An antibody, antibody composition and application of highly pathogenic porcine reproductive and respiratory syndrome virus

Abstract

The application provides an antibody or antibody binding fragment of high pathogenic porcine reproductive and respiratory syndrome virus ORF5 protein, the antibody has a relatively high relative affinity constant for PRRSV GP5 protein of different lineages and branches, can be combined with target protein with high sensitivity and high specificity, and has high stability; based on the antibody, the antibody can realize accurate, rapid and large-batch detection of PRRSV GP5 protein content in serum or related products, and has a good application prospect in PRRSV GP5 content detection.

Description

Technical Field

[0001] This invention relates to the field of immunological detection methods, and in particular to an antibody, antibody composition, and application of a highly pathogenic porcine reproductive and respiratory syndrome virus. Background Technology

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a contagious viral disease that causes reproductive disorders in pregnant sows; respiratory symptoms in piglets, prolonged fattening time, wasted feed, and increased costs; and, due to immunosuppression, often accompanied by other pathogen infections, leading to higher mortality rates. Breeding pigs experience low fertilization rates and high rates of return to estrus, seriously threatening the development of the global and Chinese pig industry. The pathogen is Porcine reproductive and respiratory syndrome virus (PRRSV). PRRSV is a single-stranded positive-sense RNA virus. Under an electron microscope, the virus particles are observed to be oval, with a diameter of 50-65 nm, and the internal nucleocapsid exhibits icosahedral symmetry, surrounded by a lipid bilayer membrane.

[0003] As a single-stranded RNA virus, PRRSV is highly prone to mutation, with the possibility of base mutations and deletions at any position in the PRRSV genome. This high degree of genomic variation leads to the continuous emergence of new strains in the field. PRRSV exists in multiple genotypes (lineages). In 1996, a PRRSV strain belonging to lineage 5 was isolated in China. In 2006, a highly pathogenic PRRSV strain (lineage 8) broke out in my country, characterized by a 30-amino acid discontinuous deletion in the hypervariable region of its non-structural protein 2 (NSP2). After 2013, a NADC30-like strain (lineage 1) appeared, and subsequently, lineage 1 strains have gradually become the prevalent PRRSV strains in my country. The commonly used detection method for PRRSV is PCR. This method is simple to operate, requires no special equipment, is low-cost, and is less affected by subjective factors. Furthermore, it allows for automated analysis of results, making it particularly important for widespread clinical applications. However, its disadvantages include the need for pretreatment of the test samples, high technical requirements throughout the entire process, and high costs. Although existing technologies such as ELISA and Western blot exist for detecting viral protein expression in serum with high sensitivity and specificity, their complexity and high requirements for laboratory conditions and personnel limit their widespread clinical application. Many diagnostic reagents for identifying PRRSV lineage 1 strains have been developed both domestically and internationally, the vast majority using RT-PCR methods, but there are no reports of monoclonal antibodies specifically for identifying PRRSV lineage 1 strains. The ORF5 gene is a target gene for PRRSV genetic analysis, and its encoded protein is the structural protein with the highest degree of variation in the PRRSV genome, making it a potential diagnostic biomarker. Therefore, this invention is proposed. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides an antibody against the ORF5 protein of highly pathogenic porcine reproductive and respiratory syndrome virus, an antibody composition thereof, and its application.

[0005] Specifically, the technical solution of the present invention is as follows:

[0006] First, from 2020 to 2024, 1143 tissue samples (lungs, lymph nodes, tonsils, spleen, etc.) from large-scale pig farms in Shandong, Liaoning, Zhejiang, Jiangsu, Heilongjiang, Henan, Hebei, Jilin, Fujian, Hunan, Shanxi, Shaanxi, Chongqing, Sichuan, and Tianjin provinces in China were collected for PRRSV virus isolation and gene analysis. Biological software was used to splice and compare the obtained fragment sequences, and the obtained complete genome sequence was subjected to genetic evolution analysis. Recombination analysis software was used to analyze the recombination characteristics of the sequences, further clarifying the whole genome characteristics and recombination features of PRRSV clinical samples in some regions of my country, and providing data support for the molecular epidemiology of PRRSV in my country.

[0007] Furthermore, the present invention expresses and purifies the conserved regions in the above analysis results to prepare antibody 7D12 for the corresponding highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 protein. The amino acid sequence of the light chain variable region of antibody 7D12 is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.2.

[0008] Preferably, the antibody is a monoclonal antibody, Fab, Fab', F(ab')2, Fv, or a single-chain antibody.

