Demethylase odm gene for synthesizing benzylisoquinoline alkaloids and application thereof

By cloning the ODM4 and ODM5 genes from Corydalis rhizome, constructing a recombinant expression vector, and expressing it in engineered bacteria, the efficient synthesis of corydaline and tetrahydrocorydaline in vivo was achieved, solving the problem of low synthesis efficiency in existing technologies. This has broad application prospects and economic value.

CN119932056BActive Publication Date: 2025-11-28CHINA PHARM UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510203388.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-24
Publication Date
2025-11-28
Estimated Expiration
2045-02-24

AI Technical Summary

Technical Problem

The lack of effective ODM enzyme genes in existing technologies leads to low efficiency in the synthesis of corydaline from Corydalis rhizome, limiting the application of metabolic engineering in the in vivo production of benzyl isoquinoline alkaloids.

Method used

ODM4 and ODM5 genes were cloned from Corydalis rhizome, and a recombinant expression vector was constructed and engineered bacteria were used to express them. These genes were then used to catalyze the demethylation of tetrahydropalmatine to generate corydaline and tetrahydropalmatine, achieving efficient synthesis through enzymatic reactions.

Benefits of technology

This provides a theoretical basis for the efficient synthesis of corydaline and tetrahydrocorydaline in organisms, improving production efficiency and economic value, and broadening the application prospects of metabolic engineering.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119932056B_ABST
    Figure CN119932056B_ABST
Patent Text Reader

Abstract

The application discloses a demethylase ODM gene for synthesizing benzyl isoquinoline alkaloids and application thereof, and the demethylase ODM gene is an ODM4 gene or an ODM5 gene, the CDS region nucleotide sequence of the ODM4 gene is shown as SEQ ID NO:1, and the CDS region nucleotide sequence of the ODM5 gene is shown as SEQ ID NO:2. In view of the fact that the research foundation for key genes for synthesizing corydaline in Corydalis tuber is weak, the ODM4 gene for catalyzing the demethylation of tetrahydropalmatine to specifically generate corydaline and tetrahydrojatrorrhizine and the ODM5 gene for specifically generating tetrahydrojatrorrhizine are cloned from the Corydalis tuber for the first time. The application provides an important theoretical basis for producing corydaline by using a synthetic biology method in the future, and has wide application prospect and great economic value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a demethylase ODM gene for synthesizing benzylisoquinoline alkaloids and application thereof. BACKGROUND

[0002] Fibraurea is the dried tuber of Fibraurea racemosa Oliv. of the Papaveraceae family, which tastes bitter and pungent, and is warm in nature. It belongs to the meridians of the liver, spleen and lung, and has the effects of activating blood, promoting qi and relieving pain. In clinical practice, Fibraurea is mainly used for treating chest and abdominal pain, chest pain, dysmenorrhea, postpartum blood stasis, and sprains and swelling pain. Modern pharmacological studies have shown that Fibraurea has the effects of analgesia, anti-anxiety, sedation and hypnotism, anti-myocardial ischemia, anti-cerebral ischemia, anti-gastrointestinal ulcer, anti-tumor, and drug withdrawal.

[0003] The main chemical components in Fibraurea are alkaloids, followed by anthraquinones, organic acids, amino acids, inorganic acids and other compounds. At present, a variety of active alkaloid components have been isolated from Fibraurea, mainly benzylisoquinoline alkaloids, including protoberberine alkaloids, aporphine alkaloids, and opium alkaloids, which are potential drugs for treating various diseases. According to the plant chemical analysis, a benzylisoquinoline alkaloid, cytonemin, has been found in the tuber of Fibraurea. Cytonemin can reduce neuropathic pain by inhibiting the ASK1-p38 MAPK / NF-κB pathway, up-regulating the Nrf2 / HO-1 / CO signaling pathway, or inhibiting the nf-κb-dependent CXCL1 / CXCR2 signaling pathway, and can effectively treat drug addiction, and has good biological activity. However, the key factor that has not been able to be developed into a medicine is that it is trace amount in nature.

[0004] In recent years, the rise of molecular biology and metabolic engineering has brought new ideas to people. Through the use of metabolic engineering methods, medicinal ingredients can be produced at the level of organisms or organelles, which has the advantages of less time-consuming, large yield, and less cost than chemical synthesis. Therefore, the use of molecular biology and metabolic engineering technology to produce effective ingredients has wide application prospects.

