Recombinant plasmid, recombinant strain and method for synthesizing rebaudioside M by one-step method

Abstract

The invention discloses a recombinant plasmid, a recombinant strain and a method for synthesizing rebaudioside M by a one-step method, and belongs to the technical field of biological catalytic synthesis. The recombinant plasmid contains a coding gene of a glycosyl transferase UGT91C1 mutant, a coding gene of a glycosyl transferase UGT76G1 mutant and a coding gene of sucrose synthase. The mutant of the glycosyl transferase UGT91C1 is 2-12E, and the coding gene sequence of the glycosyl transferase UGT91C1 is as shown in SEQ ID NO. 1; the glycosyl transferase UGT76G1 mutant is 101H10, and the coding gene sequence of the glycosyl transferase UGT76G1 mutant is as shown in SEQ ID NO. 2; the sequence of the coding gene of the sucrose synthase is as shown in SEQ ID NO. 3. The rebaudioside M is synthesized by using a three-enzyme co-expression recombinant strain containing the plasmid through a one-step method, so that the loss of fermentation materials can be reduced, the utilization efficiency of equipment is improved, the energy consumption is reduced, and the large-scale production of the rebaudioside M is facilitated.

Description

Technical Field

[0001] The invention relates to the field of biocatalytic synthesis, and in particular to a recombinant plasmid, a recombinant strain and a one-step method for synthesizing rebaudioside M. Background Art

[0002] Rebaudioside M is a natural sweetener extracted from stevia and belongs to the steviol glycoside family. Compared with other common steviol glycosides, such as rebaudioside A, rebaudioside M is also very sweet and has a relatively good taste, close to sucrose, and has a low calorie content, so it is often used as an additive in health and weight loss foods.

[0003] Rebaudioside M has undergone rigorous food safety assessments and is considered a safe food additive that can be used in the food and beverage industry to replace traditional sugars, reduce the calories of products without affecting sweetness, and help diabetics and people who control their weight reduce their sugar intake. In addition, Rebaudioside M can avoid some bitterness or aftertaste to a certain extent, so it is used to optimize taste and flavor in high-end food formulations.

[0004] However, the production of rebaudioside M in the prior art is relatively low and cannot meet the high demand of the market. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a recombinant plasmid, a recombinant strain and a one-step method for synthesizing rebaudioside M, so as to overcome the problem of low rebaudioside M yield in the prior art.

[0006] In a first aspect, the present invention provides a recombinant plasmid, which contains a gene encoding a glycosyltransferase UGT91C1 mutant, a gene encoding a glycosyltransferase UGT76G1 mutant, and a gene encoding a sucrose synthase;

[0007] The glycosyltransferase UGT91C1 mutant is 2-12E, and its encoding gene sequence is shown in SEQ ID NO.1;

[0008] The glycosyltransferase UGT76G1 mutant is 101H10, and its encoding gene sequence is shown in SEQ ID NO.2;

[0009] The sequence of the gene encoding sucrose synthase is shown in SEQ ID NO.3.

[0010] Compared with the prior art, the recombinant plasmid of the present invention contains the coding gene of the glycosyltransferase UGT91C1 mutant, the coding gene of the glycosyltransferase UGT76G1 mutant and the coding gene of the sucrose synthase. The three-enzyme co-expression recombinant strain containing the plasmid can be used for the one-step synthesis of rebaudioside M. Compared with the multi-step synthesis method of the prior art, it can reduce the loss of fermentation materials, reduce sewage discharge, improve equipment utilization efficiency and reduce energy consumption, which is conducive to the large-scale production of rebaudioside M.

[0011] In a second aspect, the present invention provides a recombinant strain containing the above-mentioned recombinant plasmid.

[0012] In a third aspect, the present invention provides a one-step method for synthesizing rebaudioside M, comprising the following steps:

[0013] (1) connecting a gene encoding a glycosyltransferase UGT91C1 mutant, a gene encoding a glycosyltransferase UGT76G1 mutant, and a gene encoding a sucrose synthase to an expression vector to obtain a recombinant plasmid;

[0014] (2) transferring the recombinant plasmid into a host strain to obtain a recombinant strain expressing three enzymes;

[0015] (3) inoculating the three-enzyme co-expressing recombinant strain into LB medium for cultivation to obtain seed liquid;

[0016] (4) Inoculate the seed solution into a new LB medium at an inoculum rate of 0.5-1.5 v / v% and shake culture until the OD value of the culture solution reaches 0.1. 600 When the pH value is 0.6-0.8, the temperature is lowered to 20-30°C, and the inducer is added for induction culture;

[0017] (5) After the induction culture is completed, the bacteria are collected, resuspended, the cells are broken, and centrifuged. The supernatant is the crude enzyme solution;

[0018] (6) Add rebaudioside A, sucrose, UDPG, crude enzyme solution and sodium phosphate buffer solution to the catalytic reaction system for reaction, inactivate the enzyme in a boiling water bath and dissolve the reaction product, and centrifuge to obtain the supernatant, which is the product rebaudioside M.

