Gypenoside GpMYC2-1 gene and application thereof
By cloning the GpMYC2-1 gene of Gynostemma pentaphyllum and overexpressing it in the hairy roots of Gynostemma pentaphyllum, the regulation of the synthesis and accumulation of secondary metabolites under cadmium stress was solved, thereby improving the cadmium tolerance of Gynostemma pentaphyllum and the quality of the Chinese medicinal material.
Patent Information
- Application Number
- CN202411880192.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-19
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-12-19
AI Technical Summary
In the existing technology, the response mechanism of Gynostemma pentaphyllum to cadmium stress is not clear, especially the regulatory mechanism of the synthesis and accumulation of secondary metabolites under cadmium stress has not been reported, which affects the quality of medicinal plants and the safety of Chinese medicinal materials.
The GpMYC2-1 gene of Gynostemma pentaphyllum was cloned, a recombinant vector plasmid was constructed, and GpMYC2-1 was overexpressed in the hairy roots of Gynostemma pentaphyllum using Agrobacterium-mediated transformation to regulate the synthesis and accumulation of secondary metabolites.
The GpMYC2-1 gene significantly enhances the biosynthesis of Gynostemma pentaphyllum saponins under cadmium stress, thereby increasing the tolerance of Gynostemma pentaphyllum to cadmium and improving the quality and safety of the traditional Chinese medicine.
Smart Images

Figure CN119932038B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to Gynostemma pentaphyllum. GpMYC2-1 Genes and their applications. Background Technology
[0002] Cadmium exhibits high phytotoxicity, capable of being translocated from plant roots to above-ground parts, inhibiting plant growth, development, and quality. This stress effect not only affects the quality of medicinal plants but also directly impacts the quality of traditional Chinese medicine (TCM) materials and their safe clinical use. Therefore, research on the cadmium response mechanism of medicinal plants helps elucidate the pathways by which cadmium affects the growth, development, and quality of TCM materials, laying a solid theoretical foundation for cultivating cadmium-tolerant medicinal plants.
[0003] Gynostemma pentaphyllum ( Gynostemma pentaphyllum Gynostemma pentaphyllum is a perennial herbaceous vine belonging to the genus Gynostemma of the Cucurbitaceae family, widely distributed in the Qinling Mountains and areas south of the Yangtze River in China. It is an important raw material for traditional Chinese medicine and health products, and is one of the few plants outside the Panax genus containing ginsenosides, earning it the reputation of "Southern Ginseng." Previous research by the inventors revealed that Gynostemma pentaphyllum can still grow normally after treatment with 50-100 μM cadmium, indicating that it has a certain tolerance to cadmium stress (zhou et al., 2023).
[0004] MYC2 Myelocytomatosis proteins (MYCs) are bHLH transcription factors widely found in plants and animals. They are core transcription factors in plant responses to jasmonic acid (JA) hormone signals, participating in plant defense responses, growth and development, and the regulation of secondary metabolites. Current research shows... MYC2 Transcription factors participate in the regulation of biosynthesis of secondary metabolites such as flavonoids, alkaloids, and terpenes, primarily by regulating the expression of key enzyme genes involved in metabolic biosynthesis. In *Salvia miltiorrhiza*, SmMYC2 It can not only increase the tanshinone content in hairy roots, but also participate in the biosynthesis of phenolic acids and anthocyanins (Cao Ruizhi, 2024; Liu Shucan, 2023). Freesia FhMYC2 It is involved in the synthesis of linalool during flower development (Yang et al., 2020). SmMYC2 Activated the key enzyme gene for tanshinone synthesis SmGGPPS1 Gene expression (Cao Ruizhi, 2024). Artemisia annua AaMYC2 Regulation of artemisinin biosynthetic enzymes AaCYP71AV1 and AaDBR2 Gene expression increases artemisinin content (Shen et al., 2016). Chili peppers CaMYC2 / 3 / 4 It can enhance the biosynthesis and accumulation of monoterpenes, thereby improving the defense capabilities of peppers against tomato spotted wilt virus (Wu et al., 2019); in tobacco,NtMYC2 Regulating scopolamine content can enhance tobacco's resistance to Alternaria (Sun et al., 2014). MYC Transcription factors play an important role in adverse conditions such as drought, salt and heat stress, but there are no reports on whether these transcription factors improve cadmium tolerance by regulating the synthesis and accumulation of Gynostemma pentaphyllum secondary metabolites under cadmium stress. Summary of the Invention
[0005] One object of the present invention is to address at least the aforementioned deficiencies and to provide at least the advantages that will be described later.
[0006] In order to achieve these objectives and other advantages of the present invention, Gynostemma pentaphyllum is now provided. GpMYC2-1 The gene has the base sequence shown in SEQ ID NO.1.