[0005] The use of metabolic engineering is limited by the lack of key enzymes and encoding genes for controlling the biosynthesis of effective ingredients. Structurally, cytonemin is C-10 monohydroxytetrahydropalmatine, that is, the methoxy group at position 10 of tetrahydropalmatine is removed to form a hydroxyl group to obtain cytonemin. Tetrahydropalmatine is a kind of benzylisoquinoline alkaloid that exists in large amounts in Fibraurea, which is cheap and easy to obtain. If metabolic engineering can be used to convert tetrahydropalmatine into trace amount of cytonemin in microorganisms, it will provide a basis for the subsequent development of cytonemin medicine.

[0006] It has been found that cytochrome P450 produced by Streptomyces griseus can selectively demethylate the hydroxyl region of tetrahydroberberine D-ring to generate corydalmine. However, due to low conversion efficiency, long reaction time, and great difference between the enzyme in bacteria and the enzyme in plants, it is necessary to find the specific ODM enzyme in Corydalis tuber to provide a basis for producing benzylisoquinoline alkaloids by using synthetic biology method. SUMMARY

[0007] The present application provides a demethylase ODM gene for synthesizing benzylisoquinoline alkaloids and application thereof.

[0008] Technical scheme: In order to achieve the above-mentioned application purposes, the present application adopts the following technical scheme:

[0009] In the first aspect, the present application provides a demethylase ODM gene for synthesizing benzylisoquinoline alkaloids, wherein the demethylase ODM gene is ODM4 gene or ODM5 gene, the CDS region nucleotide sequence of the ODM4 gene is shown in SEQ ID NO: 1, and the CDS region nucleotide sequence of the ODM5 gene is shown in SEQ ID NO: 2.

[0010] The present application uses bioinformatics technology to analyze the results of Corydalis tuber genome sequencing and Corydalis tuber transcriptome sequencing, and finds an ODM gene ODM4 for specifically generating corydalmine and tetrahydrojatrorrhizine and an ODM gene ODM5 for specifically generating tetrahydrojatrorrhizine. The cDNA of Corydalis tuber sample is subjected to PCR amplification, and the CDS sequence (full length 1074 bp) of the functional gene ODM4 for catalyzing tetrahydroberberine to be demethylated to generate corydalmine and tetrahydrojatrorrhizine and the CDS sequence (full length 1080 bp) of the ODM5 functional gene for catalyzing tetrahydroberberine to be demethylated to generate tetrahydrojatrorrhizine are obtained.

[0011] In the second aspect, the present application provides a protein encoded by the demethylase ODM gene, wherein the protein encoded by the ODM4 gene has an amino acid sequence shown in SEQ ID NO: 3, and the protein encoded by the ODM5 gene has an amino acid sequence shown in SEQ ID NO: 4. The amino acid sequence of the protein also includes an amino acid sequence with equivalent function which is formed by substituting, deleting or adding one or more amino acids in the above-mentioned sequence. The protein is demethylase ODM4 and ODM5.

[0012] In the third aspect, the present application provides a recombinant expression vector containing the demethylase ODM gene.

[0013] As a specific embodiment, the expression vector is pET28a.

[0014] Preferably, the recombinant expression vector is pET28a-ODM4 or pET28a-ODM5.

[0015] In a fourth aspect, the present application provides a recombinant expression engineering bacterium, which expresses the demethylase ODM gene or contains the recombinant expression vector.

[0016] As a specific embodiment, the recombinant expression engineering bacterium is Escherichia coli strain BL21 (DE3).

[0017] In addition, the present application provides an expression cassette containing the demethylase gene ODM4 and ODM5, etc. in addition to the recombinant expression vector, the recombinant expression engineering bacterium and the demethylase ODM4 and ODM5.

[0018] In a fifth aspect, the present application provides the use of the demethylase ODM gene, the protein, the recombinant expression vector and the recombinant expression engineering bacterium in the synthesis of benzylisoquinoline alkaloids.

[0019] As a specific embodiment, the benzylisoquinoline alkaloids are corydalmine and / or tetrahydrocolumbamine, the ODM4 gene is used to catalyze the demethylation of tetrahydropalmatine to generate corydalmine and tetrahydrocolumbamine, and the ODM5 gene is used to catalyze the demethylation of tetrahydropalmatine to generate tetrahydrocolumbamine.

