Method for synthesizing L-valine from escherichia coli based on membrane-free organelle space regulation and control

Abstract

The invention discloses a method for synthesizing L-valine from escherichia coli based on membrane-free organelle space regulation and control, and belongs to the technical field of biology. By optimizing the sequence of the disordered protein, the RGG-FUSN biomolecular aggregate obtained by connecting the disordered protein RGG with the disordered protein FUSN can form a liquid-liquid phase separation phenomenon, the RGG-FUSN biomolecular aggregate has unique advantages in construction of artificial membraneless organelles, and the aggregation speed of the liquid aggregate is relatively fixed at different induction concentrations. Based on the membrane-free organelle, the key enzyme in the L-valine synthesis process is anchored to the membrane-free organelle in a targeted manner, the key enzyme in a metabolic pathway can be recruited and positioned to the membrane-free organelle through the compartment strategy, the key enzyme is assembled at a specific spatial position, spatial regulation and control are realized, the reaction efficiency is remarkably improved, and directional transfer of a substrate is realized; finally, the production intensity of the L-valine reaches 3.67 g / L / h, which is improved by 38.5% compared with that of a chassis strain.

Description

Technical Field

[0001] The invention relates to a method for realizing the synthesis of L-valine by Escherichia coli based on the spatial regulation of membraneless organelles, and belongs to the field of biotechnology. Background Art

[0002] L-Valine is also known as 2-amino-3-methylbutyric acid, with a molecular formula of C5H 11 NO2, a member of the branched-chain amino acids (BCAAs) family, is an essential amino acid. It is a white crystalline powder solid with a slightly sweet and bitter taste, and its aqueous solution is acidic. It is often used as a human nutritional additive, feed additive, and condiment in the pharmaceutical, pesticide, and health care products industries. It has diverse biological functions and can participate in muscle tissue repair, immune system enhancement, nerve signal transmission regulation, and nitrogen balance. Due to its branched chain characteristics, it plays an important role in metabolic decomposition in muscle and liver. As a food additive, L-valine is often used to improve nutritional ingredients and is widely used in dietary supplements for athletes, helping to accelerate muscle recovery and enhance athletic performance. In the field of feed, L-valine is used as an important nutritional additive for poultry, livestock, and aquatic animals, and is one of the four most important limiting amino acids in low crude protein diets for piglets and broilers. In addition, L-valine, as a precursor of amino acid derivatives, is also widely used in the chemical industry for pharmaceutical intermediates and high value-added chemicals.

[0003] Looking at the global market, my country is a major producer, consumer and exporter of L-valine. And it shows a trend of continuous expansion in the feed and food fields. It is estimated that the global L-valine market size will approach US$1 billion in 2026. Therefore, developing a more efficient and low-cost L-valine production method will not only help consolidate the stable development of the industrial market, but also expand its application in the field of high-value chemicals.

[0004] At present, the mainstream production method of L-valine has been gradually replaced by bio-fermentation from the previous protein hydrolysis extraction method, chemical synthesis method, and enzyme catalytic synthesis method. Bio-fermentation has many advantages: the de novo synthesis pathway can use cheap carbon sources (glucose, sucrose, etc.) as substrates for L-valine synthesis, reducing production costs; the continuous iteration and optimization of metabolic chassis strains will reduce the accumulation of by-products and simplify the separation and purification process; green biosynthesis can prevent pollution from the source, which is in line with the national strategy of sustainable development.

[0005] Microbial fermentation has sustainable and green social and economic benefits. Among them, Escherichia coli has become an attractive host for building a stable and efficient production platform for L-valine in recent years because of its clear genetic background, low culture cost, superiority in large-scale fermentation of L-valine, and the fact that the L-valine it produces does not contain allergens, making it suitable for L-valine production in the pharmaceutical, nutritional supplement and animal feed industries. The way to build an efficient production strain is mainly to start from optimizing the metabolic pathway. Including: using enzyme mutants to relieve the feedback inhibition of L-valine on acetolactate synthase (AHAS), introducing efficient acetolactate synthase from Bacillus subtilis; strengthening the synthesis pathway of L-valine, using enzyme engineering technology to improve the enzyme activity of the pathway, changing the cofactor preference to increase the reaction rate; strengthening the branched-chain amino acid transporter system, deleting the translocation protein of L-valine; strengthening the PPP pathway, introducing the ED pathway to enhance the supply of NADPH, and optimizing the cofactor cycle; deleting the key enzyme genes of the competitive bypass, enhancing the accumulation of the pyruvate pool; optimizing the glucose transport system, improving the glucose uptake capacity, etc. The metabolic pathway for L-valine synthesis in Escherichia coli cannot be synthesized in large quantities due to feedback inhibition of L-valine, insufficient supply of precursor substances, low transporter capacity and low efficiency of cofactor circulation. Even if there is progress, the fermentation yield and production intensity of the constructed strain are very limited. The improvement of yield is usually achieved by knocking out the key enzyme genes of the competitive pathway, which may cause the strain to lack a certain trace substance required for growth, thus causing irreversible effects on growth. There are many ways to solve this potential problem, such as supplementing the static regulation strategy with a dynamic regulation system to connect the inhibition of the gene with the growth status of the bacteria or external human intervention factors; or manually adding and deleting pathway compounds to compensate for the adverse effects caused by the deletion of key enzyme genes, etc. The above technologies all have their disadvantages: the cumbersome transformation method will bring difficulties to the construction of the strain; the manual addition of compounds will bring unnecessary increases in production costs. Summary of the invention

[0006] To solve the above problems, the present invention transforms the disordered sequence in the formation process of membraneless organelles to obtain more stable membraneless organelles, and on this basis develops a method for achieving efficient synthesis of L-valine in Escherichia coli based on spatial regulation of membraneless organelles, providing a new way for the synthesis of L-valine.