[0007] Gynostemma pentaphyllum GpMYC2-1 The method for constructing recombinant gene vector plasmids includes the following specific steps:
[0008] S1. Take 0.1 g of Gynostemma pentaphyllum leaves, freeze them in liquid nitrogen, and then grind them into powder.
[0009] S2. Total plant RNA was extracted from the powder using a total RNA extraction kit, and then the RNA was reverse transcribed into cDNA using a high-efficiency cDNA one-strand synthesis kit.
[0010] S3, according to Gynostemma pentaphyllum GpMYC2-1 The full-length cDNA sequence was designed and upstream and downstream primers were synthesized. PCR amplification was performed using Gynostemma pentaphyllum cDNA as a template, followed by electrophoresis on a 1.2% agarose gel. The cDNA was then purified using a DNA purification and recovery kit to obtain the Gynostemma pentaphyllum cDNA. GpMYC2-1 DNA fragments.
[0011] S4. Extract the pCY-35D-GFP plasmid and perform double digestion with SacI and SalI to obtain the pCY-35D-GFP linearized vector.
[0012] S5. Using a cloning kit to... GpMYC2-1 The full-length cDNA sequence was homologously recombinated with the pCY-35D-GFP linearized vector, and the reaction product was then transformed into DH5α competent cells. Positive clones were screened on LB medium containing 50 mg / L kanamycin.
[0013] S6. After verification by bacterial culture PCR and sequencing, the plasmid was extracted to obtain pCY-35D-GFP- GpMYC2-1 Recombinant vector plasmid.
[0014] Specifically, the above procedure involved grinding Gynostemma pentaphyllum leaves using a JXFSTPRP-64L grinder from Shanghai Jingxin Biotechnology Co., Ltd.; extracting total RNA from the plant using the Eastep® Super Total RNA Extraction Kit from Promega Biotechnology Co., Ltd.; reverse transcribing the RNA into cDNA using the Novozymes HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper); performing gel recovery using the DNA purification and recovery kit from Tiangen Biotech Co., Ltd.; extracting the pCY-35D-GFP plasmid and obtaining the recombinant vector plasmid using the Tiangen plasmid mini-preparation kit; and performing homologous recombination reaction using the Novozymes ClonExpress II One Step Cloning Kit at 37°C for 30 minutes.
[0015] Preferably, the sequences of the upstream and downstream primers are as follows:
[0016] The base sequence of the upstream primer is shown in SEQ ID NO.2: ATGAATCTCTGGACTGATGAAAACG.
[0017] The base sequence of the downstream primer is shown in SEQ ID NO.3: CATGATGCCTTGGCGACC.
[0018] Preferably, the PCR amplification reaction system comprises: 25 μL of high-fidelity enzyme, 2 μL of upstream primer, 2 μL of downstream primer, 2 μL of cDNA, and 19 μL of ddH2O; the reaction conditions are: denaturation at 98 °C for 10 seconds, annealing at 58 °C for 15 seconds, extension at 72 °C for 2 minutes, and 30 cycles.
[0019] Gynostemma pentaphyllum GpMYC2-1 Gene expression methods are obtained through the following steps:
[0020] S1. Take 1 μg of pCY-35D-GFP- GpMYC2-1 The recombinant vector plasmid was added to 100 μL of competent Agrobacterium rhizogenes cells and then subjected to the following treatments: slight mixing, placement on ice for 5 minutes, flash freezing in liquid nitrogen for 5 minutes, water bath at 37°C for 5 minutes, and placement on ice for 5 minutes. 1000 μL of TY liquid medium was then added, and the mixture was shaken and cultured at 28°C for 4 hours to obtain bacterial cells. The bacterial cells were then spread on TY solid plates supplemented with 50 mg / L streptavidin and incubated upside down at 28°C for 48 hours to obtain single colonies.
[0021] S2. Pick a single colony and inoculate it into 1000 μL of TY liquid medium supplemented with streptavidin 50 mg / L. Incubate at 28°C with shaking for 24 hours. Take 100 μL of the bacterial suspension into 50 mL of fresh TY medium and incubate at 28°C with shaking for 2 hours. Add 100 μmol / L acetylsylgenone and continue culturing until the absorbance of the culture at 600 nm is 0.5. Centrifuge the culture at 5000 rpm for 5 minutes, discard the supernatant, and resuspend the bacterial suspension in 1 / 2 MS medium containing 100 μmol / L acetylsylgenone.
