A gene MlDHN1 regulating salt and alkali tolerance in Miscanthus sinensis and its application
By knocking down the DNH1 gene in Miscanthus sinensis, its regulatory role in saline-alkali stress was revealed, which solved the lack of gene-level research on the salt tolerance of Miscanthus sinensis, provided breeding applications, and improved the growth and yield of Miscanthus sinensis in saline-alkali land.
Patent Information
- Application Number
- CN202411744672.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2024-05-20
- Filing Date
- 2024-12-01
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2044-12-01
AI Technical Summary
The lack of genetic research on the salt tolerance of Miscanthus sinensis in existing technologies affects its growth and yield in saline-alkali land, and salt stress has multiple negative effects on plant physiology, biochemistry and morphology.
Transcriptome sequencing was performed after salt stress, alkali stress, and mixed salt and alkali stress to discover and verify the Miscanthus sinensis DNH1 gene MlDHN1. The gene was then knocked down using VIGS technology to observe the salt and alkali tolerance phenotypes of the plants and determine its regulatory function.
Knocking down the MlDHN1 gene significantly reduced the salt and alkali tolerance of Miscanthus sinensis, providing a theoretical basis for regulating its salt and alkali tolerance. This improved the breeding effect of soil salinity indicator plants.
Smart Images

Figure CN119932035B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a gene DHN1 that regulates the salt tolerance of Miscanthus sinensis and its application. Background Technology
[0002] Soil salinization is a major challenge facing global agriculture, impacting crop yields and sustainable agricultural development. According to FAO data, the global area of saline-alkali land exceeds 833 million hectares. Due to high salinity, pH imbalance, and poor soil structure, saline-alkali land severely inhibits crop growth, leading to low yields. Saline-alkali soils are classified into saline soils, alkaline soils, and saline-alkali soils, each containing different salt types, which have multiple negative effects on plants, including impaired water absorption, ion imbalance, nutrient deficiency, and cell membrane damage. Salt stress persists from the seed stage to the entire plant life cycle, not only interfering with photosynthesis and respiration but also affecting plant physiology, biochemistry, and morphology by altering gene expression and protein synthesis, ultimately limiting growth, development, and yield.
[0003] Miscanthus, a plant belonging to the genus Miscanthus of the Poaceae family, has shown great potential in saline-alkali land management and ecological restoration due to its strong drought, salt, and barrenness tolerance. However, salt stress is a significant environmental factor affecting the biomass of Miscanthus and other crops. Identifying and utilizing genes related to salt tolerance is crucial for improving crop salt tolerance. Currently, research on Miscanthus salt tolerance mainly focuses on the physiological level, lacking in-depth research at the gene level. Therefore, in-depth research on salt tolerance-related genes in Miscanthus and exploring their application in genetic engineering breeding has significant scientific and practical implications. Summary of the Invention
[0004] Purpose of the invention: To address the shortcomings of existing technologies, the purpose of this invention is to provide a Miscanthus gene. MlDHN1 This gene is a key gene regulating salt tolerance in Miscanthus sinensis. This invention, through transcriptome sequencing following salt stress, alkali stress, and mixed salt-alkali stress, identified the Miscanthus sinensis DNH1 gene, which is significantly upregulated under salt-alkali stress. MlDNH1 Using vigs technology, MlDNH1 in Miscanthus sinensis was knocked down. The knockdown plants were then subjected to salt stress treatment, and their salt tolerance, alkali tolerance, and salt-alkali tolerance phenotypes were further observed to determine their function under salt-alkali stress. Another objective of this invention is to provide a key gene regulating the salt-alkali tolerance of Miscanthus sinensis. MlDNH1 Applications.
[0005] Technical Solution: To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows:
[0006] This invention provides a salt-tolerant gene for Miscanthus sinensis. MlDHN1 The salt-tolerant gene of Miscanthus sinensis MlDHN1The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.