[0007] The first object of the present invention is to provide a recombinant protein for constructing a membraneless organelle, wherein the recombinant protein comprises a connected disordered protein RGG and a disordered protein FUS. N ,

[0008] The amino acid sequence of the disordered protein RGG is shown in SEQ ID NO.1, and the disordered protein FUS NThe amino acid sequence is shown in SEQ ID NO.3.

[0009] It is known to those skilled in the art that when constructing membraneless organelles, the fewer disordered proteins there are, the less likely they are to form, and it has been verified that a single RGG or FUS N It is impossible to form membraneless organelles, so currently multiple RGG or multiple FUS are usually used. N To form membraneless organelles. The present invention only uses RGG and FUS N The fusion protein formed by one copy of each endogenous disordered protein can successfully construct a membraneless organelle, which has the advantages of short sequence length and simple preparation.

[0010] Furthermore, the disordered protein RGG is located at the disordered protein FUS N Before.

[0011] Furthermore, the disordered protein RGG and disordered protein FUS N The connection is made through a connection sequence, and the connection sequence conforms to the following general formula: (GGGGS)n, wherein n is an integer between 0-5, such as 0, 1, 2, 3, 4, 5.

[0012] Preferably, the recombinant protein comprises an amino acid sequence as shown in SEQ ID NO.6.

[0013] Furthermore, the nucleotide sequence encoding the disordered protein RGG is shown in SEQ ID NO.2, and the nucleotide sequence encoding the disordered protein FUS is shown in SEQ ID NO. N The nucleotide sequence is shown in SEQ ID NO.4.

[0014] The second object of the present invention is to provide a system for spatially regulating the expression of a target gene, which can anchor the target gene in a membraneless organelle for expression, and the system comprises a recombinant protein fused with a first interactive short peptide and a target gene fused with a second interactive short peptide.

[0015] The recombinant protein includes a connected disordered protein RGG and a disordered protein FUS N The amino acid sequence of the disordered protein RGG is shown in SEQ ID NO.1, and the disordered protein FUS N The amino acid sequence is shown in SEQ ID NO.3,

[0016] The first interacting short peptide and the second interacting short peptide can specifically bind to each other.

[0017] Furthermore, the combination of the first interacting short peptide and the second interacting short peptide includes short peptide RIAD and short peptide RIDD, or short peptide CC-Di-A and short peptide CC-Di-B.

[0018] Further, when the first interacting short peptide includes short peptide CC-Di-A, the second interacting short peptide includes short peptide CC-Di-B; when the first interacting short peptide includes short peptide CC-Di-B, the second interacting short peptide includes short peptide CC-Di-A.

[0019] Further, when the first interacting short peptide includes the short peptide RIAD, the second interacting short peptide includes the short peptide RIDD; when the first interacting short peptide includes the short peptide RIDD, the second interacting short peptide includes the short peptide RIAD.

[0020] Furthermore, the interacting short peptides including the short peptide RIAD are composed of one or more short peptides RIAD connected in series, and the interacting short peptides including the short peptide RIDD are composed of one or more short peptides RIDD connected in series (the RIAD or RIDD connected in series are directly connected).

[0021] Preferably, the first short peptide interaction is a polypeptide comprising a short peptide RIDD, and the second short peptide interaction is a polypeptide comprising a short peptide RIAD. RIDD is conducive to dimerization of the RGG domain and may improve phase separation efficiency; RIAD is a short peptide of only 19 amino acids, and fusion to the end of the target protein may reduce the impact on the structure and function of the target enzyme.

[0022] Preferably, the interacting short peptides including the short peptide RIAD include the short peptide RIAD and at least one short peptide RIAD* located after the short peptide RIAD (RIAD and RIAD* are directly connected), the nucleotide sequence of the short peptide RIAD is shown in SEQ ID NO.10, and the nucleotide sequence of the short peptide RIAD* is shown in SEQ ID NO.11.

[0023] Preferably, the nucleotide sequence of the short peptide RIDD is shown in SEQ ID NO.9.

[0024] The third object of the present invention is to provide a nucleic acid molecule encoding the recombinant protein or system.

[0025] The fourth object of the present invention is to provide a recombinant plasmid carrying the nucleic acid molecule.

[0026] The fifth object of the present invention is to provide a recombinant cell containing the recombinant protein or system.

[0027] Furthermore, the recombinant cell includes a microorganism, such as a fungus or a bacterium.

[0028] The sixth object of the present invention is to provide a method for forming membraneless organelles in microorganisms, comprising the following steps: introducing the gene sequence encoding the recombinant protein into the host cell.

[0029] Furthermore, the microorganisms described in the present invention can be any host cells that need to form membraneless organelles or synthesize proteins in living cells, including but not limited to Enterobacteriaceae (such as Escherichia coli), Bacillus (such as Bacillus subtilis), yeast (such as Saccharomyces cerevisiae, Pichia pastoris), etc.

[0030] The seventh object of the present invention is to provide a method for producing biological substances in living cells (or a method for improving the production intensity of living cells), comprising the following steps: introducing the system into living cells, wherein the target gene is a gene necessary for producing biological substances.

[0031] Furthermore, the living cells are microbial cells or in vitro animal and plant cells (even if they are stem cells, they are commercial stem cells obtained with ethical review and approval).

[0032] Furthermore, the biological substances include but are not limited to proteins, amino acids and other substances that can be synthesized by microorganisms.

[0033] The eighth objective of the present invention is to provide the use of the recombinant protein, system, nucleic acid molecule, recombinant plasmid, and recombinant cell in biosynthesis.