[0022] S3. Take Gynostemma pentaphyllum leaves, gently scratch the surface, and immerse them in a resuspended bacterial solution. Infect the leaves on a horizontal shaker at 110 rpm for 10 minutes. Then transfer the leaves to MS solid medium containing 100 μmol / L acetylsylcholine and culture in the dark for 2-3 days. After washing, transfer the leaves to MS medium containing 500 mg / L carbenicillin and culture in the dark at 28 ℃ until the hairy roots are 3-5 cm long. Cut off the hairy roots and transfer them to MS medium containing 500 mg / L carbenicillin for further culture. Subculture once a week until no bacterial plaques appear on the hairy roots. Then transfer the culture to antibiotic-free MS solid plates for expansion culture for at least 1 month to obtain the initial cultured hairy roots.
[0023] S4. The initially cultured hairy roots were transferred to MS medium containing 50 mg / L kanamycin and cultured at 28 ℃ in the dark for 7 days. Hairy root lines with continued branching growth were screened, and hairy root DNA was extracted. Then, PCR amplification was performed using hairy root DNA as a template to obtain overexpressed DNA. GpMYC2-1 The genetically modified hairy root system.
[0024] Preferably, the cleaning described in S3 specifically includes: transferring the cultured explants to sterile water containing 400 mg / L carbenicillin, washing them in a horizontal shaker at 110 rpm for 5 minutes, and then rinsing them with sterile water at least 3 times.
[0025] Preferably, the PCR amplification in S4 specifically includes: designing an upstream primer based on the 35S promoter contained in the vector: the base sequence of 35S-F is shown in SEQ ID NO.4: TGAGACTTTTCAAC; based on... GpMYC2-1 Sequence, design downstream primers: GpMYC2-1The base sequence of -det-R is shown in SEQ ID NO.5: CATGATGCCTTGGCGACC; The rolB gene in Agrobacterium rhizogenes was selected as the basis for determining whether the hairy roots were induced by Agrobacterium rhizogenes. The base sequences of upstream and downstream primers F were designed and synthesized according to the rolB gene sequence, as shown in SEQ ID NO.6: GCTTTGCAGTGCTAGATTT and the base sequence of R is shown in SEQ ID NO.7: GAAGGTGCAAGCTACCTCTC. PCR amplification was performed using hairy root DNA as a template.
[0026] Preferably, the PCR amplification reaction system in S4 includes: 25 μL Taq Master Mix, 2 μL upstream primer, 2 μL downstream primer, 2 μL DNA, and 19 μL ddH2O; the reaction conditions are: 95 °C pre-denaturation for 3 minutes, 95 °C denaturation for 10 seconds, 58 °C annealing for 15 seconds, 72 °C extension for 30 seconds, and 30 cycles.
[0027] Gynostemma pentaphyllum GpMYC2-1 The application of genes to enhance plant resistance to cadmium stress.
[0028] The present invention has at least the following beneficial effects:
[0029] This invention is the first to clone transcription factor genes from Gynostemma pentaphyllum leaves. GpMYC2-1 Constructing overexpression GpMYC2-1 The vector, to obtain overexpression GpMYC2-1 The transgenic hairy root system is used for research. GpMYC2-1 Genes lay the foundation for the synthesis and accumulation of secondary metabolites of Gynostemma pentaphyllum.
[0030] This invention obtains Gynostemma pentaphyllum GpMYC2-1 The gene-derived hairy root system was applied under cadmium stress conditions, demonstrating... GpMYC2-1 It is not only a regulatory gene for the biosynthesis of Gynostemma pentaphyllum saponins, but also a key transcription factor in the biosynthesis of Gynostemma pentaphyllum saponins in response to cadmium stress.
[0031] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description
[0032] Figure 1 For the present invention GpMYC2-1 PCR diagram of gene cloning;
[0033] Figure 2 This invention is pCY-35D-GFP- GpMYC2-1 Schematic diagram of plasmid vector construction;
[0034] Figure 3 This is a diagram of the solid culture of the hairy roots of Gynostemma pentaphyllum according to the present invention;
[0035] Figure 4 For the overexpression of this invention GpMYC2-1 Image of hairy root liquid culture;
[0036] Figure 5 For the overexpression of this invention GpMYC2-1 PCR image for verification of the rolB gene in hairy roots;
[0037] Figure 6 For the overexpression of this invention GpMYC2-1 PCR image for positive verification of hairy roots;
[0038] Figure 7 This is a graph showing the total saponin content of the hairy roots in this invention.
[0039] Figure 8 This is a diagram showing the gene expression analysis of key enzymes for terpene synthesis in this invention;
[0040] in, Figure 1 The results were detected by 1.2% agarose gel electrophoresis. The size of the target fragment obtained by PCR amplification was between 1900 and 2000 bp. GpMYC2-1 The size matches; Figure 5 The results of 1.2% agarose gel electrophoresis showed that the size of the rolB gene PCR amplification product was between 450 and 500 bp, which was consistent with the size of the target gene, indicating that the hairy roots were induced by Agrobacterium rhizogenes. Figure 6 To utilize 35S-F and GpMYC2-1 -det-R was used to identify overexpressing positive hairy roots. The PCR amplification product size was between 2100 and 2300 bp, which was consistent with the expected fragment size, indicating that the hairy roots were positive hairy root lines. Detailed Implementation
[0041] The present invention will be further described in detail below with reference to embodiments, so that those skilled in the art can implement it based on the description.
