paper, and then plated on solid SH3a medium containing 0.1 mM acetosyringone, covered with a single layer of filter paper, and cultured in the dark at 22°C for 3 days.

[0117] 5. Induction of callus

[0118] After step 4 was completed, the explants were transferred to solid SH3a medium containing 10 mg / L hygromycin and 200 mg / L phosphinothricin, and cultured in the dark at 25°C for 6 weeks (subcultured every 2 weeks).

[0119] 6. Induction of bud differentiation

[0120] After step 5 was completed, the induced callus was transferred to solid SH9 medium containing 5 mg / L hygromycin and 200 mg / L phosphinothricin, and cultured at 25°C with alternating light and dark for 9 weeks (subcultured every 3 weeks).

[0121] 7. Rooting

[0122] After step 6 was completed, the seedlings with 2-3 leaves were transferred to solid 1 / 2MS medium (transferred to new solid 1 / 2MS medium every 3 weeks), and cultured at 25°C with alternating light and dark until the plants rooted.

[0123] 8、 After step 7, the rooted plant is transferred to a greenhouse for culture (22℃ light culture for 16 hours / 18℃ dark culture for 8 hours, the light intensity during light culture is 70-80 μmol·m -2 ·s -1 , the relative humidity is 70%). During the culture, the leaf is taken, the genomic DNA is extracted, and PCR identification is performed.

[0124] The wild type plant is used as the negative control of the tested plant during the PCR identification. The method of PCR identification: the genomic DNA is used as the template, and the primer pair 3 (consisting of Tnt1-F and apk R, the target fragment size is 1078bp), the primer pair 4 (consisting of apk F and apk R, the target fragment size is 609bp) and the primer pair 5 (consisting of APKpro-F and APK-R, the target fragment size is 3079bp) are used for PCR identification. The plant meeting the following standard is the plant with positive PCR identification: during the PCR identification, the primer pair 3 shows the target amplification product, the primer pair 4 does not show the target amplification product, and the primer pair 5 shows the target amplification product.

[0125] The plant with positive PCR identification is recovered for sequencing verification of the target fragment obtained by using the primer pair 5 during the PCR identification. The plant meeting the following standard is the plant with the transgenic MtAPK gene: the sequencing result has the segment shown in the 1st to 1431st positions of SEQ ID NO: 2.

[0126] The PCR identification and the related sequencing result are shown in Figure 3 .

[0127] 9、 The plant with the transgenic MtAPK gene screened in step 8 is selfed and the seed is harvested, and the seed is cultivated into a plant (i.e. the T1 generation plant). The homozygous plant with the transgenic MtAPK gene is screened from the T1 generation plant. The screening method: the leaf is taken, the genomic DNA is extracted, the primer pair 5 (consisting of APKpro-F and APK-R, the target fragment size is 3079bp) is used for PCR amplification, then the target amplification product is recovered and sequenced, if the sequencing result is only one kind and has the segment shown in the 1st to 1431st positions of SEQ ID NO: 2, the T1 generation plant is the homozygous plant with the transgenic MtAPK gene.

[0128] II. Preparation of the transgenic MtAPK S20A gene material

[0129] 1、 Preparation of the recombinant Agrobacterium.

[0130] The pCAMBIA1381-ProMtAPK S20A :MtAPK plasmid is introduced into the EHA105 Agrobacterium to obtain the recombinant Agrobacterium.

[0131] 2. Preparation of infection medium

[0132] Step 1.2.

[0133] 3. Preparation of explants

[0134] Step 1.3.

[0135] 4. Infection

[0136] Step 1.4.

[0137] 5. Induction of callus

[0138] Step 1.5.

[0139] 6. Induction of bud differentiation

[0140] Step 1.6.

[0141] 7. Rooting

[0142] Step 1.7.