[0009] Furthermore, the present invention provides a nucleic acid molecule that encodes the antibody 7D12.

[0010] Preferably, the nucleotide sequence encoding the light chain variable region is as shown in SEQ ID NO:3, or has at least 80% sequence similarity to SEQ ID NO:3; the nucleotide sequence encoding the heavy chain variable region is as shown in SEQ ID NO:4, or has at least 80% sequence similarity to SEQ ID NO:4.

[0011] Furthermore, the present invention provides a biomaterial containing the aforementioned nucleic acid molecules; the biomaterial is an expression cassette, a vector, or a host cell.

[0012] Furthermore, the present invention provides an antibody-drug conjugate of highly pathogenic porcine reproductive and respiratory syndrome virus antibody 7D12, which is obtained by conjugating the 7D12 antibody with a label, wherein the label is selected from one or more of enzyme labeling, biotin labeling, fluorescent dye labeling, chemiluminescent dye labeling, and radioactive labeling.

[0013] Furthermore, the present invention provides a composition of a highly pathogenic porcine reproductive and respiratory syndrome virus antibody 7D12, the composition comprising the antibody 7D12.

[0014] Furthermore, the present invention provides any one of the following (1) to (5) applications of the highly pathogenic porcine reproductive and respiratory syndrome virus antibody 7D12, the nucleic acid molecule, the biological material, the antibody conjugate, or the composition:

[0015] (1) Application in the preparation of products for the detection of the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus (ORF5) in a sample;

[0016] (2) Application in detecting the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus ORF5 in samples for non-diagnostic and therapeutic purposes;

[0017] (3) Use in the preparation of products for neutralizing the activity of highly pathogenic porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 in samples; (4) Use in the preparation of medicines for neutralizing highly pathogenic PRRSV ORF5 in vivo;

[0018] (5) Application in quality control or production of products containing highly pathogenic porcine reproductive and respiratory syndrome virus (ORF5).

[0019] Furthermore, the present invention provides a kit comprising the highly pathogenic porcine reproductive and respiratory syndrome virus antibody 7D12, or the antibody conjugate, or the composition thereof.

[0020] Preferably, the kit is an enzyme-linked immunosorbent assay (ELISA) kit, a fluorescence immunoassay kit, or a chemiluminescent immunoassay kit.

[0021] Beneficial effects

[0022] This study reveals that PRRSV currently exhibits multiple lineages and strains in my country. GP5 protein is a crucial immunogenic protein for PRRSV, and variations in the ORF5 amino acid site may be one of the reasons for vaccine failure. The antibody provided by this invention possesses high relative affinity constants for PRRSV GP5 proteins from different lineages and branches, enabling highly sensitive and specific binding to the target protein, and exhibiting high stability. Based on this antibody, accurate, rapid, and high-volume detection of PRRSV GP5 protein content in serum or related products can be achieved, demonstrating promising application prospects in PRRSV GP5 content detection. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0024] Figure 1This is a schematic diagram of the ORF5 gene sequence analysis in each sample.

[0025] Figure 2 Electrophoresis diagram of ORF5 fragment amplified by PCR, where M is DL-2000 marker, 1 is negative control, and 2-4 are ORF5 amplified fragments.

[0026] Figure 3 Western blot identification of monoclonal antibodies; where 1 is purified GP5 protein, 2 is supernatant of Marc cell culture infected with PRRSV20200715 strain, 3 is supernatant of Marc cell culture infected with JX A1 strain, 4 is supernatant of Marc cell culture infected with HUN4 strain, and 5 is supernatant of Marc cell culture infected with CH-1.

[0027] Figure 4 The selected monoclonal antibodies can be used as tracers for PRRSV in the detection process. Among them, 1 is PRRSV 20200715 strain infected with Marc cells, 2 is JX A1 strain infected with Marc cells, 3 is HUN4 strain infected with Marc cells, 4 is BJ4 strain infected with Marc cells, 5 is GM2 strain infected with Marc cells, and 6 is a negative control. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0029] Example 1: ORF5 sequence analysis of PRRSV and lineage 1: GP5 protein purification