[0042] Example 1
[0043] Gynostemma pentaphyllum GpMYC2-1 The gene, with its base sequence shown in SEQ ID NO.1.
[0044] ATGAATCTCTGGACTGATGAAAACGCATCTGTAATGGATGCGTTTATGAGCTCCGATCTC
[0045] TCTTCATATTGGGCACCAACTACTTCACAATCTCAATCTCAACCACCACAATCCTCTGCT
[0046] TCAGCTTCTGCTTCTACTCCCAATGACCCATGTAATTCAAATCCTCAACCAAGAATCT
[0047] CTCCAACATCGTCTTCAAGCTTTAATCGACGGGTTCTCGAGAAAGCTGGACTTACGCCATT
[0048] TTCTGGCAATCTTCTTATGATTATTCTGGTGCTTCAGTTTTAGGTTGGGGAGATGGGTAT
[0049] TATAAAGGAGAAGAAGATAAAGGGAAAAAAACCAAAGGTAAAGCTAAAGTTGTTTCCACC
[0050] GCTGCTGAACAAGCTCACCGGAAAGGTTCTCAGGGAATTGAATTCTTTGATTTCTGGA
[0051] AACCCATCTGGACCTGATGATGCTATCGATGAAGAAGTTACTGATACGGAATGGTTTTTC
[0052] CTTGTTTCTATGACTCAATCTTTTGGGAATGGTGTTGGATTTCCGAGTCAGGCTTTTTC
[0053] AATTCGACTCCGATTTGGGTTTCCGGTGCTGATAAATTAGCTGCTGCTTCTTGTGAGAGA
[0054] GCTCGTCAAGGAAGCGTTTTCGGGTTGCGGACGATGGTCTGTATTCCTTCCGCGAATGGT
[0055] GTTGTTGAAATGGGTTCTACGGAGATGATTTATCGGACTTCTGATTTGATGAATAAAGTT
[0056] AGGGTTTTGTTTGATTTTAATAATCATAATCTTGAAATGGGTTCTTGGAATTTGGGTGGT
[0057] GATGAGGGTGAGAATGATCCGTCTGAAATCTGGATTAACGAGCCTTCAAGTACGATTGAG
[0058] ATGAAGGATTCGTTGAACACTAATGTTCCTTTGAAAGGAATTCATTCCCAAAAACCCGAGT
[0059] TCGGTAGTTTGACTGAAACCCTAAGTGCAATTCATGTTCCTCCTAAGCAGAGTCAGGGT
[0060] TTTTTGAACTTTTCTGATCATGGGAATTCTTCACATTCCAATTCATTCAAGCCGGAATCT
[0061] GGTGGGATGTTGAATTTCGGCGATAGTAATCGGAGTTCTTATGGTAACGGTAATAATGGA
[0062] AATGTGAGTTTGTTTTCTGGTCATTCACAATATGTTGCAGAGGAGAATGAGAAGAAGAGA
[0063] TCGCCGCCTTCGCGTAGTAGTAACGAGGAAGAGATTCTTTCGTTTACTTCCGGTGTGGTT
[0064] TTGCCGTCGTCTGGGAAGGTGAAATCGGGCAGTGCTGCTGCTGATTCGGACCATTCGGAT
[0065] CTTGAAGCGTCGATAATTCGTGAGGTTGATAGTTGTAAAGTTGTAGAGCCGGAGAAAAGG
[0066] CCGAGAAAGAGAGGAAGAAAACCAGCTAATGGAAGAGAAGAGCCTTTGAATCATGTTGAA
[0067] GCAGAGAGGCAGAGAAGGGAAAAGTTGAACCAAAAATTCTATGCTCTTCGCGCTGTGGTT
[0068] CCAAACGTATCCAAAATGGATAAAGCTTCCCTCCTCGGCGACGCTGTCTCGTACATTAAC
[0069] GACCTTAAATCGAAGCTCCAAATCACAGAATCGGATAAAACAGAGTTGCAGAGGCAATTA
[0070] GACTCGATGAAGAAGCATATGGGAAGTAAAGATTCAAGTTTTTCAAGATGTGCAATTGAG
[0071] GAAGAAGATCTTAAGATCTCAAGCAAATTGATGGAGATGGATGTCGACGTGAAGATTATC
[0072] GGTTGGGACGCTATGATTAGGATCCAATGCAGCAAGAAAAACCATCCGGCAGCAAGGTTG
[0073] ATGATGGCTCTAAAGGATCTCGATTTAGATATGCTTCACGCCAGTGTATCGGTAGTGAAC
[0074] GATTTGATGATTCAACAGGCGACCGTGAAGATGGGAGCCGATTCTACACGCAGGAGCAG
[0075] CTCAGAATAGCCCTTATATCGAAATTCAGTGATGGGGGTCGCCAAGGCATCATG
[0076] Example 2
[0077] Gynostemma pentaphyllum GpMYC2-1 The method for constructing recombinant gene vector plasmids includes the following specific steps:
[0078] S1. Take 0.1 g of Gynostemma pentaphyllum leaves, freeze them with liquid nitrogen, and then grind them into powder using a grinder (model JXFSTPRP-64L) from Shanghai Jingxin Company.