[0034] The ninth object of the present invention is to provide a recombinant Escherichia coli, wherein the recombinant Escherichia coli is introduced into the system based on the starting bacteria, and the target gene is a gene that needs to be enhanced (upregulated) when synthesizing L-valine.

[0035] Furthermore, the coding sequence of the recombinant protein fused with the first interactive short peptide and the coding sequence of the target gene fused with the second interactive short peptide are integrated into the genome of the starting bacteria.

[0036] Furthermore, the target gene includes a dicarboxylate dehydratase gene (ilvD) and / or a branched-chain amino acid transaminase gene (ilvE).

[0037] Furthermore, the integration site of the coding sequence of the recombinant protein fused with the first interactive short peptide includes the djlA site; the integration site of the coding sequence of the target gene fused with the second interactive short peptide includes the tyrV site.

[0038] Furthermore, the starting bacteria is a modified or unmodified Escherichia coli, and the starting bacteria comprises one or more of the following modifications relative to the host bacteria:

[0039] (1) Enhanced expression of acetolactate synthase subunit I gene ilvBN,

[0040] (2) Enhanced expression of acetolactate synthase subunit II gene ilvGM,

[0041] (3) Enhanced expression of acetolactate synthase subunit III gene ilvIH,

[0042] (4) Enhanced expression of the dicarboxylic acid reductoisomerase gene ilvC,

[0043] (5) Enhanced expression of the dicarboxylate dehydratase gene ilvD,

[0044] (6) Enhanced expression of branched-chain amino acid transaminase gene ilvE,

[0045] (7) Knockout of the valine-pyruvate aminotransferase gene avtA,

[0046] (8) Knockout of the branched-chain amino acid transporter gene brnQ,

[0047] (9) Knockout of the regulatory RNA gene gcvB,

[0048] (10) Enhanced expression of branched-chain amino acid transporter gene brnFE,

[0049] (11) Knockout the lactate dehydrogenase gene ldhA.

[0050] Furthermore, the NCBI-GeneID of the acetolactate synthase subunit I gene ilvBN is 948182 (ilvB), 948183 (ilvN); the NCBI-GeneID of the acetolactate synthase subunit II gene ilvGM is 2847699 (ilvG), 948279 (ilvM); the NCBI-GeneID of the acetolactate synthase subunit III gene ilvIH is 948793 (ilvI), 947267 (ilvH); the NCBI-GeneID of the dicarboxylate reductoisomerase gene ilvC is The NCBI-GeneID is 948286; the NCBI-GeneID of the dicarboxylate dehydratase gene ilvD is 948277; the NCBI-GeneID of the branched-chain amino acid transaminase gene ilvE is 948278; the NCBI-GeneID of the valine-pyruvate aminotransferase gene avtA is 948087; the NCBI-GeneID of the branched-chain amino acid transporter gene brnQ is 945042; the NCBI-GeneID of the regulatory RNA gene gcvB is 2847720. The NCBI-GeneID of the branched-chain amino acid transporter gene brnFE is 3344066, and the NCBI-GeneID of the lactate dehydrogenase gene ldhA is 946315.

[0051] Furthermore, through P tac The promoter enhances the expression of genes ilvBN, ilvGM, ilvIH, ilvC, ilvD, ilvE and brnFE on the genome.

[0052] Furthermore, the host bacteria includes Escherichia coli K-12MG1655.

[0053] The tenth object of the present invention is to provide the use of the recombinant Escherichia coli in the synthesis of L-valine.

[0054] The compartmentalization strategy of targeting and anchoring key enzymes to membraneless organelles in the present invention can achieve the recruitment and localization of key enzymes (carboxylic acid dehydratase gene ilvD and branched-chain amino acid transaminase gene ilvE) in the metabolic pathway to the membraneless organelle RGG-FUS N In the process of assembling the condensate in a specific spatial position, spatial regulation is achieved, reaction efficiency is significantly improved, and directional transfer of substrates is achieved. Thus, by increasing the local concentration of multiple enzymes, effective channels for intermediates are constructed, crosstalk between different pathways is reduced, and catalytic efficiency is improved. Biomolecular condensates can form a liquid-liquid phase separation phenomenon, which has a unique advantage in constructing artificial membraneless organelles. There is currently no report on the use of artificial membraneless organelles to achieve spatial regulation to promote the production of L-valine. The present invention aims to explore the use of suitable and controllable conditions to achieve and enhance the metabolic regulation of L-valine using artificial membraneless organelles to increase the yield, yield and production intensity of L-valine.

[0055] Furthermore, the application includes the following steps: maintaining the dissolved oxygen content at 20-40% during the fermentation process, and waiting for OD 600 After reaching the maximum value, DO is controlled at 10-20%, during which the residual sugar content is maintained at no more than 0.5 g / L.

[0056] Beneficial effects of the present invention:

[0057] (1) The present invention further expresses the disordered protein FUS in series on the basis of the disordered protein RGG N After that, the RGG-FUS N The phase separation ability of RGG is effectively enhanced, and a more stable liquid-liquid phase separation artificial membraneless organelle can be formed in prokaryotes.

[0058] (2) The present invention uses the interactive short peptide RIDD-RIAD to recruit and anchor the detection gene mCherry to the membraneless organelle RGG-FUS N In the experiment, the co-localization of sfGFP and mCherry was observed by fluorescence, indicating that the effective recruitment of macromolecular proteins can be achieved. Further increasing the number of RIADs, and confirming the enhanced recruitment effect by fluorescence observation, showed that the membraneless organelle can be used to achieve efficient compartmentalized dynamic regulation of metabolic synthesis pathways.

