Gene PTBP1 for mycoplasma gallisepticum infection resistance and application thereof

Abstract

The invention discloses a gene PTBP1 for resisting infection of mycoplasma gallisepticum and application of the gene PTBP1, belongs to the technical field of gene engineering, and provides a gene PTBP1 related to mycoplasma gallisepticum and application of the gene PTBP1 in resisting chicken chronic respiratory diseases. The PTBP1 gene is over-expressed in chicken alveolar type II epithelial cells (AT-II), so that cell autophagy can be effectively activated, and the infection resistance of the mycoplasma gallisepticum can be improved. The infection of mycoplasma gallisepticum is inhibited; the expression of the PTBP1 gene is knocked down, so that the infection of mycoplasma gallisepticum can be effectively enhanced; the method can be applied to research and development of anti-mycoplasma gallisepticum drugs, mycoplasma infection mechanism research and chicken disease resistance breeding research.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and relates to an application of a molecular marker and a detection method thereof in resistance to Mycoplasma gallisepticum infection, and specifically uses the method of the invention to detect the expression level of chicken PTBP1 for screening chickens resistant to Mycoplasma gallisepticum infection. Background Art

[0002] Mycoplasma gallisepticum (MG) is the main pathogen that causes chronic respiratory disease (CRD) in chickens. It can be transmitted horizontally and vertically, and chickens of different ages, genders and breeds can be infected all year round. Once MG enters a chicken farm, it can spread for a long time and is difficult to eradicate. MG infection can cause a decrease in egg production in laying hens, a decrease in weight in broilers, an increase in the rate of weak chicks and mortality, and is a predisposing factor for infection by other pathogenic microorganisms, which is more harmful and brings huge economic losses to the poultry industry.

[0003] At present, the main measures to control CRD are vaccination and long-term use of antibiotics, but they cannot fundamentally solve the problem. For example, vaccines have limitations in providing protection, and frequent use of certain types of vaccines may increase the pathogenicity of mycoplasma. The large-scale use of antibiotics will cause food safety problems and bacterial resistance, and increase the resistance of strains, which greatly threatens the healthy development of the poultry industry. With the development of molecular genetics, the excavation of animal disease-resistant genes and the elucidation of their functions provide a scientific basis for the breeding of disease-resistant varieties.

[0004] Polypyrimidine Tract Binding Protein 1 (PTBP1), a member of the hnRNP family, also known as hnRNP1, plays an important role in the selective splicing of pre-mRNA and RNA metabolism. PTBP1 is widely expressed in various tissues and binds to a variety of downstream transcripts, participating in the regulation of biological processes such as apoptosis, cell differentiation, cell metabolism, immune response and drug resistance, and plays an important regulatory role in various diseases.

[0005] The present invention finds that overexpression of the PTBP1 gene in chicken alveolar type II epithelial cells (AT-II) can effectively inhibit the proliferation of Mycoplasma gallisepticum and improve the clearance ability of chicken alveolar type II epithelial cells to Mycoplasma gallisepticum. Further study of its function will lay a theoretical foundation for disease-resistant breeding.

[0006] References

[0007] 1.Arake de Tacca LM,Pulos-Holmes MC,Floor SN,Cate JHD.PTBP1 mRNAisoforms and regulation of their translation.RNA(New York,N.Y.),2019,25:1324-1336.

[0008] 2.Wang J,Ishfaq M,Li J.Baicalin ameliorates Mycoplasma gallisepticum-induced inflammatory injury in the chicken lung through regulating theintestinal microbiota and phenylalanine metabolism.Food&function,2021a,12:4092-4104.

[0009] 3.Whithear KG,Soeripto,Harrigan KE,Ghiocas E.Immunogenicity of atemperature sensitive mutant Mycoplasma gallisepticum vaccine.Australianveterinary journal,1990,67:168-174.

[0010] 4.Yu Q,Wu T,Xu W,Wei J,Zhao A,Wang M,Li M,Chi G.PTBP1 as a potentialregulator of disease.Molecular and cellular biochemistry,2023.