[0079] S2. Total plant RNA was extracted from the powder using the Eastp® Super Total RNA Extraction Kit from Promega Biotechnology Co., Ltd., and then the RNA was reverse transcribed into cDNA using the Novozymes HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper).
[0080] S3, according to Gynostemma pentaphyllum GpMYC2-1 The full-length cDNA sequence was designed and upstream and downstream primers were synthesized. PCR amplification was performed using Gynostemma pentaphyllum cDNA as a template, followed by electrophoresis on a 1.2% agarose gel. The gel was then purified using a DNA purification and recovery kit from Tiangen Biotech Co., Ltd., yielding the Gynostemma pentaphyllum cDNA. GpMYC2-1 DNA fragments.
[0081] S4. Extract pCY-35D-GFP plasmid using the Tiangen plasmid mini-prep kit, and perform double digestion with SacI and SalI to obtain the pCY-35D-GFP linearized vector.
[0082] S5. Use the Novizan ClonExpress II One Step Cloning Kit to... GpMYC2-1 The full-length cDNA sequence was homologously recombinated with the pCY-35D-GFP linearized vector at 37°C for 30 minutes. The reaction product was then transformed into DH5α competent cells, and positive clones were screened on LB medium containing 50 mg / L kanamycin.
[0083] S6. After verification by bacterial culture PCR and sequencing, the plasmid was extracted using the Tiangen Plasmid Mini-Prep Kit to obtain pCY-35D-GFP- GpMYC2-1 Recombinant vector plasmid.
[0084] Furthermore, the sequences of the upstream and downstream primers are shown below:
[0085] The base sequence of the upstream primer is shown in SEQ ID NO.2: ATGAATCTCTGGACTGATGAAAACG.
[0086] The base sequence of the downstream primer is shown in SEQ ID NO.3: CATGATGCCTTGGCGACC.
[0087] Furthermore, the PCR amplification reaction system includes: 25 μL of high-fidelity enzyme, 2 μL of upstream primer, 2 μL of downstream primer, 2 μL of cDNA, and 19 μL of ddH2O; the reaction conditions are: denaturation at 98 °C for 10 seconds, annealing at 58 °C for 15 seconds, extension at 72 °C for 2 minutes, and 30 cycles.
[0088] Example 3
[0089] Gynostemma pentaphyllum GpMYC2-1 Gene expression methods are obtained through the following steps:
[0090] S1. Take 1 μg of pCY-35D-GFP- GpMYC2-1 The recombinant vector plasmid was added to 100 μL of competent Agrobacterium rhizogenes cells and then subjected to the following treatments: slight mixing, placement on ice for 5 minutes, flash freezing in liquid nitrogen for 5 minutes, water bath at 37°C for 5 minutes, and placement on ice for 5 minutes. 1000 μL of TY liquid medium was then added, and the mixture was shaken and cultured at 28°C for 4 hours to obtain bacterial cells. The bacterial cells were then spread on TY solid plates supplemented with 50 mg / L streptavidin and incubated upside down at 28°C for 48 hours to obtain single colonies.
[0091] S2. Pick a single colony and inoculate it into 1000 μL of TY liquid medium supplemented with streptavidin 50 mg / L. Incubate at 28℃ with shaking for 24 hours. Take 100 μL of the bacterial suspension into 50 mL of fresh TY medium and incubate at 28℃ with shaking for 2 hours. Add 100 μmol / L acetylsylgenone and continue culturing until the absorbance of the culture at 600 nm is 0.5. Centrifuge the culture at 5000 rpm for 5 minutes, discard the supernatant, and resuspend the bacterial suspension in 1 / 2 MS medium containing 100 μmol / L acetylsylgenone.