[0143] 8. After completion of step 7, the rooted plantlets are transferred to a greenhouse (22℃ light culture for 16 hours / 18℃ dark culture for 8 hours, light intensity of 70-80 μmol·m -2 ·s -1 , relative humidity of 70%) for culture. During the culture, leaves are taken and genomic DNA is extracted for PCR identification.

[0144] The wild type plant is used as a negative control for the test plant in the PCR identification. The method for PCR identification is as follows: genomic DNA is used as a template and primer pair 3 (consisting of Tnt1-F and apk R, target fragment size of 1078 bp), primer pair 4 (consisting of apk F and apk R, target fragment size of 609 bp) and primer pair 5 (consisting of APKpro-F and APK-R, target fragment size of 3079 bp) are used for PCR identification. The plant that meets the following criteria is a plant that is identified as positive by PCR: in the PCR identification, the target amplification product is shown using primer pair 3 and the target amplification product is not shown using primer pair 4 and the target amplification product is shown using primer pair 5.

[0145] The plant that is identified as positive by PCR is recovered for sequencing verification of the target fragment obtained using primer pair 5 in the PCR identification. The plant that meets the following criteria is a plant that is transformed with the MtAPK S20A gene: the sequencing result has a segment shown in SEQ ID NO: 5 from 1 to 1431.

[0146] PCR identification and related sequencing results are shown in Figure 3 .

[0147] 9. The trans-MtAPK screened in step 8 S20A The transgenic plants are selfed and seeds are harvested, and the seeds are cultivated into plants (i.e. T1 generation plants). The homozygous trans-MtAPK plants are screened from the T1 generation plants by the following method: leaves are taken, genomic DNA is extracted, and PCR amplification is performed using primer pair 5 (consisting of APKpro-F and APK-R, and the target fragment size is 3079 bp), and then the target amplification product is recovered and sequenced, and if the sequencing result is only one kind and has the segment shown in positions 1 to 1431 of SEQ ID NO: 5, the T1 generation plant is a homozygous trans-MtAPK plant S20A The transgenic plants are selfed and seeds are harvested, and the seeds are cultivated into plants (i.e. T1 generation plants). The homozygous trans-MtAPK plants are screened from the T1 generation plants by the following method: leaves are taken, genomic DNA is extracted, and PCR amplification is performed using primer pair 5 (consisting of APKpro-F and APK-R, and the target fragment size is 3079 bp), and then the target amplification product is recovered and sequenced, and if the sequencing result is only one kind and has the segment shown in positions 1 to 1431 of SEQ ID NO: 5, the T1 generation plant is a homozygous trans-MtAPK plant S20A The transgenic plants are selfed and seeds are harvested, and the seeds are cultivated into plants (i.e. T1 generation plants). The homozygous trans-MtAPK plants are screened from the T1 generation plants by the following method: leaves are taken, genomic DNA is extracted, and PCR amplification is performed using primer pair 5 (consisting of APKpro-F and APK-R, and the target fragment size is 3079 bp), and then the target amplification product is recovered and sequenced, and if the sequencing result is only one kind and has the segment shown in positions 1 to 1431 of SEQ ID NO: 5, the T1 generation plant is a homozygous trans-MtAPK plant

[0148] III. Preparation of trans-MtAPK S20D Transgenic materials

[0149] 1. Preparation of recombinant Agrobacterium

[0150] The pCAMBIA1381-ProMtAPK S20D : MtAPK plasmid is introduced into EHA105 Agrobacterium to obtain recombinant Agrobacterium.

[0151] 2. Preparation of infection solution

[0152] The same as step one 2.

[0153] 3. Preparation of explants

[0154] The same as step one 3.

[0155] 4. Infection

[0156] The same as step one 4.

[0157] 5. Induction of callus

[0158] The same as step one 5.

[0159] 6. Induction of bud differentiation

[0160] The same as step one 6.

[0161] 7. Rooting

[0162] The same as step one 7.