[0059] (3) The present invention uses the enhanced RIDD-RIAD interaction peptide to recruit and localize the key enzymes ilvD and ilvE in the L-valine synthesis pathway to the membraneless organelle RGG-FUS NIn the experiment, by inducing with IPTG at a final concentration of 0.5 mM at 12 h, the production intensity of L-valine increased by 38.5% compared with the control strain, reaching 3.67 g / L / h, the yield increased to 0.479 g / g glucose, and the yield reached 103 g / L. The above results show that using membraneless organelles to spatially regulate the metabolic synthesis of L-valine in Escherichia coli is an effective strategy to improve the production intensity of L-valine. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 The fluorescence images of HP1 induced by different inducer concentrations are shown in Figure 2 .

[0061] Figure 2 The figure shows the recruitment of mCherry protein to membraneless organelles when different numbers of RIADs are used.

[0062] Figure 3 The performance of the chassis strain Val 11 and the recombinant strain HP 4 in a 3 L fermenter. DETAILED DESCRIPTION

[0063] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0064] The scheme involved in the present invention is as follows:

[0065] The present invention uses intrinsic disordered proteins (IDPs) to construct artificial membraneless organelles (MLOs) with liquid-liquid phase separation in the prokaryotic host, Escherichia coli, and verifies its liquid properties. An enzyme loading platform is created to achieve spatial regulation. The coding gene of the IDPs expression frame is expressed by gene integration through CRISPR / Cas9 editing technology.

[0066] The present invention cultured host bacteria containing the sfGFP-IDPs expression frame in a seed culture medium, detected the effects of different concentrations of IPTG on the formation of MLOs, determined the optimal IPTG concentration, and used the phenomenon that low concentrations of urea can destroy multivalent interactions to prove that the artificially constructed membraneless organelles have the characteristics of liquid-liquid phase separation rather than inclusion bodies.

[0067] The present invention provides a method for efficiently anchoring macromolecular proteins to previously constructed MLOs, and by changing the number of interacting short peptides, the strength of macromolecular protein recruitment and co-localization is enhanced, and the proportion of recruited proteins is increased. Specifically, the interacting short peptide RIDD is connected to IDPs to construct a RIDD-IDPs expression frame. The interacting short peptide RIAD is connected to the target gene, and the strong promoter P is used to express the target gene. tacThe RIAD-gene expression cassette is constructed by adding the codon-optimized RIAD* to the middle of the RIDD-gene expression cassette. The coding genes of the RIDD-IDPs expression cassette, the RIAD-gene expression cassette and the RIAD-RIAD*-gene expression cassette are integrated and expressed by CRISPR / Cas9 editing technology.

[0068] The present invention also co-localizes and recruits key enzyme genes in the L-valine metabolic synthesis pathway to MLOs, that is, anchors protein coding genes and related genes that promote the synthesis of target products on artificially constructed aggregates to increase the local concentration of related enzymes and achieve regulation of metabolic pathways. Specifically, the DNA sequence of the dicarboxylic acid dehydratase gene ilvD and the DNA sequence of the branched-chain amino acid transaminase gene ilvE are connected to RIAD and RIAD*, and the strong promoter P is used to tac and lactose operon lacO to construct a RIAD-RIAD*-ilvD-ilvE expression cassette. The RIAD-RIAD*-ilvD-ilvE expression coding gene is integrated and expressed by CRISPR / Cas9 editing technology.

[0069] During shake flask fermentation production: the recombinant Escherichia coli containing the RIDD-IDPs and RIAD-RIAD*-ilvD-ilvE expression frames are verified by shake flask fermentation. First, the recombinant Escherichia coli is activated in LB medium at 35°C-37°C to obtain a seed solution, and the seed solution is inoculated into a shake flask fermentation medium at an inoculation rate of 1-20%, and fermented and cultured at 37°C. During the shake flask fermentation culture process, the fermentation medium composition includes (g / L): glucose 20-60, CaCO3 10-50, sodium citrate dihydrate 0.1-10, yeast powder 0.1-10, (NH4)2SO4 10-30, K2HPO4·3H2O 0.01-5, trace elements: 0.001-0.5g / LFeSO4·7H2O, 0.001-0.5g / LMnSO4·H2O.

[0070] When the fermentation production is scaled up: the recombinant Escherichia coli containing the RIDD-IDPs and RIAD-RIAD*-ilvD-ilvE expression frames are fermented in a 3L fermenter for verification. First, the strain is streaked onto an agar medium and cultured in a constant temperature incubator at 35°C-37°C for 10-20 hours. Then, a single clone of the strain is selected and transferred to LB liquid culture medium, and the seed solution of the recombinant Escherichia coli is prepared at 35°C-37°C. The inoculation amount is 1-20%, and the fermentation culture is carried out at 35°C-37°C. During the growth stage, the DO (dissolved oxygen content) is maintained at 20-40%, and when the OD is reached,600 After the optical density reaches the maximum value, the DO is controlled at 10-20%, and the residual sugar content is maintained at no more than 0.5 g / L. During the fermentation culture in the fermenter, the fermentation medium used in the fermenter includes (g / L): glucose 10-50, yeast powder 1-20, potassium dihydrogen phosphate 1-20, ammonium sulfate 1-20, magnesium sulfate 1-15, citric acid 1-15, trace elements: 0.001-0.5 g / LFeSO4·7H2O, 0.001-0.5 g / LMnSO4·H2O.