[0092] S3. Take Gynostemma pentaphyllum leaves, gently scratch the surface, and immerse them in a resuspended bacterial solution. Infect the leaves on a horizontal shaker at 110 rpm for 10 minutes. Then transfer the leaves to MS solid medium containing 100 μmol / L acetylsylcholine and culture in the dark for 2-3 days. After washing, transfer the leaves to MS medium containing 500 mg / L carbenicillin and culture at 28 ℃ in the dark until the hairy roots are 3-5 cm in length. Cut off the hairy roots and transfer them to MS medium containing 500 mg / L carbenicillin for further culture. Subculture every week until sterile plaques appear on the hairy roots. Then transfer them to antibiotic-free MS solid plates for expansion culture for at least 1 month to obtain the initial cultured hairy roots. The washing process specifically includes: transferring the cultured explants to sterile water containing 400 mg / L carbenicillin and washing them on a horizontal shaker at 110 rpm for 5 minutes, followed by rinsing with sterile water at least 3 times.
[0093] S4. The initially cultured hairy roots were transferred to MS medium containing 50 mg / L kanamycin and cultured at 28 ℃ in the dark for 7 days. Hairy root lines with continued branching growth were screened, and hairy root DNA was extracted. Then, PCR amplification was performed using hairy root DNA as a template to obtain overexpressed DNA. GpMYC2-1 The transgenic hairy root system. Specifically, PCR amplification includes: designing upstream primers based on the 35S promoter contained in the vector; the base sequence of 35S-F is shown in SEQ ID NO.4: TGAGACTTTTCAAC; based on... GpMYC2-1 Sequence, design downstream primers: GpMYC2-1 The base sequence of -det-R is shown in SEQ ID NO.5: CATGATGCCTTGGCGACC; the rolB gene in Agrobacterium rhizogenes was selected as the basis for determining that the hairy roots were induced by Agrobacterium rhizogenes. The base sequences of the upstream and downstream primers F were designed and synthesized according to the rolB gene sequence, as shown in SEQ ID NO.6: GCTTTGCAGTGCTAGATTT and the base sequence of R is shown in SEQ ID NO.7: GAAGGTGCAAGCTACCTCTC. PCR amplification was performed using hairy root DNA as a template. The PCR amplification reaction system included: Taq Master Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, DNA 2 μL, ddH2O 19 μL; the reaction conditions were: 95 ℃ pre-denaturation for 3 minutes, 95 ℃ denaturation for 10 seconds, 58 ℃ annealing for 15 seconds, 72 ℃ extension for 30 seconds, 30 cycles.
[0094] Example 4
[0095] Gynostemma pentaphyllum GpMYC2-1 The application of genes to enhance plant resistance to cadmium stress.
[0096] Gynostemma pentaphyllum GpMYC2-1 Gene response test to heavy metal cadmium
[0097] Experiment 1: Determination of total saponin content in Gynostemma pentaphyllum
[0098] S1. Overexpression was obtained using the method described in Example 3. GpMYC2-1 The transgenic hairy root system was transferred into 1 / 2 MS liquid medium for culture. During the rapid growth period of the hairy root system, 50 μmol CdCl2 solution was added to the medium. After 7 days of culture, the roots were taken out as the experimental group hairy roots. Hairy roots obtained by infecting Agrobacterium rhizogenes containing the pCY-35D-GFP empty vector were used as the control group hairy roots.
[0099] S2. The surface moisture of the hairy roots of the experimental group and the control group was absorbed and dried in an oven at 60 ℃ until constant weight. The roots were then ground into powder particles with a particle size of 100 mesh to obtain the powder of the experimental group and the powder of the control group.
[0100] S3. Take 0.5g of the powder from the experimental group and the powder from the control group, respectively. Extract three times with 5mL of 75% ethanol using ultrasound, 2 hours each time. Filter the extract through a filter membrane to obtain 15mL of the extract from the experimental group and 15mL of the extract from the control group, respectively. Evaporate the ethanol in a 50℃ water bath, dissolve the crystals in 2mL of distilled water, extract once with 2.5mL of water-saturated n-butanol solution, recover the crystals, dissolve them in methanol, and finally dilute to 2mL with methanol to obtain the test solution from the experimental group and the test solution from the control group. Weigh 3.8mg of the standard ginsenoside Rb1 and prepare a 0.38mg / mL standard solution with methanol.
[0101] S4. Accurately pipette 0 μL, 50 μL, 100 μL, 200 μL, 300 μL, 400 μL, 500 μL, and 600 μL of the standard solution into 10 mL stoppered colorimetric tubes and evaporate to dryness in a 60 ℃ water bath. Add 0.2 mL of 5% vanillin-acetic acid solution and 0.8 mL of perchloric acid, mix well, and heat in a 60 ℃ water bath for 15 minutes, then cool in ice water. Add 5 mL of acetic acid, shake well, and measure the absorbance at 550 nm. Plot a standard curve based on the mass concentration and absorbance values of the standard. Accurately pipette 0.1 mL of the test solution, and measure the absorbance of the sample according to the above standard determination method. Substitute the absorbance into the regression equation to calculate the total saponin content. The total saponin content in the test sample is represented by X, x = (M1 × V1) / (M2 × V2 × 1000). In the formula, M1 is the mass of total saponins in the sample solution calculated from the standard curve, in milligrams (mg); V1 is the volume of the sample solution, in milliliters (mL); M2 is the mass of the sample, in grams (g); and V2 is the volume of the sample solution used for determination, in milliliters (mL).