[0007] This invention also provides a salt-tolerant gene for Miscanthus sinensis. MlDHN1 The method for obtaining [the information] includes the following steps:
[0008] RNA was extracted from young leaves of *Miscanthus sinensis* and reverse transcribed into cDNA. Using this cDNA as a template, PCR amplification was performed using primers MlDNH1-VIGS-F and MlDNH1-VIGS-R to construct... MlDNH1 A virus-mediated gene silencing (VIGS) vector was used to infect Miscanthus sinensis, and the salt and alkali tolerance of the infected Miscanthus sinensis was analyzed and identified.
[0009] Furthermore, the sequences of the primers MlDNH1-VIGS-F and MlDNH1-VIGS-R are as follows:
[0010] MlDNH1-VIGS-F: agaaggcctccatggggatccGCCGCTGCTGAGGAGCAC
[0011] MlDNH1-VIGS-R: cgtgagctcggtaccggatccGTGGTGGCCAGGAAGCTTC (lowercase letters indicate that this sequence is a homologous arm of the vector)
[0012] Furthermore, the PCR amplification system is ddH2O containing Mg 2+ The buffer, dNTPs, MlDNH1-VIGS-F, MlDNH1-VIGS-R, high-fidelity PCR enzyme, and Miscanthus sinensis cDNA template were prepared.
[0013] Furthermore, the reaction conditions for the PCR amplification reaction are as follows: 95℃ pre-denaturation for 30s; 95℃ denaturation for 10s, 55℃ annealing for 10s, 72℃ for 30s, 36 cycles; extension at 72℃ for 5min.
[0014] Furthermore, the expression level of the Miscanthus salt tolerance gene MlDNH1 was reduced in gene-silenced Miscanthus.
[0015] Furthermore, the salt-tolerant gene in Miscanthus can be used to reduce the salt tolerance of Miscanthus.
[0016] Beneficial effects: Compared with the prior art, the advantages of this application are: This application discloses a gene that regulates the salt tolerance of Miscanthus sinensis. MlDHN1 ,Will MlDHN1 After gene knockdown, the salt tolerance, alkali tolerance, and salt-alkali tolerance of Miscanthus sinensis were significantly reduced, indicating that... MlDHN1Genes are key regulatory factors in regulating the salt tolerance of plants. This invention provides a gene that regulates the salt tolerance of Miscanthus sinensis and its application, which can be used for breeding soil salinity indicator plants. It provides a theoretical research basis and gene sequence for the molecular mechanism of gene expression regulation of Miscanthus sinensis salt tolerance, and has important application value in the field of salt tolerance breeding of energy plants. Attached Figure Description
[0017] Figure 1 WT (wild type), pTRV:00 (empty vector control plants) and pTRV: MlDHN1 ( MlDHN1 Phenotypic characteristics of seedlings (gene knockdown plants) before and after NaCl treatment.
[0018] Figure 2 WT, pTRV:00 and pTRV: MlDHN1 Expression level of the MlDHN1 gene in plants.
[0019] Figure 3 WT, pTRV:00 and pTRV: MlDHN1 Comparison of plant survival rate (A), fresh weight (B), and chlorophyll content (C) before and after salt stress treatment.
[0020] Figure 4 WT, pTRV:00 and pTRV: MlDHN1 DAB staining results of plant leaves before and after salt stress treatment.
[0021] Figure 5 WT, pTRV:00 and pTRV: MlDHN1 NBT staining results of plant leaves before and after salt stress treatment.
[0022] Figure 6 WT, pTRV:00 and pTRV: MlDHN1 The phenotypes of plants before and after alkaline and saline-alkali stress treatments, and the comparison of their survival rate, fresh weight, chlorophyll content, and MDA content. Detailed Implementation
[0023] The present invention will be further described below with reference to specific embodiments. Molecular biology experimental methods not specifically described in the following embodiments can be performed according to the methods listed in J. Sambrook's *Molecular Cloning: A Laboratory Manual* (3rd Edition) or conventional methods in the art, or according to the kit and product instructions.