[0020] In a sixth aspect, the present application provides a method for synthesizing benzylisoquinoline alkaloids, which comprises using the demethylase ODM gene to synthesize the benzylisoquinoline alkaloids by genetic engineering.

[0021] As a specific embodiment, the benzylisoquinoline alkaloids are corydalmine and / or tetrahydrocolumbamine, the ODM4 gene is used to catalyze the demethylation of tetrahydropalmatine to generate corydalmine and tetrahydrocolumbamine, and the ODM5 gene is used to catalyze the demethylation of tetrahydropalmatine to generate tetrahydrocolumbamine.

[0022] As a specific embodiment, the method comprises constructing a recombinant expression vector using the demethylase ODM gene, then introducing the recombinant expression vector into an engineering bacterium to obtain a recombinant expression engineering bacterium, fermenting, purifying to obtain a purified protein (demethylase ODM4 or ODM5), and finally using tetrahydropalmatine as a raw material, the purified protein as a catalyst to perform an enzymatic reaction to obtain the benzylisoquinoline alkaloids.

[0023] More specifically, the recombinant expression engineering bacterium is a recombinant Escherichia coli, which is inoculated into a fermentation medium and cultured at 35-37°C to an OD 600When the value is 0.6-0.8, an inducer isopropyl-beta-D-thiogalactopyranoside is added for fermentation at 18℃ for 18 h. The enzymatic reaction is carried out at 20-30℃ for 0.5-2.5 h, and the reaction medium is Tris-HCl buffer or phosphate buffer.

[0024] In an embodiment, the final concentration of the inducer isopropyl-beta-D-thiogalactopyranoside is 0.3 mM.

[0025] In an embodiment, the fermentation medium includes, but is not limited to, LB or TB medium.

[0026] In an embodiment, when the ODM4 gene is used to catalyze the demethylation of tetrahydropalmatine to generate corydaline and tetrahydropapaverin, the optimal enzymatic reaction condition is that Tris-HCl buffer with pH 8.0 is used, and the reaction is carried out at 20℃ for 120 min. When the ODM5 gene catalyzes the demethylation of tetrahydropalmatine to generate tetrahydropapaverin, the optimal enzymatic reaction condition is that phosphate buffer with pH 6.5 is used, and the reaction is carried out at 30℃ for 50 min.

[0027] In a seventh aspect, the application provides the use of the demethylase ODM gene, the recombinant expression vector and the recombinant expression engineering bacteria in increasing the content of corydaline and / or tetrahydropapaverin in plants.

[0028] Beneficial effects: In view of the fact that the research on the key genes for synthesizing corydaline in Corydalis yanhusuo is weak, the ODM4 gene and the ODM5 gene which catalyze the demethylation of tetrahydropalmatine to generate corydaline and tetrahydropapaverin and the ODM5 gene which catalyze the demethylation of tetrahydropalmatine to generate tetrahydropapaverin are cloned from Corydalis yanhusuo for the first time. The application provides an important theoretical basis for producing corydaline by using synthetic biology method in the future, and has wide application prospect and great economic value. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 is a schematic diagram of the demethylation reaction of tetrahydropalmatine catalyzed by the ODM4 protein to synthesize corydaline and tetrahydropapaverin in Example 2;

[0030] Figure 2 is a schematic diagram of the demethylation reaction of tetrahydropalmatine catalyzed by the ODM5 protein to synthesize tetrahydropapaverin in Example 2;

[0031] Figure 3 is a mass spectrum of the product catalyzed by the ODM4 protein enzyme in Example 2, wherein (A) is MS1 and MS2 analysis of the standard corydaline, (B) is MS1 and MS2 analysis of the standard tetrahydropapaverin, and (C-D) are mass spectrum detection diagrams of the ODM4 protein catalyzed sample;

[0032] Figure 4 is the mass spectrum of LC-MS detection of ODM5 protease catalytic product in Example 2, wherein (A) MS1 and MS2 analysis of standard tetrahydropalmatine is carried out. (B) ODM5 protein catalytic sample mass spectrum detection chart;

[0033] Figure 5 is the enzyme study of ODM4 and ODM5 in Example 2 to improve the catalytic efficiency of demethylase, wherein (A) is the enzyme study result of ODM4, (B) is the enzyme study result of ODM5. DETAILED DESCRIPTION

[0034] The following examples are used to illustrate the present application, but are not intended to limit the scope of the present application. If not specifically indicated, the examples are carried out according to the conventional experimental conditions, such as Sam brook et al. Molecular Cloning: a Laboratory Manual, 2001, or according to the conditions suggested by the manufacturer's instructions.