[0163] 8. After step 7 is completed, the rooted plants are transferred to a greenhouse for culture (22℃ light culture for 16 hours / 18℃ dark culture for 8 hours, and the light intensity during light culture is 70-80 μmol·m -2 ·s -1 , and the relative humidity is 70%). During the culture process, leaves are taken, genomic DNA is extracted, and PCR identification is performed.

[0164] Wild type plants were used as negative controls in PCR identification. The method of PCR identification: PCR identification was performed using primer pair 3 (consisting of Tnt1-F and apk R, target fragment size 1078 bp), primer pair 4 (consisting of apk F and apk R, target fragment size 609 bp) and primer pair 5 (consisting of APKpro-F and APK-R, target fragment size 3079 bp) respectively, with genomic DNA as template. Plants meeting the following criteria were PCR identified as positive: in PCR identification, primer pair 3 showed target amplification product, primer pair 4 did not show target amplification product, and primer pair 5 showed target amplification product.

[0165] Plants identified as positive by PCR were recovered for sequencing verification of the target fragment obtained using primer pair 5 in PCR identification. Plants meeting the following criteria were transgenic MtAPK plants: in the sequencing results, there was a segment shown in positions 1 to 1431 of SEQ ID NO: 7. S20D

[0166] PCR identification and related sequencing results are shown in Table 1. Figure 3 .

[0167] 9、Step 8, the transgenic MtAPK S20D gene plants screened out were selfed and seeds were harvested, and the seeds were cultivated into plants (i.e. T1 generation plants). Homozygous transgenic MtAPK S20D gene plants were screened from the T1 generation plants. Screening method: leaf blades were taken, genomic DNA was extracted, and PCR amplification was performed using primer pair 5 (consisting of APKpro-F and APK-R, target fragment size 3079 bp), then the target amplification product was recovered and sequenced, and if the sequencing results were only one kind and had a segment shown in positions 1 to 1431 of SEQ ID NO: 7, the T1 generation plant was a homozygous transgenic MtAPK S20D gene plant.

[0168] Four, phenotype identification

[0169] Test seeds: selfed seeds of homozygous transgenic MtAPK gene plants obtained in Step One (denoted as MtAPK / Mtapk), selfed seeds of homozygous transgenic MtAPK S20A gene plants obtained in Step Two (denoted as MtAPK S20A / Mtapk), selfed seeds of homozygous transgenic MtAPK S20D gene plants obtained in Step Three (denoted as MtAPK S20D / Mtapk) or seeds of wild type alfalfa (denoted as R108).

[0170] ​1. Put the test seeds in 2 mL centrifuge tubes, add 1 mL of 98% concentrated sulfuric acid, shake gently for 8 min, then rinse with sterile water for 8 times, then add 1 mL of 5% sodium hypochlorite aqueous solution and treat for 12 min, then rinse with sterile water for 10 times, then spread the seeds on 0.8% water agar plates, and incubate at 4°C in the dark for 3 days, then incubate at room temperature in the dark for 12 hours (at this time the seeds germinate).

[0171] 2. Preparation of control pots and test pots

[0172] Control pots: Take the pots, fill them with culture medium (700 cm 3 Culture medium / pot) and all the contents of a control dish, mix well. Control dish: Add 15 mL of solid V8 medium that has not yet solidified to a 90 mm diameter dish, let it solidify, and incubate at 28°C for 6 d.

[0173] Test pots: Take the pots, fill them with culture medium (700 cm 3 Culture medium / pot) and all the contents of a test dish, mix well. Test dish: Add 15 mL of solid V8 medium that has not yet solidified to a 90 mm diameter dish, let it solidify, then inoculate with P. medicaginis (0.5 cm 3 plug / pot), and incubate at 28°C for 6 d.

[0174] 3. Group treatment

[0175] Control group (CK): Take the control pots and sow the germinated seeds obtained in step 1 (5 seeds per pot).

[0176] Test group (P.m.): Take the test pots and sow the germinated seeds obtained in step 1 (5 seeds per pot).

[0177] Incubation conditions: 28°C, light and dark alternation. Incubation time: 3 weeks.