[0030] This study investigated the isolation and gene analysis of PRRSV virus from lung, lymph node, tonsil, and spleen tissue samples collected from large-scale pig farms in Shandong, Liaoning, Zhejiang, Jiangsu, Heilongjiang, Henan, Hebei, Jilin, Fujian, Hunan, Shanxi, Shaanxi, Chongqing, Sichuan, and Tianjin provinces in China between 2020 and 2024. The samples were numbered, ground, and aliquoted into EP tubes, stored at -80℃ for later use. The ORF5 gene of the samples was amplified by PCR using PrimeSTAR HSDNA Polymerase. After the reaction, the PCR products were extracted and identified by electrophoresis. Positive clones were selected for sequencing. Sequence assembly was performed using Seqman software. MegAlign was used to analyze the nucleotide and deduced amino acid homology and amino acid variation sites of the PRRSV ORF5 gene sequence. Genetic evolution analysis of the PRRSV ORF5 gene and representative strains of each lineage was performed using MegAlign and MEGA-X software. A phylogenetic tree was constructed using the Neighbor-joining method (NJ), with the Bootstrap value set to 1000 (representing 1000 replicates) to assess the confidence of the phylogenetic tree branches.

[0031] like Figure 1As shown, the sequence identity of the ORF5 gene nucleotides in the samples was 78.9-100%, and the deduced amino acid sequence identity was 80.2-100%. On the phylogenetic tree, it was distributed across three branches of PRRSV-2: Lineage 1, Lineage 3, and Lineage 8, including two branches of Lineage 1 (Sublineage 1.5 and Sublineage 1.8). The amino acid differences among different lineages of ORF5 were mainly concentrated in the signal peptide region (1aa-26aa), the decoy epitope (27aa-30aa), two hypervariable regions (32aa-35aa, 57aa-61aa), and two transmembrane regions (TM1, TM2), while the neutralizing epitope region (37aa-45aa) was relatively conserved. Mutations of N30D, L28P, and N30S were found in the "decoy" epitope of the GP5 protein (located at amino acid positions 27-30, V / ALVN / S). Mutations of L41S, H37Y, and L38S were found in the neutralizing antigenic epitope (located at amino acid positions 37-45, SHF / LQLIYNL, including the neutralizing epitope binding site (located at positions 39-41, amino acid position L / FQL) and the neutralizing epitope recognition site (located at positions 38 and 42-44, amino acid positions H and IYN)). The antigenic epitopes of GP5 in lineage 1 were conserved, and no mutations were found in the ORF5 amino acids of any lineage in either the decoy or neutralizing epitopes. The representative strain PRRSV 20200715 (lineage 1) was selected for further research.

[0032] Example 2: Screening and identification of PRRSV ORF5 monoclonal antibodies

[0033] ORF5 amplification primers were designed and synthesized (ORF5-F: ATGTTGCGGAAATGCTAGACC; ORF5-R: CTACAATCGACGCCATTGTTC). RNA was extracted from viral samples using a viral RNA extraction kit and reverse transcribed into cDNA. PRRSV was detected using a PRRSV qRT-PCR kit. cDNA with low Ct values ​​was amplified by PCR using the aforementioned ORF5-specific primers. PCR reaction conditions: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, annealing for 30 s, 72℃ extension for 2 min, 35 cycles; 72℃ extension for 3 min. The target fragment was recovered and purified, and ligated into the pET-28a vector using a double enzyme digestion method. Figure 1The recombinant plasmid pET-28a-GP5 was successfully constructed and transformed into E. coli BL21(DE3) to express the recombinant protein. Under IPTG induction, the transformed bacteria successfully expressed recombinant GP5, and the recombinant protein was soluble. High-purity protein was obtained after affinity purification using a Ni-NTA-His column. The concentration of GP5 was determined to be 1 mg / mL using the BCA method.

[0034] Female BALB / c mice aged 6-8 weeks were selected. Recombinant GP5 antigen was emulsified with an equal volume of complete Freund's adjuvant and then subcutaneously immunized with 20 μg of antigen per mouse. Subsequently, every two weeks, mice were subcutaneously immunized three times with the same dose of antigen and incomplete Freund's adjuvant. Serum titers were measured after each immunization. A booster immunization was administered intraperitoneally three days before fusion. Mouse spleen cells and SP2 / 0 cells were mixed at a ratio of 4:1 using PEG Hybri-Max as the fusion agent. The fused cells were then added to 96-well plates (1×10⁻⁶ cells per well). 5 Cells / well), each well containing 0.1 mL of 1×HAT medium. On day 3, add 0.1 mL of HT medium. On day 7, aspirate the medium from the 96-well plate and add 0.2 mL of fresh HT medium. On day 9, collect the supernatant for ELISA detection. The procedure is as follows: Coat a 96-well ELISA plate with purified GP5 protein and incubate overnight at room temperature. Wash three times with washing buffer (PBS + 0.05% Tween 20), then incubate with blocking buffer (PBS + 1% BSA) for 1 hour. Wash the 96-well plate three times. Add hybridoma supernatant and incubate for 1 hour, then wash three times. Add 100 μL of 1:10000 diluted goat anti-mouse IgG secondary antibody to each well, incubate at room temperature for 1 hour, then wash three times. Add 100 μL of TMB to each well for color development for 3 minutes, then add 100 μL / well of stop solution (2M H2SO4) to stop the reaction. Analyze with Tecan... The OD450 signal of each sample was measured using a Spark microplate reader. Wells with two positive results were used for further subcloning. This process was repeated three times until all cloned cell wells showed a 100% positive rate, confirming the successful acquisition of the 7D12 hybridoma cell line capable of stably secreting monoclonal antibodies. Positive monoclonal hybridomas were cultured in 50 mL of serum-free medium for 8-9 days, and the supernatant was collected by centrifugation for further culture.