[0011] 5. Zhou J, Zhou J, Wu LJ, Li YY, Li MQ, Liao HQ. CircRNA circUSP36 impairs the stability of NEDD4L mRNA through recruiting PTBP1 to enhance ULK1-mediated autophagic granulosa cell death. Journal of reproductive immunology, 2022, 153: 103681. Summary of the invention

[0012] The purpose of the present invention is to provide a molecular marker PTBP1 for Mycoplasma gallisepticum infection resistance traits and a detection method thereof.

[0013] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0014] In the first aspect, the present invention claims protection for the use of the PTBP1 gene having the nucleotide sequence as shown in SEQ ID NO.1 in (1) or (2) or (3) or (4):

[0015] (1) Improve the ability of chicken alveolar type II epithelial cells to clear Mycoplasma gallisepticum;

[0016] (2) Improve the resistance of chickens to Mycoplasma gallisepticum;

[0017] (3) Improve chickens’ resistance to chronic respiratory diseases;

[0018] (4) Cultivate new disease-resistant chicken breeds with improved resistance to chronic respiratory diseases.

[0019] In a second aspect, the present invention seeks to protect the use of the biological material containing the above-mentioned PTBP1 gene in (1) or (2) or (3) or (4):

[0020] (1) Improve the ability of chicken alveolar type II epithelial cells to clear Mycoplasma gallisepticum;

[0021] (2) Improve the resistance of chickens to Mycoplasma gallisepticum;

[0022] (3) Improve chickens’ resistance to chronic respiratory diseases;

[0023] (4) Cultivate new disease-resistant chicken breeds with improved resistance to chronic respiratory diseases.

[0024] The biological material is recombinant DNA, expression box, transposon, plasmid vector, phage vector, engineering bacteria or transgenic cell line.

[0025] Furthermore, the above application is that overexpressing the PTBP1 gene in chicken alveolar type II epithelial cells can activate cell autophagy and enhance the clearance ability of chicken alveolar type II epithelial cells to Mycoplasma gallisepticum; knocking down the PTBP1 gene can reduce the clearance ability of chicken alveolar type II epithelial cells to Mycoplasma gallisepticum;

[0026] Furthermore, the process of overexpressing the PTBP1 gene in chicken alveolar type II epithelial cells is to insert the PTBP1 gene into the expression vector pcDNA3.1 to construct the overexpression vector pcDNA3.1-PTBP1 of the PTBP1 gene; transfecting the constructed overexpression vector peDNA3.1-PTBP1 into chicken alveolar type II epithelial cells to obtain chicken alveolar type II epithelial cells overexpressing the PTBP1 gene; the process of knocking down the PTBP1 gene in chicken alveolar type II epithelial cells is achieved by introducing PTBP1 siRNA into the host cells or animals; the nucleotide sequence of the PTBP1 siRNA is shown in SEQ ID No.2.

[0027] In a specific embodiment of the present invention, the PTBP1 gene is inserted into the expression vector pcDNA3.1 using the 5'EcoRI-3'XhoI double restriction enzyme system.

[0028] The present invention includes but is not limited to the following beneficial effects:

[0029] The present invention finds that overexpressing the PTBP1 gene in chicken alveolar type II epithelial cells and upregulating the expression of the PTBP1 gene can inhibit the proliferation of Mycoplasma gallisepticum and thus inhibit the infection of Mycoplasma gallisepticum, and enhance the clearance ability of chicken alveolar type II epithelial cells on Mycoplasma gallisepticum; knocking down the PTBP1 gene and downregulating the expression of the PTBP1 gene can effectively enhance the proliferation of Mycoplasma gallisepticum and thus enhance the infection of Mycoplasma gallisepticum, and can reduce the clearance ability of chicken alveolar type II epithelial cells on Mycoplasma gallisepticum. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This figure shows the results of using Western Blot technology to detect that in chicken alveolar type II epithelial cells infected with Mycoplasma gallisepticum, the PTBP1 protein content gradually decreased with the increase of infection time.

[0031] Figure 2 This is a diagram showing the result of upregulating PTBP1 gene expression by transfecting the overexpression vector pcDNA3.1-PTBP1 into chicken alveolar type II epithelial cells.