[0178] 25 plants per group were set for each test seed.

[0179] After the incubation was completed, the morphology was observed and photographed, and the photographs are shown in Figure 4 .

[0180] After the incubation was completed, the survival rate was calculated. After the incubation was completed, the whole plants (i.e. including the roots and the aboveground parts) were taken, washed, then dried, then photographed and the fresh weight, aboveground part height, root length and plant height were measured, and the leaves were taken for relative conductivity detection. The photographs are shown in Figure 5 A. The results of survival rate, fresh weight, aboveground part height, root length, plant height and conductivity are shown in Figure 5 B. Figure 5Among them, the data marked with different letters are significantly different, and the data marked with the same letter are not significantly different.

[0181] The control group: compared with wild type alfalfa, the growth and development of backfill plants (MtAPK / Mtapk, MtAPK S20A / Mtapk, MtAPK S20D / Mtapk) had no significant difference. Test group: the survival rate of MtAPK S20A / Mtapk plants was about 75%, and the survival rate of R108 plants was about 50%. The survival rate of MtAPK S20A / Mtapk plants was significantly higher than that of R108 plants. The fresh weight, height of aboveground part, root length and plant height of MtAPK S20A / Mtapk plants were significantly higher than those of R108 plants. The relative electrical conductivity of MtAPK S20A / Mtapk plant leaves was significantly lower than that of R108 plants. The results showed that the mutation of the 20th serine of the MtAPK protein of Medicago polymorpha to alanine significantly improved the resistance of the plant to P. medicaginis.

[0182] Example 4, obtaining and identifying of transgenic materials of Medicago polymorpha

[0183] I. Preparation of transgenic MtAPK gene materials

[0184] The method is the same as step one of example 3.

[0185] The PCR identification results are shown in Figure 6 B.

[0186] Two plants were randomly selected from the homozygous transgenic MtAPK S20A gene plants in T1 generation plants, named MtAPK / Mtapk-2 plants and MtAPK / Mtapk-6 plants.

[0187] II. Phenotypic identification

[0188] Test plants: wild type plants, homozygous Tnt1 insertion mutants in the offspring of mutant NF15906 in example 1 (denoted as Mtapk), selfed offspring plants of MtAPK / Mtapk-2 plants (denoted as MtAPK / Mtapk-2), selfed offspring plants of MtAPK / Mtapk-6 plants (denoted as MtAPK / Mtapk-6).

[0189] The test plants were cultured in flowerpots containing culture medium (700cm 3 of culture medium per flowerpot). 5 plants per flowerpot. Culture conditions: 28℃, light and dark alternation culture. The culture time was 3 weeks from the beginning of seed germination.

[0190] Each test plant was set up with 25 plants as biological repeats.

[0191] After completion of the culture, the morphology was observed and photographed, and the photographs are shown in Figure 6 A.

[0192] After completion of the culture, the whole plant (i.e. including the root and the aboveground part) was taken, washed, and then wiped dry, and then the height of the aboveground part, the root length, and the plant height were measured. The results are shown in Figure 6 C, D, and E. Figure 6 In the table, the data marked with different letters are significantly different, and the data marked with the same letter are not significantly different.

[0193] Example 5, mechanism research

[0194] The mechanism research was carried out, and the results are shown in Figure 7 .

[0195] Figure 7 A is to prove that MtVIK can phosphorylate the 20th serine of MtAPK protein by in vitro phosphorylation experiment. Figure 7 B is to prove that MtAPK protein is phosphorylated after inoculation of P. medicaginis, and the phosphorylation band gradually deepens with the extension of the inoculation time (6h-24h). CIAP is alkaline phosphatase, and its function is to remove the phosphate groups on the phosphorylated modified protein. Figure 7 C is to prove that the phosphorylation band of MtAPK protein in Mtvik mutant is weak after inoculation of P. medicaginis; when the 20th serine (Ser, S) is mutated to alanine (Ala, A), MtAPK protein cannot be phosphorylated, and the results show that the 20th serine of MtAPK protein is the key site for MtVIK to phosphorylate MtAPK.