[0035] Example 1 Cloning of ODM4 and ODM5 genes

[0036] According to the previous analysis of fumariy genome sequencing and fumariy transcriptome sequencing results, two pairs of specific primers were designed:

[0037] ODM4-F: 5'- ATGGGTCGCGGATCCGAATTCGGGCCCATGAAGAATGAGATCAACC-3' ODM4-R: 5'- GGTGGTGGTGGTGCTCGAGCTAATCCAATTTCATGAATTCC-3'

[0038] ODM5-F: 5'- ATGGGTCGCGGATCCGAATTCGGGCCCATGAACAATGCGATTATCAATAG-3'

[0039] ODM5-R: 5'- GTGGTGGTGGTGGTGCTCGAGTTAATCCAATTTCATGAATTCCAAT-3'

[0040] Total RNA extraction kit was used to extract total RNA from fumariy tuber, and cDNA was synthesized by reverse transcription. The CDS sequences of ODM4 gene (full length 1074 bp) and ODM5 (full length 1080 bp) genes of tetrahydropalmatine demethylation in fumariy shown in SEQ ID NO: 1 and SEQ ID NO: 2 were amplified from the cDNA obtained by reverse transcription using the above primers.

[0041] (1) Fresh Corydalis tuber was ground with liquid nitrogen, 100 mg powder was accurately weighed into a 2 mL centrifuge tube pre-cooled with liquid nitrogen, and the EASYspin Universal Plant RNA Kit total RNA kit lysis solution was added. After vortex mixing, it was placed for 10 min;

[0042] (2) According to the operation instruction of the EASYspin Universal Plant RNA Kit total RNA kit, the total RNA of Corydalis tuber was extracted;

[0043] (3) The total RNA extracted from Corydalis tuber was used as a template, and the reverse transcriptase kit PrimeScript TM RTMaster Mix (purchased from Baobioengineer Co., Ltd.) was used to synthesize the first strand of cDNA, and the reaction conditions were carried out according to the kit instructions;

[0044] (4) The CDS sequences of the functional genes ODM4 and ODM5 in Corydalis, which catalyze the demethylation of tetrahydropalmatine to generate corydaline and tetrahydropalmatine, and generate tetrahydropalmatine, were amplified from the cDNA obtained by reverse transcription from RNA using the above primers ODM4-F and ODM4-R, ODM5-F and ODM5-R;

[0045] (5) Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ for 15 sec, 56℃ for 90 sec, 72℃ for 1.5 min, 30 cycles; 72℃ extension for 15 min. The reaction product was purified using the DNA purification kit of Vazyme Company. The purified PCR product was inserted into the EcoRI and XhoI enzyme digestion sites of the expression vector pET28a using the ClonExpress MultiS one-step cloning kit (purchased from Vazyme Company, Nanjing, China), and the E. coli DH5α competent cells were transformed, positive clones were screened and sequenced, and the full-length gene was obtained. The plasmids carrying ODM4 and ODM5 gene sequences were extracted from the positive clones and named as pET28a-ODM4 and pET28a-ODM5 plasmids.

[0046] Example 2 E. coli recombinant expression verification of ODM4 gene and ODM5 gene

[0047] Materials and methods

[0048] LB medium: 10 g / L peptone, 10 g / L sodium chloride, 5 g / L yeast extract, 121℃ sterilization for 15 min.

[0049] TB medium: 12 g / L peptone, 5 g / L glycerol, 24 g / L yeast extract, 17 mM potassium dihydrogen phosphate, 72 mM potassium hydrogen phosphate, sterilized at 121°C for 15 min.

[0050] Fermentation conditions

[0051] (1) The pET28a-ODM4 and pET28a-ODM5 plasmids obtained in Example 1 were transformed into E. coli BL21 (DE3) competent cells, positive clones were screened and subcultured in LB liquid medium containing Kana antibiotic, and the recombinant E. coli was cultured at 35-37°C until the OD600 value was 0.6-0.8. After adding isopropyl-β-D-thiogalactoside, the culture was further incubated at 16-20°C for 12-20 h. The concentration of isopropyl-β-D-thiogalactoside was 0.3 mM.