[0032] Figure 3 This is the result of detecting intracellular autophagosomes using laser scanning confocal microscopy after cells were treated with overexpression of PTBP1.

[0033] Figure 4 To detect autophagy genes in cells overexpressing PTBP1 using Western Blot technology.

[0034] Figure 5 This is the result of using fluorescence quantitative PCR technology to detect the copy number of Mycoplasma gallisepticum in the PTBP1 gene overexpression group and the control group.

[0035] Figure 6 This is the result of using small RNA interference technology to inhibit the expression of PTBP1 gene in chicken alveolar type II epithelial cells.

[0036] Figure 7 This is the result of using fluorescent quantitative PCR technology to detect the copy number of Mycoplasma gallisepticum in the PTBP1 gene expression inhibition group and the control group. DETAILED DESCRIPTION

[0037] 1. The technical solution of the present invention is further described in detail below in conjunction with the embodiments and related drawings. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention.

[0038] 2. The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent companies or are conventional biological materials known to those skilled in the art unless otherwise specified.

[0039] 3. Experimental Materials

[0040] The pcDNA3.1 vector was purchased from Invitrogen, the MG strain and chicken alveolar type II epithelial cells were provided by the State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan, China, and the PTBP1 interference vector was purchased from Suzhou Genema Co., Ltd.

[0041] 4. Example 1: Construction of overexpression vector of PTBP1 gene. The process comprises the following steps:

[0042] The pcDNA3.1-PTBP1-F (5'-GCACAGTGGCGGCCGCTCGAGATGAGCAGCAACGCTTCTT and pcDNA3.1-PTBP1-R (5'-GTTIAAACGGGCCCTCTAGACTCGAGTTAAATGGTGGACTTCGAGAAGGA-3') were designed to amplify the full-length chicken PTBP1 gene. The full-length CDS sequence of the chicken PTBP1 gene was amplified from AECH cells by PCR amplification. The PCR product was connected to the pcDNA3.1 vector treated with EcoRI restriction endonuclease by gel recovery and homologous recombination to construct the pcDNA3.1-PTBP1 vector. The recombinant plasmid was then transformed into Escherichia coli DH5α competent cells, and a single colony was picked and inoculated into LB liquid culture medium containing ampicillin and cultured at 37°C with shaking. After Sanger sequencing was correct, the plasmid was extracted using an endotoxin-free plasmid extraction kit.

[0043] 5. Example 2: PTBP1 gene activates autophagy in cells infected with Mycoplasma gallisepticum

[0044] (1) Preparation of AECII overexpressing PTBP1 gene

[0045] When the cell density reaches 50%-60% and the cells are in good condition, transfection is performed. Taking a 6-well plate as an example, the transfection steps are as follows:

[0046] ① 1 hour before transfection, aspirate the cell culture medium, wash the cells twice with PBS without double antibody, aspirate the PBS, and add 2 mL Reduced Serum Medium;

[0047] ②Pipette 1.5μL LipofectamineTM 2000 and mix it with 50μL Reduced Serum Medium;

[0048] ③Pipette 2500ng PTBP1-pcDNA3.1 and mix into 50μL Reduced Serum Medium, let stand at room temperature for 5 minutes;

[0049] ④ Mix the mixture of (2) and (3) and let it stand at room temperature for 20 minutes to form a complex;

[0050] ⑤ Pipette 100 μL of the mixture into the prepared cells, gently shake the cell culture plate to mix evenly, and replace the complete culture medium (containing 1% double antibody) 4-6 hours after transfection;

[0051] ⑥ Culture in a cell culture incubator at 37°C and 5% CO2 for 24-72 hours;