[0035] Ten-week-old female Balb / c mice were injected intraperitoneally with 0.5 mL of liquid paraffin. Seven days later, they were inoculated intraperitoneally with 1×10 6 One hybridoma cell per cell. Before inoculation, wash the hybridoma cells twice with DMEM medium and adjust the concentration to 1×10⁻⁶. 7Cells / mL were collected, and 0.1 mL of cell suspension was injected into the peritoneal cavity of mice. Ascites fluid was generated after 7 days and collected using a syringe. The collected ascites fluid was centrifuged at 3000 rpm for 5 min, and the supernatant was collected. Monoclonal antibodies were purified using a Protein A column. The purified monoclonal antibodies were dialyzed against PBS overnight at 4°C. Quantification was performed using a BCA quantitative kit, and the concentration was adjusted to 1 mg / mL.

[0036] The monoclonal antibody 7D12 was sequenced, and the sequencing results showed that the amino acid sequence of its light chain variable region was: DIVMTQALSNPVTSASLGSSC RSKSLLHIRNYTSLF WYLQPDGTPQLLIY QMSLHLAS GVPDRFSSSGSGTDFTLRISSLTISNLDQC AQNNTLPYT FGGGTRVLEIK(SEQ ID NO.1), where the underscore is LCDR1-3;

[0037] Its nucleotide sequence is as follows:

[0038] gatattgtgatgacccaggcgctgagcaacccggtgaccagcgcgagcctgggcagcagctgccgcagcaaaagcctgctgcatattcgcaactataccagcctgttttggtatctgcagccggatggcaccccgcagctgctgatttatcagatgagcctgca tctggcgagcggcgtgccggatcgctttagcagcagcggcagcggcaccgattttaccctgcgcattagcagcctgaccattagcaacctggatcagtgcgcgcagaacaacaccctgccgtatacctttggcggcggcacccgcgtgctggaaattaaa(SEQ ID NO.3);

[0039] The amino acid sequence of its heavy chain variable region is as follows:

[0040] EVQLVESGGGLVGSLKLSCALSCASGF TFSYGMS WVRQTPEKRRLELWVA TISRGTYPSYSNSG RFTIDNAKAKTL YLQMSLMNSLRSYYCTR EGIFFNFYVEYSAMY WGQTTLTVSS(SEQ ID NO.2), where the underscore is HCDR1-3;

[0041] Its nucleotide sequence is as follows:

[0042] gaagtgcagctggtggaaagcggcggcggcctggtgggcagcctgaaactgagctgcgcgctgagctgcgcgagcggctttacctttagctatggcatgagctgggtgcgccagaccccggaaaaacgccgcctggaactgtgggtggcgaccattagccgcggcacctatccgagcta tagcaacagcggccgctttaccattgataacgcgaaagcgaaaaccctgtatctgcagatgagcctgatgaacagcctgcgcagctattattgcacccgcgaaggcattttttttaacttttatgtggaatatagcgcgatgtattggggccagaccaccctgaccgtgagcagc(SEQ ID NO.4).

[0043] GP5 antigen was coated onto an ELISA plate and blocked. After washing with PBST, the monoclonal antibody 7D12 was diluted to saturation and added to the plate at 100 μL / well, incubated at room temperature for 2 h. After washing with PBST, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, and 5.0 mol / L NaSCN (sodium thiocyanate) solutions were added sequentially to 60 μL / well, and incubated at room temperature for 15 min. After washing with PBST, HRP-labeled goat anti-mouse IgG was added, and the plate was incubated at room temperature for 45 min for colorimetric detection. The relative affinity constant of the antibody was the sodium thiocyanate concentration corresponding to a decrease in the OD value at 450 nm to 50% of the uneluted value. The results showed that the selected monoclonal antibody 7D12 had an affinity greater than 4 mol / L, indicating good affinity.