[0019] Compared with the prior art, the present application constructs a recombinant plasmid including a gene encoding a glycosyltransferase UGT91C1 mutant, a gene encoding a glycosyltransferase UGT76G1 mutant, and a gene encoding a sucrose synthase, and then constructs a three-enzyme co-expression recombinant strain, and cultivates the three-enzyme co-expression recombinant strain to obtain a crude enzyme solution. The crude enzyme solution and a reaction system including rebaudioside A as a substrate can be used to synthesize rebaudioside M in a one-step method. By reducing the output of the intermediate product rebaudioside D in the conversion system, the substrate rebaudioside A is directly converted into the target product rebaudioside M, which is beneficial to improving the substrate conversion rate, thereby increasing the yield of rebaudioside M.

[0020] Furthermore, the LB medium in step (3) contains 40 mg / L to 100 mg / L of streptomycin sulfate; the culture temperature in step (3) is 30 to 40° C., and the culture is shaken at 200 to 300 rpm for 12 to 18 hours.

[0021] Compared with the prior art, the LB medium in the above technical solution contains streptomycin sulfate, which can effectively inhibit the growth of foreign bacteria and protect the three-enzyme co-expression recombinant strain from being contaminated by foreign bacteria. At the same time, the seed liquid obtained by oscillating culture under the above specific conditions can ensure that there is a sufficient number of starting bacteria in the subsequent fermentation culture process.

[0022] Furthermore, in step (4), the culture temperature during the first shaking culture is 35-40° C. and the culture is carried out at 200-300 rpm;

[0023] The LB culture medium in step (4) contains 40 mg / L to 100 mg / L of streptomycin sulfate.

[0024] Furthermore, the inducer in step (4) is arabinose, the final concentration of the inducer in the LB medium is 2-5 g / L, the induction culture temperature is 20-30° C., and the shaking culture is carried out at 200-300 rpm for 16-24 hours.

[0025] Compared with the prior art, the above technical solution adds arabinose with a final concentration of 2 to 5 g / L to the LB medium, and performs induction culture under the above culture conditions. Arabinose can activate the promoter in the recombinant expression vector, thereby starting the downstream gene, and inducing the three-enzyme co-expression recombinant strain to express the glycosyltransferase UGT91C1 mutant 2-12E, the glycosyltransferase UGT76G1 mutant 101H10 and the sucrose synthase.

[0026] Furthermore, the catalytic reaction system contains 25-50 mM rebaudioside A, 300-700 mM sucrose, 1-2 mM UDPG, 10-500 mL crude enzyme solution and 50-100 mM sodium phosphate buffer solution.

[0027] It should be understood that the concentrations of the reaction substrates rebaudioside A, sucrose and UDPG in the above technical solution are all final concentrations in the catalytic reaction system. The amount of crude enzyme solution added should be determined according to the volume of the total reaction system and the concentration of each substrate in the reaction system.

[0028] Furthermore, during the catalytic reaction, the reaction temperature is 30-40° C., the pH is 7-8, and the reaction time is 6-48 hours.

[0029] Furthermore, the expression vector is PYB1s.

[0030] Furthermore, the host strain includes but is not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the growth curve of the three-enzyme co-expressing recombinant strain in the fermenter in Test Example 2.

[0032] Figure 2 This is a graph showing the change in yield of the product rebaudioside M (RM) over time in the enlarged conversion reaction system of Test Example 3.

[0033] Figure 3 This is the detection spectrum of HPLC after 24 hours of reaction in Test Example 3. DETAILED DESCRIPTION

[0034] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0035] In the prior art, rebaudioside A is generally converted into an intermediate product, rebaudioside D, and then rebaudioside D is converted into the target product, rebaudioside M. However, due to the low solubility of the intermediate product, rebaudioside D, the intermediate product, rebaudioside D, is not easily redissolved after the step-by-step conversion, which affects the yield of the target product, rebaudioside M. In order to solve the above technical problems, the present invention provides a recombinant plasmid, a recombinant strain and a one-step method for synthesizing rebaudioside M. See the following examples for details.