[0071] 1. The sequence involved in the present invention is as follows:

[0072] RGG: amino acid sequence SEQ ID NO.1, nucleotide sequence SEQ ID NO.2,

[0073] FUS N : Amino acid sequence SEQ ID NO.3, nucleotide sequence SEQ ID NO.4,

[0074] Connect RGG and FUS N Linker: nucleotide sequence SEQ ID NO.5,

[0075] IDPs(RGG-FUS N ): amino acid sequence SEQ ID NO.6,

[0076] Strong promoter P tac : Nucleotide sequence SEQ ID NO.7,

[0077] Lactose operon lacO: nucleotide sequence SEQ ID NO.8,

[0078] RIDD: nucleotide sequence SEQ ID NO.9,

[0079] RIAD: nucleotide sequence SEQ ID NO.10,

[0080] RIAD*: nucleotide sequence SEQ ID NO.11,

[0081] Dicarboxylate dehydratase gene ilvD: nucleotide sequence SEQ ID NO.12,

[0082] Branched-chain amino acid transaminase gene ilvE: nucleotide sequence SEQ ID NO.13,

[0083] 2. Starting strains involved in the present invention

[0084] The starting strain used in the present invention, recombinant Escherichia coli Val 11, is described in Chinese patent publication number CN118931932A.

[0085] 3. Sample processing method involved in the present invention:

[0086] Recombinant E. coli can be cultured normally in LB medium. Unless otherwise specified, IPTG with a final concentration of 0.5 mM is added at 12 h of fermentation to induce the expression of the relevant expression frame. When the fluorescence image needs to be observed, 0.1 mL of the fermentation broth is taken and centrifuged at 5000 rpm for 5 min at room temperature to prepare a glass slide for observation. When the L-valine content needs to be detected, 1 mL of the fermentation broth is taken and centrifuged at 12000 rpm for 10 min at room temperature. After filtering the supernatant through a 0.22 μm water filter membrane, it is appropriately diluted and the L-valine content in the sample is detected by HPLC.

[0087] 4. The detection method involved in the present invention:

[0088] Fluorescence observation of recombinant E. coli was performed using a Nikon C-HGF microscope equipped with a 100x oil immersion objective. FITC fluorescence filters were used to observe sfGFP, and TRITC fluorescence filters were used to observe mCherry.

[0089] L-valine was detected by high performance liquid chromatography (HPLC) system (Agilent Technologies 1260 series), and the concentration of L-valine in the fermentation broth was determined by Infinity Lab Poroshell 120EC-C18 column (Agilent). The HPLC detector was an ultraviolet absorption detector (UV), and the detection temperature of the chromatographic column was set at 40°C.

[0090] The sample needs to be pre-column derivatized with OPA boric acid before detection. The preparation method of pre-column derivatization reagent is as follows:

[0091] Boric acid solution: prepare 0.4 M boric acid solution and adjust the pH to 10.2 with NaOH.

[0092] OPA solution: Take 9 ml of the above 0.4 M boric acid solution and add 100 mg of o-phthalaldehyde, 1 mL of acetonitrile, and 100 μL of mercaptopropionic acid.

[0093] During pre-column derivatization, 7 μL of boric acid was extracted and mixed with 1 μL of sample, and then 2 μL of OPA solution was added, followed by 30 μL of water, and 20 μL was injected.

[0094] Mobile phase A: Dissolve 3.01 g of anhydrous sodium acetate in deionized water and dilute to 1 L, then add 200 μL of triethylamine and adjust the pH to 7.20±0.05 with 5% acetic acid; add 5 mL of tetrahydrofuran after filtration, mix and set aside.

[0095] Mobile phase B: Dissolve 3.01g of anhydrous sodium acetate in deionized water and dilute to 200mL; adjust the pH to 7.20±0.05 with 5% acetic acid; add 400mL of acetonitrile and 400mL of methanol to the solution after filtration, mix and set aside. Gradient elution. The detection flow rate is 0.8mL / min.

[0096] Example 1 Verification of RGG-FUS N Artificial membraneless organelles that can form liquid-liquid phase separation in the prokaryotic organism Escherichia coli

[0097] The gene was integrated with the sfGFP-IDPs expression cassette (using the strong promoter P tac The sfGFP-IDPs expression cassette was constructed by connecting sfGFP to IDPs and the lactose operon lacO and was integrated into the djlA site of the recombinant Escherichia coli Val 11 genome as an example:

[0098] The upstream and downstream gene sequences of the integrated djlA gene were determined, and the sfGFP-IDPs expression frame was fused with the upstream and downstream gene sequences of djlA by fusion PCR to construct the fragment djlA-sfGFP-IDPs. Using the pTarget plasmid as a template (SEQ ID NO. 14), the primers pTarget-djlA-F / pTarget-djlA-R were used to amplify a 2096 bp pTarget plasmid fragment for the construction of pTarget-djlA.

[0099] pTarget-djlA-F:

[0100] TCTCAAAGAAGTGACCGCCAGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGC

[0101] pTarget-djlA-R:

[0102] TGGCGGTCACTTCTTTGAGAACTAGTATTATACCTAGGACTGAGCTA GCTG

[0103] The fusion system is: PrimeSTAR Max DNA Polmerase 10μL, and the other three fragments are mixed in equal amounts to reach 10μL, with a total volume of 20μL.

[0104] The fusion conditions were as follows: pre-denaturation at 98°C for 5 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 1 minute (20 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0105] The amplification system was: PrimeSTARMax DNA Polmerase 25 μL, DNA template 200 ng, primers (10 μM) 1 μL each, distilled water 23 μL, and a total volume of 50 μL.

[0106] Amplification conditions were as follows: pre-denaturation at 98°C for 5 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 1 minute (34 cycles); extension at 72°C for 5 minutes (1 cycle).

[0107] pEcCas9 was chemically transformed into recombinant E. coli. Then the pTarget-djlA and djlA-sfGFP-IDPs DNA fragments were electroporated into recombinant E. coli containing pEcCas9.