[0196] Note: The conductivity was detected by Mettler FE38-Standard conductivity meter, and the operation method is as follows:

[0197] ① Take 50 mL centrifuge tube, add 20 mL miliQ water, measure the conductivity of the liquid in the centrifuge tube, and record as S0.

[0198] ② Take the centrifuge tube completed in step ①, add the leaves to be tested, then place the centrifuge tube in a vacuum pump and vacuumize for 16 min (≤-0.089 Mpa), then place the centrifuge tube in a shaking bed, incubate at 25℃, 230 rpm for 1 h, measure the conductivity of the liquid in the centrifuge tube, and record as S1.

[0199] ③Take the centrifuge tube of completing step ③, put into boiling water for 35 min, then put the centrifuge tube into the shaker, incubate at 25℃, 230 rpm for 1 h, measure the conductivity of the liquid in the centrifuge tube, record as S2.

[0200] Relative conductivity = (S1-S0) / (S2-S0).

[0201] The application has been described in detail. For those skilled in the art, without departing from the purpose and scope of the application, and without unnecessary experiments, the application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the application gives a special example, it should be understood that the application can be further improved. In general, according to the principle of the application, this application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in this application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. A protein, which is any of the following (al) or (a2): (al) a protein obtained by substituting the 20th amino acid residue in SEQ ID NO: 1 with an alanine residue; (a2) a fusion protein obtained by linking a tag to the N-terminus or / and C-terminus of the protein of (al).

2. A protein-related biological material, which is any of the following (bl) to (b4): (bl) a nucleic acid molecule encoding the protein of claim 1; (b2) an expression cassette containing the nucleic acid molecule of (bl); (b3) a recombinant vector containing the nucleic acid molecule of (bl) or an expression cassette of (b2); (b4) a recombinant microorganism containing the nucleic acid molecule of (bl) or an expression cassette of (b2) or a recombinant vector of (b3). Phytophthora medicaginis 4. Use of the protein of claim 1 or a gene encoding the protein of claim 1 in regulating the resistance of a plant to P. medicaginis.

5. Use of the protein-related biological material of claim 2 in the preparation of a transgenic plant having improved resistance to Phytophthora root rot; the Phytophthora is P. medicaginis.

6. Use of the protein-related biological material of claim 2 in the preparation of a transgenic plant having improved resistance to P. medicaginis.

7. A method for breeding a transgenic plant having improved resistance to Phytophthora root rot, comprising the step of introducing a gene encoding the protein of claim 1 into a recipient plant to obtain a transgenic plant having improved resistance to Phytophthora root rot; the Phytophthora is P. medicaginis.

8. A method for breeding a transgenic plant having improved resistance to P. medicaginis, comprising the step of introducing a gene encoding the protein of claim 1 into a recipient plant to obtain a transgenic plant having improved resistance to P. medicaginis.

3. Use of a protein according to claim 1 or a gene encoding a protein according to claim 1 in modulating the resistance of a plant to Phytophthora root rot; the Phytophthora being P. phaseoli (P. megasperma).

9. A method for breeding a transgenic plant having improved resistance to Phytophthora root rot, comprising the step of mutating a gene encoding a MtAPK protein in the genomic DNA of a recipient plant into a gene encoding the protein of claim 1 to obtain a transgenic plant having improved resistance to Phytophthora root rot; the MtAPK protein is the protein shown in SEQ ID NO: 1; the Phytophthora is P. medicaginis. ).

10. A method for breeding a transgenic plant having improved resistance to P. medicaginis, comprising the step of mutating a gene encoding a MtAPK protein in the genomic DNA of a recipient plant into a gene encoding the protein of claim 1 to obtain a transgenic plant having improved resistance to P. medicaginis; the MtAPK protein is the protein shown in SEQ ID NO:

1. ​ ​ ​ ​ ​ ​

Images