[0052] (2) The fermentation broth obtained in step (1) was centrifuged at 8000 rpm at 4°C for 10-20 min, and the bacterial cells were collected and washed with Tris-HCl buffer at pH 8.0. After washing, the bacterial cells were used for crude enzyme reaction or whole-cell catalysis.

[0053] Enzymatic reaction

[0054] (3) The bacterial cells washed in step (2) were resuspended with 20 mM imidazole to make the OD value of different recombinant bacterial suspensions 15, and the crude enzyme solution was obtained by ultrasonic crushing. The supernatant was centrifuged at 14000 rpm at 4°C for 30-60 min, and then purified by a nickel column. The detailed steps are described in the instruction manual.

[0055] (4) The purified protein obtained in step (3) was used for in vitro functional verification, and the test steps were as follows: reaction volume 200 μL, 400 μM tetrahydropalmatine, 500 μM α-ketoglutaric acid, 10 mM ascorbic acid, 2.5 mM Fe 2+ , 36 μg of ODM purified protein, 100 mM Tris-HCl buffer (pH 8.5) to make up 200 μL; the negative control was 400 μM tetrahydropalmatine, 500 μM α-ketoglutaric acid, 10 mM ascorbic acid, 2.5 mM Fe 2+ , and the ODM purified protein was inactivated by boiling. The reaction was carried out at 30°C for 2 h, and then 1 / 2 volume of acetonitrile was added for mixing. The reaction mixture was centrifuged at 14000 rpm for 10-20 min, and the supernatant was filtered and used for high performance liquid chromatography analysis.

[0056] The ODM4 protein catalytic reaction is described in detail in Figure 1 , and the ODM5 protein catalytic reaction is described in detail in Figure 2 .

[0057] High performance liquid chromatography analysis

[0058] (5) Mobile phase: A phase is ultrapure water containing 0.1% formic acid, and B phase is acetonitrile.

[0059] (6) Chromatographic column: Shimadzu LC-2010C AT high performance liquid chromatograph, Hedera ODS-2 C18 chromatographic column (4.0 mm x 250 mm, 5 μm), mobile phase acetonitrile: 0.1% formic acid solution, gradient elution, elution flow rate 1 mL / min, sample amount 20 μL, column temperature 25 ℃; elution program: 0 min: 10:90 (v / v), 5 min: 30:70 (v / v), 10 min: 95:5 (v / v), 14 min: 45:55 (v / v), 12 min: 50:50 (v / v). Use ultraviolet detector, detection wavelength 280 nm.

[0060] (7) Mass spectrometry parameters: Agilent Poroshell 120 SB-Aq (3.0 * 150 mm, 2.7 μm) is used. The mobile phase is acetonitrile: 0.1% formic acid water. The linear elution conditions are 0 min: 10:90 (v / v), 5 min: 30:70 (v / v), 10 min: 95:5 (v / v), 14 min: 45:55 (v / v), 12 min: 50:50 (v / v). The conditions of ESI source are: dry gas (N2) flow rate 8.0 L / min; collision energy, 35 eV; spray voltage 3.5 kV; capillary temperature: 320℃; auxiliary combustion gas heater temperature, 300℃; sheath gas flow rate: 35 arb; auxiliary gas flow rate: 15 arb; sweep gas flow rate: 5 arb; auxiliary gas, sheath gas, sweep gas are all high-purity nitrogen. All operations and data analysis are in positive ion mode.

[0061] The ODM4 protein function verification results are obtained by LC-MS detection, and the results are shown in Figure 3 , wherein A is the mass spectrum of the standard substance, the molecular weight is 343.1757[H+1] + , B is the mass spectrum of the standard substance tetrahydrojatrorrhizine, the molecular weight is 342.1698, C is the mass spectrum of the sample of ODM4 protein catalyzing tetrahydro-palmatine to generate corydalmine, and the catalytic product with a molecular weight of 342.1703 can be detected, and D is the mass spectrum of the sample of ODM4 protein catalyzing tetrahydro-palmatine to generate tetrahydrojatrorrhizine, and the catalytic product with a molecular weight of 342.1704 can be detected; the ODM5 protein function verification results are obtained by LC-MS detection, and the results are shown inFigure 4 Figure 8 shows the mass spectrum of ODM4 catalyzed sample (A) and the standard tetrahydroharman (B). The molecular weight of the standard tetrahydroharman is 342.1698, and the molecular weight of the catalyzed product is 342.1798.