[0052] (2) Detection of autophagy activation level in cells

[0053] The above cells were treated with mCheery-EGFP-LC3 lentiviral vector. Before infection, the virus was taken out of the refrigerator and slowly thawed on ice, the original culture medium of the cells was aspirated, 1 / 2 volume of fresh culture medium was added, and the virus was added and gently mixed according to the MOI value = 50 for infection. The culture volume was replenished to the full culture volume 4 hours after infection. 8-16 hours after infection, the culture medium containing the virus was aspirated, replaced with fresh complete culture medium, and continued to be cultured at 37°C. The principle of this method is based on the different pH stability of green and red fluorescent proteins. The fluorescence signal of EGFP can be quenched under acidic conditions (pH < 5) inside the lysosome, and the fluorescence signal of mCherry has no obvious change under acidic conditions. In the green and red fused images, autophagosomes appear as yellow dots (i.e., mCherry+GFP+), while autophagic lysosomes appear as red dots (i.e., mCherry+GFP-). When both yellow and red dots in the cell increase, the autophagic flow increases; when the yellow dots in the cell increase and the red dots do not change, the autophagic flow is blocked. Finally, the number of yellow spots and red spots after overlay was counted to measure the autophagy flow.

[0054] The experimental results are shown in the figure. After transfection with plasmid pcDNA3.1-PTBP1, the PTBP1 gene content in cells was upregulated ( Figure 2 After Mycoplasma gallisepticum infected AECII cells, the autophagic flow in the cells was blocked, and a large amount of LC3 red and green fluorescence coexisted to form a yellow fluorescence signal. After overexpression of the PTBP1 gene, the yellow fluorescence of the autophagosome caused by Mycoplasma gallisepticum infection was significantly reduced ( Figure 3 ). Western blot results showed that overexpression of PTBP1 gene promoted LC3 II expression and p62 degradation, and activated the autophagy process ( Figure 4 ).

[0055] 6. Example 3: PTBP1 gene enhances resistance to Mycoplasma gallisepticum

[0056] (1) Steps to inhibit PTBP1 gene:

[0057] The siRNA sequence of the chicken PTBP1 gene was designed to knock down its expression, and the sequence was F-CCAACCACAAGGAGCUUAATT, R-UUAAGCUCCUUGUGGUUGGTT. Meanwhile, the meaningless nucleotide sequence was used as a negative control (NC), and the sequence was F-GCAAUGGUGGGAUGGUCAATT, R-UUCUCCGAACGUGUCACGUTT.

[0058] When the cell density reaches 50%-60% and the cells are in good condition, transfection is performed. Taking a 6-well plate as an example, the transfection steps are as follows:

[0059] ① 1 hour before transfection, aspirate the cell culture medium, wash the cells twice with PBS without double antibody, aspirate PBS, and add 2 mL Reduced Serum Medium;

[0060] ②Pipette 1.5μL LipofectamineTM 2000 and mix it with 50μL Reduced Serum Medium;

[0061] ③Pipette 1.25μl siRNA (20μM / L storage solution) and si-PTBP1 and mix to 50μL Reduced Serum Medium, let stand at room temperature for 5 minutes;

[0062] ④ Mix the mixture of (2) and (3) and let it stand at room temperature for 20 minutes to form a complex;

[0063] ⑤ Pipette 100 μL of the mixture into the prepared cells, gently shake the cell culture plate to mix evenly, and replace the complete culture medium (containing 1% double antibody) 4-6 hours after transfection;

[0064] ⑥ Culture in a cell culture incubator at 37°C and 5% CO2 for 24-72 hours;

[0065] (2) After overexpressing or inhibiting the PTBP1 gene, the number of mycoplasma copies in the cells was detected.

[0066] According to the sequence of MG 16S rRNA published by NCBI, primers were designed for its highly conserved region. The primer sequences are as follows:

[0067] ①16S rRNA-F AGCTAATCTGTAAAGTTGGTC

[0068] ②16S rRNA-R CGCTTCCTTGCGGTTAGCAAC

[0069] ③ DNA was extracted by phenol-chloroform extraction, the target product was recovered by gel, and the PCR product and pMD-18T vector were connected by TA cloning connection. The connected plasmid was then transformed into Escherichia coli DH5α competent cells, and a single colony was picked and inoculated in LB liquid culture medium containing ampicillin, and cultured at 37°C with shaking. After Sanger sequencing was correct, the plasmid was extracted using an endotoxin-free plasmid extraction kit. The concentration of the recombinant plasmid was determined by ultra-micro spectrophotometer Nanodrop 2000, and the plasmid concentration was converted to molecular copy number according to the molecular mass and Avogadro constant. The recombinant plasmid was diluted to the original concentration and placed at -80°C for standby use. Then a 10-fold gradient dilution was performed to prepare a standard. These standards were used as templates, and negative controls were set, and fluorescent quantitative PCR was performed using the optimized optimal conditions. The Ct values ​​of different template concentrations were obtained, the Ct values ​​were recorded, and the standard curve was drawn.

