Application of soybean nuclear stem cell factor coding gene GmNSN1

Abstract

The invention discloses an application of a soybean nuclear stem cell factor coding gene GmNSN1. The invention discloses application of the soybean nuclear stem cell factor coding gene GmNSN1 shown in SEQ ID NO.1 in genetic engineering transformation of the resistance of soybeans to prodenia litura. By mutating the gene, the resistance of soybeans to prodenia litura can be remarkably improved. The soybean nuclear stem cell factor coding gene GmNSN1 can be transformed into soybean through construction of a gene editing carrier and genetic engineering, the GmNSN1 gene is subjected to directional mutation, and the resistance of soybean to prodenia litura is regulated.

Description

Technical Field

[0001] The invention relates to application of nuclear stem cell factor encoding gene GmNSN1, and belongs to the field of genetic engineering. Background Art

[0002] Soybean (Glycine max (L.) Merr.) is an important grain and oil crop, providing humans with high-quality plant-based protein and oil, and is a raw material for processing a large number of traditional foods. In soybean production, insect pests are one of the main factors that reduce soybean production. In some soybean producing areas, the fall armyworm is the main leaf-feeding pest that harms soybean leaves, flowers, pods and young stems. It has a large appetite and reproduces quickly, and in severe cases, it can cause soybean harvest failure. Chemical control is currently the main measure for preventing and controlling the fall armyworm, but the continuous pollution caused by chemical pesticides is incalculable. The harm to human health caused by the continuous pollution is immeasurable. The cultivation and use of insect-resistant soybean varieties can effectively reduce the use of pesticides, achieve green prevention and control of pests, and ensure stable and increased soybean production.

[0003] Previous studies have located an insect-resistant site on chromosome 10 of soybean. Bioinformatics prediction found that only the nuclear stem cell factor protein (nucleostemin-like1, NSN1) encoding gene GmNSN1 is highly expressed in various tissues within this site. Nuclear stem cell factor (nucleostemin, NS) is a nucleolar GTP-binding protein that was first discovered in the nucleolus of mouse neural stem cells. It is mainly involved in stem cell proliferation, cell cycle maintenance, ribosomes and embryogenesis. In Arabidopsis, a nuclear stem cell factor protein (nucleostemin-like1, NSN1) with the same domain as mammalian nuclear stem cell factor was identified. Plant NSN1 regulates embryonic development and seedling growth and is highly expressed in developing embryos, flowers, shoot apical meristems and organ primordia. In soybean, the function of the GmNSN1 gene has not been studied, and there are no reports related to insect resistance. Summary of the invention

[0004] The purpose of the present invention is to disclose the insect-resistant genetic engineering application of soybean nuclear stem cell factor encoding gene GmNSN1.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] Application of soybean nuclear stem cell factor encoding gene GmNSN1 in genetic engineering to change soybean resistance to Spodoptera litura. The coding region sequence of the soybean nuclear stem cell factor encoding gene GmNSN1 is shown in SEQ ID NO.1

[0007] As a preferred embodiment of the present invention, knocking out the soybean nuclear stem cell factor encoding gene GmNSN1 can improve soybean resistance to Spodoptera litura.

[0008] The application of the gene editing vector of the soybean nuclear stem cell factor encoding gene GmNSN1 in improving soybean resistance to Spodoptera litura.

[0009] The application of the gene editing vector of the soybean nuclear stem cell factor encoding gene GmNSN1 in constructing soybean varieties with resistance to Spodoptera litura.

[0010] Beneficial effects:

[0011] GmNSN1 is a soybean nuclear stem cell factor gene that regulates soybean resistance to Spodoptera litura. Tissue expression analysis showed that GmNSN1 is expressed in all soybean tissues, with the highest expression in the leaves of resistant materials. Through gene editing technology and genetic transformation, it was found that GmNSN1 gene knockout transgenic soybeans significantly enhanced their resistance to Spodoptera litura. Therefore, GmNSN1 can be used as a target for regulating soybean resistance to Spodoptera litura and for insect resistance modification of soybean. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 .Agarose gel electrophoresis of GmNSN1 clone. The target fragment is 1719 bp in length. KF1: Kefeng No. 1; M: DL2000 molecular marker.