[0102] Experiment 2: Expression analysis of key enzyme genes in the Gynostemma pentaphyllum saponin synthesis pathway
[0103] 1. Control hairy roots, positive hairy roots, and cadmium-treated positive hairy roots were extracted. Total RNA was extracted from the plants using the Eastp® Super Total RNA Extraction Kit (Promegabio), and the RNA was reverse transcribed into cDNA using the Novozymes HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper). Specific primers were used to target key genes in the saponin synthesis pathway. GpDXS , GpDHDDS ,GpHMGR2 , GpMVK For isotropic expression level detection, the specific primers are shown in Table 1.
[0104] 2. Based on the butler gene GpUBC As an internal reference gene (the upstream primer sequence is shown in SEQ ID NO.8: ATGCTGATGGTAGTATATGC; the downstream primer sequence is shown in SEQ ID NO.9: TGGATAGAGGTGAGTATGG), 2- △△CT The relative expression level of the gene to be tested can be calculated.
[0105] Table 1: List of Specific Primer Sequences
[0106]
[0107] The results are as follows Figure 7 and Figure 8 The results showed that in the untreated group with 0 μM dCl2, the total saponin content of Gynostemma pentaphyllum in the overexpressing lines OE1, OE2, and OE3 was higher than that in the control hairy roots (WT), increasing by 0.13-fold, 0.13-fold, and 0.18-fold, respectively. Key enzyme genes in the Gynostemma pentaphyllum saponin synthesis pathway were also observed. GpDXS , GpDHDDS , GpHMGR2 , GpMVK , GpSQE and Gpβ-AS The expression levels of these compounds were significantly increased. In the 50 μM cadmium dCl2 treatment group, the total saponin content of Gynostemma pentaphyllum in the overexpressing lines OE1, OE2, and OE3 was significantly higher than that in the control hairy roots (WT), increasing by 0.22-fold, 0.26-fold, and 0.26-fold, respectively. GpDXS , GpDHDDS , GpHMGR2 , GpMVK , GpSQE and Gpβ-AS Gene expression levels were significantly higher than those in WT.
[0108] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. It can be applied to various fields suitable for the present invention. Further modifications can be readily implemented by those skilled in the art.
Claims
1. Gynostemma pentaphyllum GpMYC2-1 Genes, characterized by, The base sequence is shown in SEQ ID NO.
1.
2. The Gynostemma pentaphyllum as described in claim 1 GpMYC2-1 A method for constructing a gene recombinant vector plasmid, characterized in that, The specific steps include: S1. Take 0.1 g of Gynostemma pentaphyllum leaves, freeze them in liquid nitrogen, and then grind them into powder; S2. Extract total plant RNA from the powder using a total RNA extraction kit, and then reverse transcribe the RNA into cDNA using a high-efficiency cDNA one-strand synthesis kit. S3, according to Gynostemma pentaphyllum GpMYC2-1 The full-length cDNA sequence was designed and upstream and downstream primers were synthesized. PCR amplification was performed using Gynostemma pentaphyllum cDNA as a template, followed by electrophoresis on a 1.2% agarose gel. The cDNA was then purified using a DNA purification and recovery kit to obtain the Gynostemma pentaphyllum cDNA. GpMYC2-1 DNA fragments; S4. Extract the pCY-35D-GFP plasmid and double digest it with SacI and SalI to obtain the pCY-35D-GFP linearized vector. S5. Using a cloning kit to... GpMYC2-1 The full-length cDNA sequence was homologously recombinated with the pCY-35D-GFP linearized vector, and the reaction product was then transformed into DH5α competent cells. Positive clones were screened on LB medium containing 50 mg / L kanamycin. S6. After verification by bacterial culture PCR and sequencing, the plasmid was extracted to obtain pCY-35D-GFP- GpMYC2-1 Recombinant vector plasmid.
3. The Gynostemma pentaphyllum as described in claim 2 GpMYC2-1 A method for constructing a gene recombinant vector plasmid, characterized in that, The sequences of the upstream and downstream primers are shown below: Upstream primer: ATGAATCTCTGGACTGATGAAAACG; Downstream primer: CATGATGCCTTGGCGACC.
4. The Gynostemma pentaphyllum as described in claim 2 GpMYC2-1 A method for constructing a gene recombinant vector plasmid, characterized in that, The PCR amplification reaction system includes: 25 μL high-fidelity enzyme, 2 μL upstream primer, 2 μL downstream primer, 2 μL cDNA, 19 μL ddH2O; The reaction conditions were: denaturation at 98 °C for 10 seconds, annealing at 58 °C for 15 seconds, extension at 72 °C for 2 minutes, and 30 cycles.