[0036] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified.

[0037] Example 1

[0038] Amplification of target gene

[0039] Using the cDNA of the coding gene sequence of the mutant 2-12E of the glycosyltransferase UGT91C1 from wild-type rice (Oryza sativa) as a template, ugt91c1-F and ugt91c1-R as primers, and high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) PCR amplification was performed to obtain the correct coding gene fragment of the mutant 2-12E.

[0040] ugt91c1-F (SEQ ID NO.4):

[0041] GCTAACAGGAGGAATTAACCATGGACTCCGGCTACTCCTC

[0042] ugt91c1-R (SEQ ID NO.5):

[0043] TCTCCTTGGTAGTTGAGGACTTTCAATCCTTGTAAGATCT

[0044] Using the cDNA of the coding gene sequence of the mutant 101H10 of the glycosyltransferase UGT76G1 from wild-type rice (Oryza sativa) as a template, ugt76g1-F and ugt76g1-R as primers, and high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) was used for PCR amplification to obtain the correct coding gene fragment of the mutant 101H10.

[0045] ugt76g1-F (SEQ ID NO.6):

[0046] GTCCTCAACTACCAAGGAGAAAACAATGGCCGAAAATAAAACG

[0047] ugt76g1-R (SEQ ID NO.7):

[0048] TCCTCCTCTTCCTGCGTTTGACGTATGTTTACAACGATGAAATGTAAG

[0049] The cDNA of the nucleotide sequence of the sucrose synthase gene from Arabidopsis thaliana was used as a template, atsus-F and atsus-R were used as primers, and PCR amplification was performed using a high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct sucrose synthase gene fragment.

[0050] atsus-F (SEQ ID NO.8):

[0051] AAACGCAGGAAGAGGAGGAAATAATGGCAAACGCTGAACGTA

[0052] atsus-R (SEQ ID NO.9):

[0053] GTACCAGATCTACCCTCGAGAACCCAAAGGCTTCATATAATGCAGG

[0054] Example 2

[0055] Construction of recombinant plasmid and recombinant Escherichia coli expressing three enzymes

[0056] Construction of recombinant plasmid for co-expression of three enzymes

[0057] Using PYB1s-F and PYB1s-R as primers and PYB1s empty vector as template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct PYB1s expression vector fragment. (Qun Liu, Baixue Lin, Yong Tao. Improved methylation in E. coli via an efficient methylsupply system driven by betaine. Metabolic Engineering, Volume 72, 2022, 46-55, published this vector.)

[0058] PYB1s-F(SEQ ID NO.10):CTCGAGGGTAGATCTGGTAC

[0059] PYB1s-R(SEQ ID NO.11):GGTTAATTCCTCCTGTTAGC

[0060] The coding genes of mutant 2-12E, mutant 101H10 and sucrose synthase were connected to the expression vector PYB1s by Gibson assembly method to obtain recombinant plasmids.

[0061] The composition of the LB solid medium in this embodiment is as follows:

[0062] NaCl 10g / L, yeast powder 5g / L, peptone 10g / L, agar powder 15g / L.

[0063] E. coli DH5α competent cells were prepared by the CaCl2 method (Beijing Quanshijin Biotechnology Co., Ltd.). The Gibson ligation product in the above step was added to the E. coli DH5α competent cells, reacted on ice for 30 minutes, then reacted in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes, followed by adding 1 mL of LB liquid culture medium (NaCl 10g / L, yeast powder 5g / L, peptone 10g / L), and placed on a 37°C shaker for 1 hour to recover, and finally the E. coli was spread on an LB plate containing 50 mg / L streptomycin sulfate and cultured at 37°C overnight.

[0064] Several monoclonal bacterial cells were selected for culture, and the monoclonal plasmids were extracted and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing verification. The recombinant plasmid with correct sequencing was named pYB1s-ugt91c1-ugt76g1-atsus.