[0024] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0025] Example 1: Cloning of the Miscanthus MlDHN1 gene
[0026] 1. Extraction of total RNA from Miscanthus sinensis
[0027] Tender leaf tissues of Miscanthus sinensis were collected, ground in liquid nitrogen, and RNA was extracted using the Trizol method.
[0028] 2. MlDHN1 Cloning of the gene.
[0029] MlDHN1 Gene-specific fragment amplification: Amplification was performed using specific primers: primer F: ATGGAGTACGGTCAGCAGGGA, primer R: TTAGTGCTGTCCGGGCAGC. MlDHN1 ( Misin17G118100 Gene-specific fragments.
[0030] 3. Construct pTRV: MlDHN1 pTRV was constructed using a homologous recombination reaction performed with the ClonExpress Ultra One Step kit (Vazyme). MlDHN1.
[0031] The primers used are:
[0032] MlDNH1-VIGS-F: agaaggcctccatggggatccGCCGCTGCTGAGGAGCAC
[0033] MlDNH1-VIGS-R: cgtgagctcggtaccggatccGTGGTGGCCAGGAAGCTTC (lowercase letters indicate that this sequence is a homologous arm of the vector)
[0034] Example 2: VIGS infection
[0035] In order to conduct in-depth research MlDHN1 The specific function of the gene in the salt stress response was investigated using VIGS technology to infect Miscanthus seeds, resulting in specific inhibition. MlDHN1 Plants exhibiting gene expression. TRV-mediated. MlDHN1Gene silencing was performed using the Miscanthus VIGS infection method, referencing (An efficient virus-induced gene silencing (VIGS) system for gene functional studies in Miscanthus, Volume 15, Issue 6 June 2023). Compared with wild-type (WT) and empty vector control plants (pTRV:00), pTRV: MlDHN1 In the plant MlDHN1 The expression level decreased by approximately 50%, demonstrating the successful achievement of VIGS technology in controlling [the expression level of VIGS]. MlDHN1 Effective gene silencing (with appendix) Figure 2 ).
[0036] Example 3: Chlorophyll Content Determination
[0037] Chlorophyll content was calculated using the method of Lichtenthaler and Wellburn (Lichtenthaler and Wellburn, 1983).
[0038] (1) Material preparation
[0039] Collect approximately 20 to 50 mg of fresh leaf material, transfer it into a 2 mL centrifuge tube, and accurately record the weight.
[0040] (2) Extraction
[0041] Add 2 mL of methanol to a centrifuge tube and store in a refrigerator at low temperature, inverting the tube occasionally to promote extraction. If extraction is incomplete, remove the upper layer of methanol, add another 1 mL of methanol, and incubate overnight. Combine the supernatants from both extractions.
[0042] (3) Measurement
[0043] Transfer 300 μL of the combined supernatant to a 96-well plate. Use 300 μL of methanol as a blank control. Next, accurately measure the absorbance of the supernatant at specific wavelengths of 653 nm and 666 nm.
[0044] (4) Concentration calculation
[0045] Calculation of chlorophyll a (Chla) concentration:
[0046] Chla = (15.65 × OD666 - 7.34 × OD653) × dilution ratio
[0047] Calculation of chlorophyll b (Chlb) concentration:
[0048] Chlb = (27.05 × OD653 - 11.21 × OD666) × Dilution ratio
[0049] The calculation results are in μg / mL.
[0050] (5) Results representation
[0051] The chlorophyll concentrations calculated above were converted to μg / mg (fresh weight) for subsequent analysis.
[0052] Example 4: Leaf DAB and NBT staining
[0053] Take pTRV separately: MlDHN1 The leaves of pTRV:00 and WT plants were stained with DAB (3,3-diaminobenzidine tetrahydrochloride) and NBT (nitroblue tetrazolium) as follows.