[0070] ④Molecular copy number = DNA mass concentration / DNA molecular weight

[0071] ⑤DNA molecular weight = number of DNA bases × 324.5

[0072] ⑥DNA mass concentration = absorbance at 260nm

[0073] The experimental results are as follows Figure 5 As shown in Figure 2, upregulation of PTBP1 gene content led to a decrease in the copy number of mycoplasma, while inhibition of PTBP1 had the opposite effect ( Figure 6 ).

[0074] In summary, the present invention takes chicken alveolar type II epithelial cells as an example, and overexpressing the PTBP1 gene in AECII can significantly activate cell autophagy, enhance the clearance ability of chicken alveolar type II epithelial cells against Mycoplasma gallisepticum, and inhibit the proliferation and infection of Mycoplasma gallisepticum. It shows that the PTBP1 gene of the present invention can be used to prepare drugs for resisting Mycoplasma gallisepticum infection.

[0075] SEQ ID NO.1

[0076] PTBP1 gene nucleotide sequence:

[0077]

[0078]

[0079] SEQ ID No.2

[0080] Nucleotide sequence of PTBP1 siRNA:

[0081] Si-PTBP1F(5′-CCAACCACAAGGAGCUUAATT-3′)

[0082] Si-PTBP1 R(5′-UUAAGCCUUGUGGUUGGTT-3′)

Claims

1. Use of the PTBP1 gene having the nucleotide sequence shown in SEQ ID NO.1 in (1) or (2) or (3) or (4): (1) Improve the ability of chicken alveolar type II epithelial cells to clear Mycoplasma gallisepticum; (2) Improve the resistance of chickens to Mycoplasma gallisepticum; (3) Improve chickens’ resistance to chronic respiratory diseases; (4) Cultivate new disease-resistant chicken breeds with improved resistance to chronic respiratory diseases.

2. Use of the biological material containing the PTBP1 gene of claim 1 in (1) or (2) or (3) or (4): (1) Improve the ability of chicken alveolar type II epithelial cells to clear Mycoplasma gallisepticum; (2) Improve the resistance of chickens to Mycoplasma gallisepticum; (3) Improve chickens’ resistance to chronic respiratory diseases; (4) Cultivate new disease-resistant chicken breeds with improved resistance to chronic respiratory diseases.

3. The use according to claim 2, characterized in that: The biological material is recombinant DNA, expression box, transposon, plasmid vector, phage vector, engineering bacteria or transgenic cell line.

4. The use according to claim 1 or 2, characterized in that: Overexpression of the PTBP1 gene in chicken alveolar type II epithelial cells can activate cell autophagy and thereby enhance the clearance ability of chicken alveolar type II epithelial cells to Mycoplasma gallisepticum; knocking down the PTBP1 gene can reduce the clearance ability of chicken alveolar type II epithelial cells to Mycoplasma gallisepticum.

5. The use according to claim 4, characterized in that: The process of overexpressing the PTBP1 gene in chicken alveolar type II epithelial cells is as follows: inserting the PTBP1 gene into the expression vector pcDNA3.1 to construct an overexpression vector pcDNA3.1-PTBP1 of the PTBP1 gene; and transfecting the constructed overexpression vector pcDNA3.1-PTBP1 into chicken alveolar type II epithelial cells to obtain chicken alveolar type II epithelial cells overexpressing the PTBP1 gene.

6. The use according to claim 4, characterized in that: Reducing the expression of PTBP1 in the host cell is achieved by introducing PTBP1 siRNA into the host cell or animal; the nucleotide sequence of the PTBP1 siRNA is shown in SEQ ID No.2.

Images