[0108] The transformation conditions are as follows: the recombinant E. coli competent cells are prepared using the Competent Cell Preparation Kit, and the pEcCas9 plasmid is transformed into the recombinant E. coli by chemical transformation. Then, the recombinant E. coli competent cells containing pEcCas9 are prepared by electroporation. The pTarget-djlA plasmid and the djlA-sfGFP-IDPs DNA fragment are transformed into the recombinant E. coli competent cells containing the pEcCas9 plasmid by electroporation.

[0109] The electroporation conditions were as follows: first, prepare the recombinant E. coli electroporation competent medium with pEcCas9 plasmid; place 50 μL competent medium on ice, add 500 ng pTarget-djlA plasmid and 1400 ng djlA-sfGFP-IDPs DNA fragment, place on ice for 30 minutes, and transfer to a 0.1 cm Bio-Rad electroporation cup. Use MicroPulse (Bio-Rad) electroporator with an electrode parameter of 1.8 kV. After electroporation, quickly transfer 1 mL of LB medium to the electroporation cup, pipette 5 times, and then transfer to an EP tube, incubate at 220 rpm and 37 ° C for 2 hours.

[0110] Take 200 μL of bacterial solution and apply it on LB plate containing spectinomycin (final concentration of 1 mM) and kanamycin (final concentration of 1 mM), culture at 37°C overnight, select single colonies for PCR verification, use primers test-djlA-F / test-djlA-R, the correct colony amplification product is a 3049 bp fragment, select a correct single colony, inoculate the correct single colony into liquid LB medium containing 2.5% (V / V) 1M L-rhamnose, and culture at 37°C, 220rpm for 10-12h to eliminate plasmid pTarget-djlA. For the strains to be eliminated from the pTarget plasmid, pick single clones and spot plate them on solid LB medium containing spectinomycin (final concentration of 1 mM) and kanamycin (final concentration of 1 mM) to verify that pTarget is successfully eliminated. And use primers test-tdjlA-F / test-djlA-R to pick single colonies for PCR verification. The correct single colony was inoculated onto a solid LB medium containing 5g / L glucose and 10g / L sucrose, and cultured at 37°C for 10-12h to eliminate the plasmid pEcCas9. The strains to be eliminated from the pEcCas9 plasmid were picked and plated onto solid LB medium containing kanamycin and no additional antibiotics to verify the successful elimination of pEcCas9. The recombinant E. coli that completed gene editing was obtained and named HP1.

[0111] test-djlA-F:GCCAGTTGATGGACCGAATG

[0112] test-djlA-R:AACGCCCCAAGTTACCTTGGC

[0113] HP1 was inoculated into LB medium, and after culturing for 12 h, IPTG was added at a final concentration of 0.25 mM, 0.5 mM, and 1 mM for induction for 60 min, 90 min, and 120 min, respectively. The results are as follows Figure 1 As shown. It was observed that the condensation process of membraneless organelles could be observed at an inducer concentration of 0.5 mM. Different inducer concentrations had different effects on the transcriptional activation strength of genes, while the aggregation speed of liquid condensates was relatively fixed. Therefore, it was speculated that when the inducer concentration was appropriate, the formation process of membraneless organelles could be detected. The emergence of this process was beneficial, which could significantly increase the release specific surface area of ​​enzymes and substrates in membraneless organelles.

[0114] After adding 0.5 M urea, the membraneless organelles were observed to disintegrate, indicating that RGG-FUS N Artificial membraneless organelles with liquid-liquid phase separation can be formed in the prokaryotic organism Escherichia coli.

[0115] Example 2 RGG-FUS NTesting and enhancing protein recruitment capabilities

[0116] The upstream and downstream gene sequences of the integrated djlA gene were determined, and the RIDD-sfGFP-IDPs expression frame was fused with the upstream and downstream gene sequences of djlA by fusion PCR to construct the fragment djlA-RIDD-sfGFP-IDPs. Using the pTarget plasmid as a template, the primers pTarget-djlA-F / pTarget-djlA-R were used to amplify the 2096bp pTarget plasmid fragment for the construction of pTarget-djlA.

[0117] pEcCas9 was chemically transformed into recombinant E. coli Val 11. The pTarget-djlA and djlA-RIDD-sfGFP-IDPs DNA fragments were then electroporated into recombinant E. coli containing pEcCas9 to obtain recombinant E. coli with completed gene editing, named HP1.5.

[0118] Determine the upstream and downstream gene sequences of the integrated tyrV gene, and fuse the RIAD-mCherry expression frame with the upstream and downstream gene sequences of tyrV by fusion PCR to construct the fragment tyrV-RIAD-mCherry. Using the pTarget plasmid as a template, use primers pTarget-tyrV-F / pTarget-tyrV-R to amplify a 2096bp pTarget plasmid fragment for the construction of pTarget-tyrV.

[0119] pTarget-tyrV-F:

[0120] CCGAAGTTACCACATCGCTGGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGC

[0121] pTarget-tyrV-R:

[0122] CAGCGATGTGGTAACTTCGGACTAGTATTATACCTAGGACTGAGCTA GCTG

[0123] pEcCas9 was chemically transformed into HP1.5. Then the pTarget-tyrV and tyrV-RIAD-mCherry DNA fragments were electroporated into HP1.5 containing pEcCas9.

[0124] The pTarget-dljA, pTarget-tyrV and pEcCas9 plasmids were eliminated using the same method as before to obtain recombinant Escherichia coli with completed gene editing, named HP2.

[0125] Determine the upstream and downstream gene sequences of the integrated tyrV gene, and fuse the RIAD-RIAD*-mCherry expression frame with the upstream and downstream gene sequences of tyrV by fusion PCR to construct the fragment tyrV-RIAD-RIAD*-mCherry. Using the pTarget plasmid as a template, use primers pTarget-tyrV-F / pTarget-tyrV-R to amplify a 2096bp pTarget plasmid fragment for the construction of pTarget-tyrV.