5. The Gynostemma pentaphyllum as described in claim 1 GpMYC2-1 A gene expression method, characterized in that, Obtained through the following steps: S1. Take 1 μg of the pCY-35D-GFP as described in claim 2. GpMYC2-1 The recombinant vector plasmid was added to 100 μL of competent Agrobacterium rhizogenes cells and then subjected to the following treatments: slight mixing, placement on ice for 5 minutes, flash freezing in liquid nitrogen for 5 minutes, water bath at 37 ℃ for 5 minutes, and placement on ice for 5 minutes. 1000 μL of TY liquid medium was then added, and the cells were cultured in a shaker at 28 ℃ for 4 hours to obtain bacterial cells. The bacterial cells were then spread on TY solid plates supplemented with 50 mg / L streptavidin and incubated upside down at 28 ℃ for 48 hours to obtain single colonies. S2. Pick a single colony and inoculate it into 1000 μL of TY liquid medium supplemented with streptavidin 50 mg / L. Incubate at 28 ℃ with shaking for 24 hours. Take 100 μL of the bacterial suspension into 50 mL of fresh TY medium and incubate at 28 ℃ with shaking for 2 hours. Add 100 μmol / L acetylsylgenone and continue culturing until the absorbance of the culture at 600 nm is 0.
5. Centrifuge the culture at 5000 rpm for 5 minutes, discard the supernatant, and resuspend the bacterial suspension in 1 / 2 MS medium containing 100 μmol / L acetylsylgenone. S3. Take Gynostemma pentaphyllum leaves and gently scratch the surface, then soak them in the resuspended bacterial solution. Infect them on a horizontal shaker at 110 rpm for 10 minutes. Then transfer the leaves to MS solid medium containing 100 μmol / L acetylsylcholine and culture them in the dark for 2-3 days. After washing, transfer them to MS medium containing 500 mg / L carbenicillin and culture them at 28 ℃ in the dark until the hairy roots are 3-5 cm long. Cut off the hairy roots and transfer them to MS medium containing 500 mg / L carbenicillin for further culture. Subculture them every week until no bacterial plaques appear on the hairy roots. Then transfer them to antibiotic-free MS solid plates for expansion culture for at least 1 month to obtain the initial cultured hairy roots. S4. The initially cultured hairy roots were transferred to MS medium containing 50 mg / L kanamycin and cultured at 28 ℃ in the dark for 7 days. Hairy root lines with continued branching growth were screened, and hairy root DNA was extracted. Then, PCR amplification was performed using the hairy root DNA as a template. GpMYC2-1 The genetically modified hairy root system.
6. The Gynostemma pentaphyllum as described in claim 5 GpMYC2-1 A gene expression method, characterized in that, The cleaning described in S3 specifically includes: After culture, the explants were transferred to sterile water containing 400 mg / L carbenicillin and washed in a horizontal shaker at 110 rpm for 5 minutes, and then rinsed with sterile water at least 3 times.
7. The Gynostemma pentaphyllum as described in claim 5 GpMYC2-1 A gene expression method, characterized in that, The PCR amplification in S4 specifically includes: Based on the 35S promoter contained in the vector, design the upstream primer: 35S-F: TGAGACTTTTCAAC; according to GpMYC2-1 Sequence, design downstream primer: GpMYC2-1-det-R: CATGATGCCTTGGCGACC; The rolB gene from Agrobacterium rhizogenes was selected as the basis for determining whether hairy roots were induced by Agrobacterium rhizogenes. The upstream and downstream primers F: GCTTTGCAGTGCTAGATTT and R: GAAGGTGCAAGCTACCTCTC were designed and synthesized based on the rolB gene sequence, and PCR amplification was performed using hairy root DNA as a template.
8. The Gynostemma pentaphyllum as described in claim 5 GpMYC2-1 A gene expression method, characterized in that, The reaction system for PCR amplification in S4 includes: Taq Master Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, DNA 2 μL, ddH2O 19 μL; The reaction conditions were: 95 °C pre-denaturation for 3 minutes, 95 °C denaturation for 10 seconds, 58 °C annealing for 15 seconds, 72 °C extension for 30 seconds, and 30 cycles.
9. A Gynostemma pentaphyllum as described in claim 1 GpMYC2-1 The application of genes is characterized by, It was used to promote the synthesis of total saponins from Gynostemma pentaphyllum under cadmium stress conditions.
Citation Information
Patent Citations
Method for increasing rare ginsenoside in gynostemma pentaphyllum tea
CN118947793A
Novel ginsenoside glycosidase derived from the genus terrabacter, and use thereof
US20120264167A1