[0054] (1) DAB staining of leaves
[0055] A 0.1% DAB solution is typically used for staining and should be prepared fresh and stored at 4°C protected from light. Weigh 0.1 g of DAB powder and dissolve it in 100 mL of phosphate buffer (pH 3.8) to a final concentration of 1 mg / mL. Use sonication to aid dissolution during the preparation process.
[0056] Collect leaves to be stained and place them in a container containing DAB solution, ensuring the leaves are completely submerged. Stain at room temperature in the dark for 2-6 hours, until the positive areas turn dark brown and the remaining areas are nearly colorless or the plant's natural color (adjust staining time according to the plant's tenderness and color development). After staining, rinse the leaves with distilled water to remove any residual DAB dye. Add 95% ethanol and treat at 40°C for 3-16 hours to decolorize the leaves. During this process, replace the 95% ethanol several times to ensure complete removal of chlorophyll. After decolorization, gently lay the leaves flat on filter paper to allow the remaining liquid on the surface to be absorbed. Finally, carefully observe the staining of the leaves and take photographs for record-keeping.
[0057] (2) Leaf NBT staining
[0058] NBT solution: A 0.5 mg / mL NBT solution is typically used and should be prepared fresh before use. Specifically, weigh 0.05 g of NBT powder and dissolve it in 100 mL of phosphate buffer, adjust the pH to 7.8, and store at 4°C, protected from light.
[0059] During the experiment, the required plant leaves were collected and completely immersed in NBT staining solution. Staining was carried out at room temperature and in the dark. The staining time was adjusted according to the youngness of the plant and the degree of color development, generally 2-6 hours. When the positive areas showed a deep blue color, while other areas showed a light blue color, were nearly colorless, or retained the plant's original color, the leaves were gently removed with tweezers and immersed in distilled water, rinsing them gently back and forth 3-5 times to remove the surface staining solution. Then, the leaves were placed on filter paper to absorb excess water, immersed in 95% ethanol, and treated at 40℃ for 3-16 hours to ensure effective removal of chlorophyll. Fresh 95% ethanol was replaced several times during this period. After dehydration, the leaves were immersed in distilled water again and rinsed 3-5 times, placed on filter paper to absorb excess water, carefully observed, and photographed for record-keeping.
[0060] Example 5: Salt stress, alkali stress, and mixed salt-alkali stress treatment
[0061] Wild-type (WT) and empty vector control (pTRV:00) plants and pTRV: MlDHN1 ( MlDHN1 Gene knockout plants were treated in 1 / 2 Hoagland's hydroponic solution with the following treatments: salt treatment (100 mM NaCl, pH 5.8), alkali treatment (100 mM NaHCO3, pH 7.5), and a mixed salt-alkali treatment (100 mM NaCl + 100 mM NaHCO3, pH 5.8). Each group consisted of 20 plants. After seven days of treatment, survival rate, fresh weight, and chlorophyll content were measured. The activities of malondialdehyde (MDA), superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were also measured according to the kit instructions.
[0062] Under normal growth conditions, pTRV: MlDHN1 There was no significant difference in growth phenotype between the strain and the pTRV:00 control (see appendix). Figure 1 A). After salt stress treatment, both wild-type (WT) and empty vector control (pTRV:00) plants showed some degree of wilting (see appendix). Figure 1 B), with final survival rates of 76.6% and 83.3%, respectively. In comparison, pTRV: MlDHN1 The transgenic plants showed significantly enhanced sensitivity to salt stress, exhibiting a more pronounced wilting phenotype compared to the WT and pTRV:00 controls, with a final survival rate of only 64.3%. Figure 3 A). Accordingly, after salt stress treatment, pTRV: MlDHN1 The fresh weight and chlorophyll content of the strain were significantly lower than those of the WT and pTRV:00 control plants (see attached). Figure 3 B, C). These results illustrate... MlDHN1It plays a positive regulatory role in the salt stress tolerance of Miscanthus sinensis. Furthermore, DAB and NBT staining experiments revealed that under normal growth conditions, WT, pTRV:00, and pTRV: MlDHN1 The color difference in the plant leaves was not obvious. However, when subjected to salt stress, it became clear that pTRV: MlDHN1 The strain exhibited stronger and deeper coloration, indicating higher ROS accumulation compared to the WT and pTRV:00 control plants (see appendix). Figure 4 Appendix Figure 5 ).