[0126] pEcCas9 was chemically transformed into HP1.5. Then the pTarget-tyrV and tyrV-RIAD-RIAD*-mCherry DNA fragments were electroporated into HP1.5 containing pEcCas9.

[0127] The pTarget-dljA, pTarget-tyrV and pEcCas9 plasmids were eliminated using the same method as before to obtain recombinant Escherichia coli with completed gene editing, named HP3.

[0128] HP2 was inoculated into LB medium, and IPTG with a final concentration of 0.5 mM was added after culturing for 12 h to induce. In the merged fluorescence image, it can be observed that 71% of the macromolecular protein mCherry was recruited and co-localized on the membraneless organelles. The results are shown in Figure 2 As shown. N Has the ability to recruit proteins.

[0129] HP3 was inoculated into LB medium, and IPTG with a final concentration of 0.5 mM was added after culturing for 12 h to induce. In the merged fluorescence image, it can be observed that 89% of the macromolecular protein mCherry was recruited and co-localized on the membraneless organelles. The results are shown in Figure 2 It is shown that increasing the number of interacting proteins RIAD can enhance the activity of RGG-FUS N Ability to recruit proteins.

[0130] Example 3 Shake flask fermentation proves RGG-FUS N Promote the metabolic synthesis of L-valine

[0131] The upstream and downstream gene sequences of the integrated djlA gene were determined, and the RIDD-IDPs expression frame was fused with the upstream and downstream gene sequences of djlA by fusion PCR to construct the fragment djlA-RIDD-IDPs. Using the pTarget plasmid as a template, the primers pTarget-djlA-F / pTarget-djlA-R were used to amplify the 2096bp pTarget plasmid fragment for the construction of pTarget-djlA.

[0132] pEcCas9 was chemically transformed into recombinant E. coli. The pTarget-djlA and djlA-RIDD-IDPs DNA fragments were then electroporated into recombinant E. coli containing pEcCas9 to obtain recombinant E. coli with completed gene editing, named HP3.5.

[0133] Determine the upstream and downstream gene sequences of the integrated tyrV gene, and fuse the RIAD-RIAD*-ilvD-ilvE expression frame with the upstream and downstream gene sequences of tyrV by fusion PCR to construct the fragment tyrV-RIAD-RIAD*-ilvD-ilvE. Using the pTarget plasmid as a template, use primers pTarget-tyrV-F / pTarget-tyrV-R to amplify a 2096bp pTarget plasmid fragment for the construction of pTarget-tyrV.

[0134] pEcCas9 was chemically transformed into HP3.5. Then the pTarget-tyrV and tyrV-RIAD-RIAD*-ilvD-ilvE DNA fragments were electroporated into HP3.5 containing pEcCas9.

[0135] The pTarget-dljA, pTarget-tyrV and pEcCas9 plasmids were eliminated using the same method as before to obtain recombinant Escherichia coli with completed gene editing, which was named HP4.

[0136] The target engineered strain HP4 was activated in LB medium and inoculated into liquid seed medium. Seed medium (g / L): peptone 10, yeast powder 5, NaCl 10; culture conditions: 37°C, 220rpm for 10h. Then the seed liquid was inoculated into the fermentation medium at a 4% inoculation rate. Shake flask fermentation medium (g / L): glucose 40, yeast powder 2, sodium citrate dihydrate 2, K2HPO4·3H2O0.6, (NH4)2SO416, CaCO330, trace elements: 0.005g / L MnSO4·H2O, 0.005g / LFeSO4·7H2O. Culture conditions: 37°C, 220rpm, 48h, and IPTG with a final concentration of 0.5mM was added at 12h to induce the expression of related genes.

[0137] During the fermentation process, samples were taken from time to time. At the end of the fermentation, the L-valine concentration of the fermentation supernatant was determined by high performance liquid chromatography (HPLC). First, the fermentation broth was centrifuged at 14000rpm and 20℃ for 10min, and then the supernatant was collected and the concentration of extracellular L-valine was detected by HPLC. Finally, the maximum value of extracellular L-valine of recombinant Escherichia coli HP4 was determined to be 21.6g / L, which was equivalent to the production of chassis strain Val 11, but the maximum value appeared 6h earlier than that of chassis strain Val 11.

[0138] Example 43 L fermentation tank fermentation proves that RGG-FUSN promotes the metabolic synthesis of L-valine

[0139] The target engineered strain HP4 was activated in LB medium and inoculated into liquid seed medium. Seed medium (g / L): peptone 10, yeast powder 5, NaCl 10; culture conditions: 37°C, 220rpm for 11h. Then the seed liquid was inoculated into the fermentation medium of the fermenter at an inoculation rate of 20%. Fermentation medium of the fermenter (g / L): glucose 20, yeast powder 5, potassium dihydrogen phosphate 7, ammonium sulfate 6, magnesium sulfate 2, citric acid 2, trace elements: 0.005g / LFeSO4·7H2O, 0.005g / LMnSO4·H2O. Culture conditions: Fermentation culture at 37°C, keep DO (dissolved oxygen content) at 30% during the growth phase, and wait until OD is reached. 600 After the optical density (OD) reached the maximum value, DO was controlled at 15%, and the residual sugar content was maintained at no more than 0.5 g / L. At 12 h, IPTG was added at a final concentration of 0.5 mM to induce the expression of related genes.

[0140] Finally, at 28h of fermentation, that is, 16h of induction, the L-valine production of HP4 reached 103g / L, the yield increased to 0.479g / g glucose, and the production intensity reached 3.67g / L / h, which was 38.5% higher than that of the chassis strain Val 11. Moreover, the fermentation in the fermenter also showed the same trend as that in the shake flask, and the peak production time of HP4 was significantly earlier than that of the chassis strain Val11 ( Figure 3 ).