[0065] Construction of recombinant Escherichia coli expressing three enzymes

[0066] E. coli BW25113 competent cells were prepared by the CaCl2 method, and the recombinant plasmid pYB1s-ugt91c1-ugt76g1-atsus was transferred into the E. coli BW25113 competent cells. The E. coli was then spread on LB plates containing 50 mg / L streptomycin sulfate and cultured at 37°C overnight. Positive clones containing the recombinant plasmid pYB1s-ugt91c1-ugt76g1-atsus were selected to obtain recombinant E. coli expressing the three enzymes.

[0067] Example 3

[0068] Cultivation of recombinant Escherichia coli expressing three enzymes

[0069] The composition of LB medium in this embodiment is as follows:

[0070] NaCl 10g / L, yeast powder 5g / L, peptone 10g / L, streptomycin sulfate 50mg / L.

[0071] The three-enzyme co-expressing recombinant E. coli colony in Example 2 was picked up with a high-temperature and high-pressure sterilized toothpick, inoculated into 5 mL of LB medium, and cultured on a shaker at 37° C. and 200 rpm for 12 h to obtain a seed solution.

[0072] Use an inoculation needle to dip the seed solution and inoculate it into another 500 mL LB medium at a 1 v / v% inoculation rate. Cultivate with shaking at 37°C and 200 rpm. When the OD of the culture solution reaches 600 =0.6, the temperature was lowered to 25°C, arabinose was added at a final concentration of 2 g / L, and the induction culture was continued for 18 h at 25°C and 220 rpm in a shaker.

[0073] After the induction culture, the recombinant Escherichia coli cells expressing the three enzymes were collected by centrifugation at 4000×g for 15 min, and the cells were resuspended in 20 mL of sodium phosphate buffer. The cells were disrupted by 260W ultrasound for 30 min to release the intracellular enzymes. After the disruption, the cells were centrifuged at 8000×g for 10 min at 4°C in a refrigerated centrifuge, and the supernatant was collected as the crude enzyme solution.

[0074] Test Example 1:

[0075] Reaction system: rebaudioside A with a final concentration of 25 mM, sucrose with a final concentration of 300 mM, UDPG with a final concentration of 1.5 mM, 10 mL of the crude enzyme solution in Example 3, and finally supplemented with 100 mM, pH = 7.0 sodium phosphate buffer to a total system of 50 mL.

[0076] After 6 hours of reaction in a water bath at 37°C, the reaction was terminated by inactivating the enzyme in a boiling water bath for 5 minutes and dissolving the reaction product. The content of the conversion product rebaudioside M (RM) was 21.4 mM and the residual content of rebaudioside A (RA) was 1.2 mM by HPLC. The yield of the product RM was calculated to be 85.6% and the conversion rate of RA was 95.2%.

[0077] Test Example 2

[0078] In order to be closer to industrial production, the three-enzyme co-expression recombinant strain in Example 2 was fermented at a high density in a 5L fermenter to obtain a fermentation broth. The fermentation curve of the bacteria in the fermenter is shown in FIG. Figure 1 shown.

[0079] The specific fermentation process is as follows:

[0080] A TB fermentation medium (4 mL / L glycerol, 24 g / L yeast extract, 12 g / L tryptone, and a phosphate buffer system consisting of 72 mmol / L K2HPO4 and 17 mmol / L KH2PO4) was prepared in a 5 L fermentor and sterilized. The seed solution in Example 3 was inoculated into the TB fermentation medium at an inoculation amount of 1% of the volume of the fermentation medium. Fermentation was performed at 37° C. The fermentor ventilation pressure was 0.02 MPa, the stirring speed could be controlled at 300 to 1000 rpm, and the stirring speed in this example was 600 rpm. The dissolved oxygen was maintained at 25 to 35%, and a 50 wt% glucose solution was added at a rate of 5 g / L / h. When the bacterial concentration grew to OD 600 After the temperature reached 50°C, the fermentation broth was cooled to 25°C, and arabinose with a final concentration of 2 g / L was added for induction culture. The fermentation culture was continued for 36 hours to obtain the fermentation broth.

[0081] Depend on Figure 1It can be seen that the three-enzyme co-expression recombinant strain constructed in the present application has a high cell concentration in the above-mentioned high-density fermentation process and is suitable for industrial production.

[0082] Take 2L of fermentation liquid and centrifuge it at 4000rpm and 25℃ for 15min to collect the fermentation bacteria. Resuspend the fermentation bacteria with sodium phosphate buffer to a total volume of 1L. Homogenize the resuspended fermentation bacteria cells at a homogenization pressure of 80Mpa. After homogenization twice, centrifuge at 4000rpm for 15min to collect the supernatant enzyme solution.