[0062] (8) The enzymatic reaction conditions were optimized, and the effects of different reaction pH (100 mM phosphate buffer at pH 6.0-6.5, 100 mM Tris-HCl buffer at pH 7.0-8.5, and 100 mM Na2CO3-NaHCO3 buffer at pH 9.0-11.0), temperature (15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C), time (15 min, 45 min, 60 min, 90 min, 120 min, 150 min, 180 min, 240 min), and different ions (Cu2+, Mg2+, Ag+, Ca2+, Zn2+, Mn2+, Fe3+, Co2+, Ni+ in the presence / absence of Fe2+) were investigated. The samples were taken and analyzed by high performance liquid chromatography according to the above method. The results are shown in Figure 8. The optimal reaction conditions for ODM4 are Tris-HCl buffer at pH 8.0, 20°C, and 120 min. The optimal reaction conditions for ODM5 are phosphate buffer at pH 6.5, 30°C, and 50 min. Figure 5

[0063] While the embodiments of the present application have been shown and described, it is to be understood that various modifications, substitutions, replacements and variations can be made to these embodiments without departing from the principles and spirit of the present application, and the scope of the present application is defined by the appended claims and their equivalents.​

Claims

1. A demethylase ODM gene for the synthesis of benzylisoquinoline alkaloids, characterized in that, The demethylase ODM gene is either the ODM4 gene or the ODM5 gene. The nucleotide sequence of the CDS region of the ODM4 gene is shown in SEQ ID NO:1, and the nucleotide sequence of the CDS region of the ODM5 gene is shown in SEQ ID NO:

2.

2. The protein encoded by the demethylase ODM gene according to claim 1, characterized in that, The protein encoded by the ODM4 gene has the amino acid sequence shown in SEQ ID NO:3; the protein encoded by the ODM5 gene has the amino acid sequence shown in SEQ ID NO:

4.

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the demethylase ODM gene as described in claim 1.

4. A recombinant expression engineered bacterium, characterized in that, The recombinant expression engineered bacteria express the demethylase ODM gene as described in claim 1, or contain the recombinant expression vector as described in claim 3.

5. The application of the demethylase ODM gene of claim 1, the protein of claim 2, the recombinant expression vector of claim 3, and the recombinant expression engineered bacteria of claim 4 in the synthesis of benzylisoquinoline alkaloids, characterized in that, The benzyl isoquinoline alkaloids are corydaline and tetrahydropalmatine, or tetrahydropalmatine. The ODM4 gene is used to catalyze the demethylation of tetrahydropalmatine to generate corydaline and tetrahydropalmatine, and the ODM5 gene catalyzes the demethylation of tetrahydropalmatine to generate tetrahydropalmatine.

6. A method for synthesizing benzylisoquinoline alkaloids, characterized in that, The method includes using the demethylase ODM gene of claim 1 to synthesize the benzyl isoquinoline alkaloids by genetic engineering methods, characterized in that the benzyl isoquinoline alkaloids are corydaline and tetrahydropalmatine, or tetrahydropalmatine, the ODM4 gene is used to catalyze the demethylation of tetrahydropalmatine to generate corydaline and tetrahydropalmatine, and the ODM5 gene catalyzes the demethylation of tetrahydropalmatine to generate tetrahydropalmatine.

7. The method for synthesizing benzylisoquinoline alkaloids according to claim 6, characterized in that, The method includes constructing a recombinant expression vector using the demethylase ODM gene as described in claim 1, then introducing the recombinant expression vector into engineered bacteria to obtain recombinant expression engineered bacteria, fermenting, purifying to obtain purified protein, and finally using tetrahydropalmatine as raw material and the purified protein as catalyst to carry out an enzymatic reaction to obtain the benzylisoquinoline alkaloid.

Citation Information

Patent Citations

  • O-methyltransferase protein with highly specific catalytic function on multiple BIAS parent nuclei, and coding gene and application thereof

    CN115896058A

  • Application of O-methyltransferase in lotus plumule and coding gene of O-methyltransferase in biosynthesis of mono / bisbenzylisoquinoline alkaloids

    CN116376863A