[0063] When subjected to alkali or mixed saline-alkali stress, pTRV: compared to pTRV:00 and WT plants, MlDHN1 The plants exhibited a more pronounced leaf wilting phenotype. pTRV: MlDHN1 The survival rate, fresh weight, and chlorophyll content of the plants were significantly lower than those of WT and pTRV:00 plants. Meanwhile, pTRV: MlDHN1 The MDA content of the plants was significantly higher than that of the WT and pTRV:00 plants (see attached image). Figure 6 In summary, this evidence suggests that... MlDHN1 It may play a positive role in enhancing the salt and alkali stress tolerance of awns. Its reduced expression decreases the plant's salt tolerance, alkali tolerance, and salt-alkali tolerance, while its overexpression may increase the plant's salt tolerance, alkali tolerance, and salt-alkali tolerance.
[0064] In summary, this evidence suggests that... MlDHN1 A gene that positively regulates salt stress response in Miscanthus species, whose suppressed expression significantly enhances plant sensitivity to salt stress. This gene, regulating salt tolerance in Miscanthus and its applications, can be used in breeding soil salinity indicator plants and has significant application value in the field of salt-alkali tolerance breeding of energy plants.
[0065] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.
Claims
1. An application of regulating the Miscanthus sinensis MlDHN1 gene, characterized in that, The nucleotide sequence of the MlDHN1 gene is shown in SEQ ID NO.
1. The salt tolerance of Miscanthus sinensis plants is reduced by knocking down the expression level of the MlDHN1 gene.
2. The application according to claim 1, characterized in that, The amino acid sequence encoded by the MlDHN1 gene is shown in SEQ ID NO.
2.
3. The application according to claim 1, characterized in that, The vector for knocking down the MlDHN1 gene was constructed using the following method: using cDNA from young leaves of Miscanthus sinensis as a template, PCR amplification was performed using primers to obtain the target fragment, which was then constructed into the viral vector TRV2, and subsequently used to infect Miscanthus sinensis seeds to obtain Miscanthus sinensis plants with reduced MlDHN1 gene expression levels.
4. The application according to claim 3, characterized in that, The primers are as follows: M1DNH1-VIGS-F: agaaggcctccatggggatccGCCGCTGCTGAGGAGCAC; M1DNH1-VIGS-R: cgtgagctcggtaccggatccGTGGGTGGCCAGGAAGCTTC.
5. The application according to claim 1, characterized in that, The expression level of the MlDHN1 gene was knocked down using VIGS technology.
6. An application of regulating the Miscanthus sinensis MlDHN1 gene, characterized in that, The nucleotide sequence of the MlDHN1 gene is shown in SEQ ID NO.
1. Knocking down the expression level of the MlDHN1 gene reduces the alkali tolerance of Miscanthus sinensis plants.
7. An application of regulating the Miscanthus tectorius MlDHN1 gene, characterized in that, The nucleotide sequence of the MlDHN1 gene is shown in SEQ ID NO.
1. By knocking down the expression of the MlDHN1 gene, the salt and alkali tolerance of Miscanthus sinensis plants can be reduced.
8. The application of the Miscanthus MlDHN1 gene in the breeding of salt-tolerant Miscanthus, characterized in that, The nucleotide sequence of the MlDHN1 gene is shown in SEQ ID NO.
1. By knocking down the expression level of the MlDHN1 gene, Miscanthus plants with reduced salt tolerance and / or alkali tolerance were obtained.