[0141] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A recombinant protein for constructing membraneless organelles, characterized in that: The recombinant protein includes a connected disordered protein RGG and a disordered protein FUS N , The amino acid sequence of the disordered protein RGG is shown in SEQ ID NO.1, and the disordered protein FUS N The amino acid sequence is shown in SEQ ID NO.

3.

2. The recombinant protein according to claim 1, characterized in that Contains at least one of the following characteristics: (1) The disordered protein RGG is located in the disordered protein FUS N Before; (2) The disordered protein RGG and the disordered protein FUS N Connected by a connecting sequence, the connecting sequence conforms to the following general formula: (GGGGS)n, n is an integer between 0 and 5; (3) The recombinant protein comprises an amino acid sequence as shown in SEQ ID NO.6; (4) The nucleotide sequence encoding the disordered protein RGG is shown in SEQ ID NO.2, and the nucleotide sequence encoding the disordered protein FUS is shown in SEQ ID NO. N The nucleotide sequence is shown in SEQ ID NO.

4.

3. A system for spatially regulating the expression of a target gene, characterized in that: The system includes a recombinant protein fused with a first short interactive peptide and a target gene fused with a second short interactive peptide. The recombinant protein includes a connected disordered protein RGG and a disordered protein FUS N The amino acid sequence of the disordered protein RGG is shown in SEQ ID NO.1, and the disordered protein FUS N The amino acid sequence is shown in SEQ ID NO.3, The first interacting short peptide and the second interacting short peptide can specifically bind to each other.

4. The system according to claim 3, characterized in that Contains at least one of the following characteristics: (1) The combination of the first interacting short peptide and the second interacting short peptide includes a modified or unmodified short peptide RIAD and a short peptide RIDD, or a modified or unmodified short peptide CC-Di-A and a short peptide CC-Di-B; (2) When the first interacting short peptide includes the short peptide RIAD, the second interacting short peptide includes the short peptide RIDD; when the first interacting short peptide includes the short peptide RIDD, the second interacting short peptide includes the short peptide RIAD; (3) The interacting short peptides including the short peptide RIAD are composed of one or more tandem short peptides RIAD, and the interacting short peptides including the short peptide RIDD are composed of one or more tandem short peptides RIDD; (4) The first interacting short peptide or the second interacting short peptide includes a short peptide RIAD and at least one short peptide RIAD* located after the short peptide RIAD, the nucleotide sequence of the short peptide RIAD is shown in SEQ ID NO.10, and the nucleotide sequence of the short peptide RIAD* is shown in SEQ ID NO.

11.

5. A nucleic acid molecule encoding the recombinant protein of claim 1 or 2 or the system of claim 3 or 4.

6. A recombinant plasmid carrying the nucleic acid molecule according to claim 5.

7. A recombinant cell containing the nucleic acid molecule of claim 5.

8. A method for forming membraneless organelles in microorganisms, characterized in that: The following steps are involved: The gene sequence encoding the recombinant protein according to claim 1 or 2 is introduced into a host cell.

9. A method for producing biological substances in living cells, characterized in that The following steps are involved: The system according to claim 3 or 4 is introduced into a living cell, wherein the target gene is at least one gene necessary for producing a biomaterial.

10. Use of the recombinant protein according to claim 1 or 2, the system according to claim 3 or 4, the nucleic acid molecule according to claim 5, the recombinant plasmid according to claim 6 or the recombinant cell according to claim 7 in biosynthesis.

11. A recombinant Escherichia coli, characterized in that The recombinant Escherichia coli is introduced into the system of claim 3 or 4 based on the starting bacteria, and the target gene is at least one gene whose expression needs to be upregulated when synthesizing L-valine.

12. The recombinant Escherichia coli according to claim 11, characterized in that Contains at least one of the following characteristics: (1) integrating the coding sequence of the recombinant protein fused with the first interactive short peptide and the coding sequence of the target gene fused with the second interactive short peptide into the genome of the starting bacteria, (2) The target gene includes a dicarboxylic acid dehydratase gene and / or a branched-chain amino acid transaminase gene.

13. The recombinant Escherichia coli according to claim 12, characterized in that Contains at least one of the following characteristics: (1) The integration site of the coding sequence of the recombinant protein fused with the first interactive short peptide includes the djlA site, (2) The integration site of the coding sequence of the target gene fused with the second interactive short peptide includes the tyrV site.

14. The recombinant Escherichia coli according to claim 11, characterized in that The starting bacteria is a modified or unmodified Escherichia coli, and the starting bacteria comprises one or more of the following modifications relative to the host bacteria: (1) Enhanced expression of acetolactate synthase subunit I gene ilvBN, (2) Enhanced expression of acetolactate synthase subunit II gene ilvGM, (3) Enhanced expression of acetolactate synthase subunit III gene ilvIH, (4) Enhanced expression of the dicarboxylic acid reductoisomerase gene ilvC, (5) Enhanced expression of the dicarboxylate dehydratase gene ilvD, (6) Enhanced expression of branched-chain amino acid transaminase gene ilvE, (7) Knockout of the valine-pyruvate aminotransferase gene avtA, (8) Knockout of the branched-chain amino acid transporter gene brnQ, (9) Knockout of the regulatory RNA gene gcvB, (10) Enhanced expression of branched-chain amino acid transporter gene brnFE, (11) Knockout the lactate dehydrogenase gene ldhA.

15. The recombinant Escherichia coli according to claim 14, characterized in that The host bacteria include Escherichia coli K-12MG1655.

16. Use of the recombinant Escherichia coli according to any one of claims 11 to 15 in the synthesis of L-valine.

Images