[0013] Figure 2 .Tissue expression pattern of GmNSN1. N=3.

[0014] Figure 3 . Editing types of the GmNSN1 gene in homozygous knockout strains. WT: receptor Jack, KO#2, 3, 4, 4-2: 4 gmnsn1 mutant strains.

[0015] Figure 4 .Identification of the resistance of the T2 generation gmnsn1 mutant strain to Spodoptera litura. (A) Spodoptera litura larvae after 2 days of feeding. (B) Relative growth rate of Spodoptera litura larvae after 2 days of feeding; (C) Leaves of Jack and gmnsn1 mutants after 2 days of feeding with Spodoptera litura larvae. Scale bar: 5 cm. *: P<0.05; **: P<0.01; ****: P<0.0001. DETAILED DESCRIPTION

[0016] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0017] Unless otherwise specified, the methods used in the following examples are all conventional methods.

[0018] Example 1 Expression pattern of soybean GmNSN1 gene

[0019] 1) Cloning of soybean GmNSN1 gene

[0020] Total RNA was extracted from the leaves of soybean variety Kefeng No. 1 using a total RNA extraction kit (Total RNA Kit, Tiangen). Total RNA was used as a template and reverse transcription was performed according to the instructions of the reverse transcription kit (HiScript III 1st Strand cDNA Synthesis Kit, Vazyme, Nanjing, R123-01) to obtain the first strand of cDNA. According to the mRNA sequence of the gene GmNSN1 on the soybean genome in the Phytozome v13 database (Glyma.10G122200), specific primers were designed. The primer sequences for amplifying the gene were F: TCCTTCCCCTTTTCGAGACGA; R: TATGGCAAGTCCATTTCCCCC. PCR amplification was performed using the cDNA of the leaves of Kefeng No. 1 obtained above as a template. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 1 minute and 45 seconds, a total of 35 cycles, and finally 72℃ incubation for 5 minutes. The PCR product was sequenced to obtain the CDS sequence of the GmNSN1 gene with a complete coding region, wherein the coding region sequence is shown in SEQ ID NO.1, and the length is 1719 bp ( Figure 1 ), amino acid sequence is shown in SEQ ID NO.2. 2) GmNSN1 gene is highly expressed in insect-resistant soybean leaves

[0021] Kefeng No. 1 is a soybean material resistant to Spodoptera litura. Kefeng No. 1 material was planted in the field and managed routinely. The roots, stems, and leaves of Kefeng No. 1 at V4 stage, the flowers at R2 stage, the pods 15 days after flowering, and the seeds 45 days after flowering were taken and quickly frozen in liquid nitrogen and stored at -80°C for later use. The total RNA of each tissue was extracted and reversely transcribed into cDNA. The relative expression of GmNSN1 in different tissues of the two materials was analyzed by real-time fluorescence quantitative PCR reaction, and the two-tailed t test was used for the significance of the relative expression of genes between tissues. The primer sequences for GmNSN1 fluorescence quantitative analysis were F: ttttgctgtccgttggaggt and R: tgtttgccgcgttggatatt, and the soybean gene Tubulin (Glyma.03g124400) was used as an internal reference, and the primer sequences were F: ggagttcacagaggcagaga and R: cacttacgcatcacatagca. The results showed that GmNSN1 was expressed in different tissues of Kefeng 1 ( Figure 2 ), with the highest expression in leaves.