[0044] NaSCN (mol / L) 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5 7D12 2.512 2.403 2.137 2.011 1.988 1.974 1.905 1.894 1.348 0.421 0.274

[0045] The collected protein expression samples were mixed with 5× protein loading buffer, boiled for 10 min, and the proteins in the samples were separated by 10% SDS-PAGE electrophoresis and stained with Coomassie Brilliant Blue R-250. Simultaneously, the electrophoretically separated protein samples were transferred to an NC membrane, which was blocked with TBS solution containing 5% skim milk at room temperature for 2 h. The NC membrane was then incubated with selected monoclonal antibodies or tag antibodies, positive serum, etc., at room temperature for 1 h. After washing three times with 0.5% Tween-20 (TBST), it was incubated with HRP-labeled goat anti-mouse IgG (H+L) as a secondary antibody (1:10000) at room temperature for 1 h. After washing three times with TBST, the membrane was developed using ECL, and the immunoblotting results were detected using a Tianneng imaging system. The results showed that the selected monoclonal antibodies could specifically recognize not only the purified GP5 protein but also the GP5 protein expressed in naturally infected Marc-145 cells.

[0046] Indirect immunofluorescence (IFA) detection

[0047] Marc-145 cells were infected with PRRSV strains HuN4, CH-1a, and ZJhz021 at 0.1 MOI. After 24 h of infection, the infected Marc-145 cells were fixed with pre-chilled 80% ethanol. After washing the cells three times with PBS, the selected monoclonal antibodies were added, and the cells were incubated at 37°C for 1 h. After washing three times with PBS, FITC-labeled goat anti-mouse IgG (H+L) diluted 1:1000 was added, and the cells were incubated at 37°C in the dark for 30 min. After washing with PBS, the results were recorded under an inverted fluorescence microscope. The results showed that the selected monoclonal antibodies can be used as PRRSV tracers in the detection of PRRSV.

[0048] The above description of the embodiments is intended to enable those skilled in the art to understand and use the present invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. An antibody or antibody binding fragment against the ORF5 protein of highly pathogenic porcine reproductive and respiratory syndrome virus, characterized in that The amino acid sequence of the light chain variable region of the antibody or antibody binding fragment is shown as SEQ ID NO. 1, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.

2.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the antibody or antibody binding fragment of claim 1.

3. The nucleic acid molecule of claim 2, wherein, The nucleotide sequence encoding the light chain variable region is shown as SEQ ID NO: 3, and the nucleotide sequence encoding the heavy chain variable region is shown as SEQ ID NO:

4.

4. A biological material containing the nucleic acid molecule of claim 2 or 3, wherein the biological material is an expression cassette, a vector or a host cell.

5. A conjugate of an antibody or antibody binding fragment against highly pathogenic porcine reproductive and respiratory syndrome virus, characterized in that The conjugate is obtained by coupling the antibody or antibody binding fragment of claim 1 with a label selected from one or more of an enzyme label, a biotin label, a fluorescent dye label, a chemiluminescent dye label, and a radioactive label.

6. A composition of an antibody or antibody binding fragment against highly pathogenic porcine reproductive and respiratory syndrome virus, wherein the composition comprises the antibody or antibody binding fragment of claim 1.

7. A kit characterized in that The kit comprises the antibody or antibody binding fragment of claim 1, the nucleic acid molecule of claim 2 or 3, the biological material of claim 4, the conjugate of claim 5, and / or the composition of claim 6.

8. The kit of claim 7, wherein the kit is an enzyme-linked immunoassay kit, a fluorescent immunoassay kit or a chemiluminescent immunoassay kit.

9. Use of the antibody or antibody binding fragment of claim 1, the nucleic acid molecule of claim 2 or 3, the biological material of claim 4, the conjugate of claim 5, the composition of claim 6 and / or the kit of claim 7 or 8 in any one of (1) to (2): (1) in the manufacture of a product for detecting the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus in a sample; (2) in the detection of the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus in a sample for non-diagnostic and therapeutic purposes.

9. Use of the antibody or antibody binding fragment of claim 1, the nucleic acid molecule of claim 2 or 3, the biological material of claim 4, the conjugate of claim 5, the composition of claim 6 and / or the kit of claim 7 or 8 in any one of (1) to (2): (1) in the manufacture of a product for detecting the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus in a sample; (2) in the detection of the presence or level of highly pathogenic porcine reproductive and respiratory syndrome virus in a sample for non-diagnostic and therapeutic purposes. ​

Images