[0083] Test Example 3

[0084] Amplification conversion reaction system: During the conversion process, the conversion substrate rebaudioside A was added step by step, and the step-by-step addition amount was 10mM / time / 1h until the final concentration of the substrate rebaudioside A was increased to 50mM, the final concentration of sucrose was 700mM, and the final concentration of UDPG was 1.5mM. The supernatant enzyme solution in Test Example 2 was 500mL, and finally supplemented to 2000mL with 100mM, pH=7.0 sodium phosphate buffer. The amplification conversion reaction system was heated to 37°C, reacted for 24h, and the enzyme was inactivated in a boiling water bath for 5min to terminate the reaction and dissolve the reaction product.

[0085] HPLC detection showed that the content of the conversion product rebaudioside M (RM) was 41.8 mM, and the residual content of rebaudioside A (RA) was 4.1 mM. The calculated yield of the product RM was 83.6%, and the conversion rate of RA was 91.8%.

[0086] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A recombinant plasmid, characterized in that: The recombinant plasmid contains a gene encoding a glycosyltransferase UGT91C1 mutant, a gene encoding a glycosyltransferase UGT76G1 mutant, and a gene encoding a sucrose synthase; The glycosyltransferase UGT91C1 mutant is 2-12E, and its encoding gene sequence is shown in SEQ ID NO.1; The glycosyltransferase UGT76G1 mutant is 101H10, and its encoding gene sequence is shown in SEQ ID NO.2; The sequence of the gene encoding the sucrose synthase is shown in SEQ ID NO.

3.

2. A recombinant strain, characterized in that: The recombinant strain contains the recombinant plasmid according to claim 1.

3. A one-step method for synthesizing rebaudioside M, characterized in that: The following steps are involved: (1) connecting a gene encoding a glycosyltransferase UGT91C1 mutant, a gene encoding a glycosyltransferase UGT76G1 mutant, and a gene encoding a sucrose synthase to an expression vector to obtain a recombinant plasmid; (2) transferring the recombinant plasmid into a host strain to obtain a recombinant strain expressing three enzymes; (3) inoculating the three-enzyme co-expressing recombinant strain into LB medium for cultivation to obtain seed liquid; (4) Inoculate the seed solution into a new LB medium at an inoculum rate of 0.5-1.5 v / v% and shake culture until the OD value of the culture solution reaches 0.

1. 600 When the pH value is 0.6-0.8, the temperature is lowered to 20-30°C, and the inducer is added for induction culture; (5) After the induction culture is completed, the bacteria are collected, resuspended, the cells are broken, and centrifuged. The supernatant is the crude enzyme solution; (6) Add rebaudioside A, sucrose, UDPG, crude enzyme solution and sodium phosphate buffer solution to the catalytic reaction system for reaction, inactivate the enzyme in a boiling water bath and dissolve the reaction product, and centrifuge to obtain the supernatant, which is the product rebaudioside M.

4. The method according to claim 3, characterized in that The LB medium in step (3) contains 40 mg / L to 100 mg / L of streptomycin sulfate; The culture temperature in step (3) is 30-40°C, and the culture is shaken at 200-300 rpm for 12-18 hours.

5. The method according to claim 3, characterized in that: The first shaking culture in step (4) is carried out at a temperature of 35 to 40° C. and a temperature of 200 to 300 rpm; The LB culture medium in step (4) contains 40 mg / L to 100 mg / L of streptomycin sulfate.

6. The method according to claim 3, characterized in that The inducer in step (4) is arabinose, the final concentration of the inducer in the LB medium is 2-5 g / L, the induction culture temperature is 20-30° C., and the shaking culture is carried out at 200-300 rpm for 16-24 hours.

7. The method according to claim 3, characterized in that The catalytic reaction system contains 25-50 mM rebaudioside A, 300-700 mM sucrose, 1-2 mM UDPG, 10-500 mL crude enzyme solution and 50-100 mM sodium phosphate buffer solution.

8. The method according to claim 3, characterized in that During the catalytic reaction, the reaction temperature is 30-40°C, the pH is 7-8, and the reaction time is 6-48h.

9. The method according to claim 3, characterized in that: The expression vector is PYB1s.

10. The method according to claim 3, characterized in that: The host strain includes but is not limited to Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris or Corynebacterium glutamicum.

Images