[0022] Example 2 Gene Engineering Application of Gene GmNSN1

[0023] 1) Creation of soybean mutants carrying the GmNSN1 gene

[0024] The three sgRNA targeting sites of the GmNSN1 gene were designed online using the CRISPR-P2.0 website (http: / / CRISPR.hzau.edu.cn / CRISPR / ) and inserted into the CRISPR / Cas9 vector PSC-M for soybean gene editing (Duet al. 2016). The recombinant vector was introduced into the Agrobacterium tumefaciens strain EHA105 and transformed into the soybean cultivar Jack through the cotyledon node. The three sgRNA sequences were: sgRNA1: ACAAAAGAAAGCCGAACGCA, sgRNA2: GCAGGAACTCAAGGCCCTCG, sgRNA3: GCGAAGGGCGAAGGCAATTG. Specific primers were designed near the target site. The primers for sgRNA1 were U3sgRNA1-F2: ACAAAAGAAAGCCGAACGCAGTTTTAGAGCTAGAAATAGCAAG and U3sgRNA1-R2: TGCGTTCGGCTTTCTTTTGTTGACCAGACATGTCACGCTTAGT, which were linked to the intermediate vector U3 (Duet al.2016), the primers of sgRNA2 and sgRNA3 were: U6sgRNA2-F1: GCAGGAACTCAAGGCCCTCGGTTTTAGAGCTAGAAATAGCAAG, U6sgRNA2-R1: CGAGGGCCTTGAGTTCCTGCAATCCATATGTTTTCCTGGGAC, U6SgRNA3-F3: GCGAAGGGCGAAGGCAATTGGTTTTAGAGCTAGAAATAGCAAG, U6SgRNA3-R3: CAATTGCCTTCGCCCTTCGCAATCCATATGTTTTCCTGGGAC, and linked to the intermediate vector U6 (Du et al.2016). The editing site was amplified by PCR reaction, and the editing of GmNSN1 gene in transgenic soybean was detected by sequencing of PCR products. The primer sequences are: sgRNA-F: CCTAAGTATATCTTTCGCCT, sgRNA-R: ACATCGAGTACCCAATGGAT. Three GmNSN1 gene-edited strains (KO#2, 3, and 4) were obtained in the T0 generation. After additional generation reproduction and PCR product sequencing, 12 homozygous gmnsn1 mutants were obtained, with four editing types, namely KO#2, 3, 4, and 4-2 ( Figure 3 ), where KO#4 and 4-2 are different editing types from a T0 individual strain.

[0025] 2) GmNSN1 gene knockout improves soybean resistance to Spodoptera litura

[0026] Forced feeding of Spodoptera litura larvae was used to further evaluate the insect resistance of soybean mutant gmnsn1. Four strains of four types of gmnsn1 homozygous mutants, T2 generation and Jack, were used for insect resistance identification. Four well-grown and uniformly sized early second-instar Spodoptera litura larvae were placed on the fourth pair of trifoliate leaves of the recipient and knockout strains (V4), and the leaves were tightly covered with white mesh bags to prevent the larvae from escaping. The weight of the larvae before feeding (W0) and after 2 days of feeding (W1) was weighed, and the relative growth rate (RGR) of the larvae was calculated. The insect resistance of gmnsn1 mutants was evaluated using the relative growth rate as an indicator, and the calculation formula was: RGR = (W1-W0) / (2*W0)*100%. The results showed that the relative growth rate of the larvae fed on the four types of gmnsn1 mutants was significantly lower than that of the control group fed on Jack, and the degree of leaf area loss was also lower than that of the control group ( Figure 4 ). These results indicate that knocking out the GmNSN1 gene in soybean significantly improves the plant's resistance to Spodoptera litura.

[0027] References:

[0028] Du H, Zeng X, Zhao M, et al. Efficient targeted mutagenesis in soybean by TALENs and CRISPR / Cas9, Journal of Biotechnology, 2016, 217: 90-97.

Claims

1. Application of soybean nuclear stem cell factor encoding gene GmNSN1 in genetic engineering to modify soybean resistance to Spodoptera litura. The coding region sequence of soybean nuclear stem cell factor encoding gene GmNSN1 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Knocking out the soybean nuclear stem cell factor encoding gene GmNSN1 described in claim 1 by gene editing can improve soybean resistance to Spodoptera litura.

3. Use of the gene editing vector of the soybean nuclear stem cell factor encoding gene GmNSN1 as described in claim 1 in improving soybean resistance to Spodoptera litura.

4. Use of the gene editing vector of the soybean nuclear stem cell factor encoding gene GmNSN1 described in claim 1 in constructing soybean varieties with resistance to Spodoptera litura.

Images