Nucleic acid sequences and methods for detecting goss' wilt of corn

Abstract

The application belongs to the field of corn molecular breeding and biotechnology, and particularly relates to a nucleic acid sequence for detecting corn stalk rot and a detection method. The application can be used for detecting the polymorphism or genotype of SNP1 and SNP2 in the corn genome, and identifying corn stalk rot. The SNP1 is the 200th nucleotide of SEQ ID No. 7, which is A or G; and the SNP2 is the 202th nucleotide of SEQ ID No. 8, which is A or G. The application can be used for breeding corn germplasm resistant to stalk rot, and also can be used for high-throughput and accurate identification of the genotype of the corn material to be detected, and screening of the material resistant to stalk rot.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of corn molecular breeding and biotechnology, and particularly relates to a nucleic acid sequence for detecting corn stalk rot and a detection method. BACKGROUND

[0002] Corn (Zea mays L.) is a major food and feed crop in China, and is also an important industrial raw material and energy plant, playing a vital role in the national economy and agricultural production. Corn stalk rot is a global soil-borne disease that seriously harms corn production, mainly causing early decline of plants, insufficient grain filling, and yield reduction. The diseased plants are prone to stalk lodging, which restricts the mechanized harvesting of corn in China. The dominant pathogenic bacteria causing corn stalk rot in China are Fusarium graminearum and Pythium inflatum. Cultivating and promoting stalk rot-resistant varieties is the most economical and effective control approach.

[0003] Due to the great influence of pathogenic bacteria, environment, and genotype on stalk rot, and the difficulty in finding high and multi-resistant sources, corn stalk rot is becoming more and more serious. At present, most of the located resistance sites have low effects, and few disease-resistant genes have been cloned. Further in-depth exploration of corn stalk rot resistance QTL and disease-resistant genes, and development of molecular markers closely linked to QTL, will provide strong support for the aggregation of multiple resistance genes in stalk rot-resistant molecular breeding, and are expected to improve the resistance of corn to stalk rot. KASP markers do not need to be typed according to the size of DNA fragments, and can get rid of the traditional gel electrophoresis method which is relatively cumbersome, low-throughput, and expensive, and is more suitable for the high-throughput molecular detection platform currently rapidly developing. Therefore, the development of low-cost KASP molecular markers for corn resistance to Fusarium graminearum stalk rot QTL suitable for high-throughput molecular detection platform is of great significance for popularizing the application of molecular marker technology and improving the efficiency and level of corn breeding for stalk rot resistance in China. SUMMARY

[0004] The technical problem to be solved by the present application is how to identify or assist in identifying corn stalk rot resistance or how to carry out corn breeding. The technical problem to be solved is not limited to the technical subject described, and other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.

[0005] To solve the above technical problems, the present application provides the following technical solutions:

[0006] The present application provides any one of the following applications of a substance for detecting the polymorphism or genotype of a SNP site in the corn genome, A1) identifying or assisting in identifying corn stalk rot resistance;

[0007] A2) screening or breeding a corn line or strain or variety resistant to stalk rot;

[0008] A3) screening or breeding a corn line or strain or variety susceptible to stalk rot;

[0009] A4) corn breeding;

[0010] A5) preparing a product for identifying or aiding in identifying corn resistance to stalk rot;

[0011] A6) preparing a product for screening or breeding a corn line or strain or variety resistant to stalk rot;

[0012] A7) preparing a product for screening or breeding a corn line or strain or variety susceptible to stalk rot;

[0013] A8) preparing a product for corn breeding;

[0014] The SNP site is any one of the following:

[0015] P1, the SNP site is SNP1 site and SNP2 site, the SNP1 site is a SNP of the corn genome, which is the 50th nucleotide of SEQ ID No. 9 in the sequence listing, which is A or G; the SNP2 site is a SNP of the corn genome, which is the 50th nucleotide of SEQ ID No. 16 in the sequence listing, which is A or G;

[0016] P2, the SNP site is the SNP1 site;

[0017] P3, the SNP site is the SNP2 site.

[0018] The SNP1 is located on the 5th chromosome of corn, that is, the 178607304th position of B73 RefGen_V3( https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3 ) and is also called Ks7 hereinafter; the SNP2 is located on the 5th chromosome of corn, that is, the 182486805th position of B73 RefGen_V3( https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3 ) and is also called Ks8.1 hereinafter.

[0019] The skilled in the art know that SEQ ID No. 7 is composed of the nucleotide sequence of SNP1 site (the 200th nucleotide of SEQ ID No. 7) and the nucleotide sequence near the SNP site, and the number of the nucleotide sequence near the SNP site should not be regarded as a limitation of the protection scope of the present application, which can be 49bp (SEQ ID No. 9), 59bp (SEQ ID No. 10), 69bp (SEQ ID No. 11), 79bp (SEQ ID No. 12), 89bp (SEQ ID No. 13), 99bp (SEQ ID No. 14), 149bp (SEQ ID No. 15), 250bp, 300bp, 500bp, 1000bp before and after the SNP site, or other arbitrary values, which are used to assist in locating the position of the SNP on chromosome 5 of the corn genome. SEQ ID No. 8 is composed of the nucleotide sequence of SNP1 site (the 202th nucleotide of SEQ ID No. 8) and the nucleotide sequence near the SNP site, and the number of the nucleotide sequence near the SNP site should not be regarded as a limitation of the protection scope of the present application, which can be 49bp (SEQ ID No. 16), 59bp (SEQ ID No. 17), 69bp (SEQ ID No. 18), 79bp (SEQ ID No. 19), 89bp (SEQ ID No. 20), 99bp (SEQ ID No. 21), 149bp (SEQ ID No. 22), 250bp, 300bp, 500bp, 1000bp before and after the SNP site, or other arbitrary values, which are used to assist in locating the position of the SNP on chromosome 5 of the corn genome.

[0020] Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 60 of the sequence shown in SEQ ID No. 10; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 60 of the sequence shown in SEQ ID No. 17. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 70 of the sequence shown in SEQ ID No. 11; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 70 of the sequence shown in SEQ ID No. 18. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 80 of the sequence shown in SEQ ID No. 12; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 80 of the sequence shown in SEQ ID No. 19. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 90 of the sequence shown in SEQ ID No. 13; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 90 of the sequence shown in SEQ ID No. 20. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 100 of the sequence shown in SEQ ID No. 14; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 100 of the sequence shown in SEQ ID No. 21. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 150 of the sequence shown in SEQ ID No. 15; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 150 of the sequence shown in SEQ ID No. 22. Further, the molecular marker Ks7 is a nucleotide sequence containing a polymorphism of A / G at position 200 of the sequence shown in SEQ ID No. 7; the molecular marker Ks8.1 is a nucleotide sequence containing a polymorphism of A / G at position 202 of the sequence shown in SEQ ID No. 8.

[0021] The terms "before" and "after" are intended to be defined in the direction recognized by those skilled in the art, such as the 5'-3' direction.

[0022] The above-mentioned identifying or assisting in identifying corn stalk rot, or screening or selecting corn lines or strains or varieties resistant to stalk rot, specifically includes screening corn plants with SNP site Ks7 genotype GG and SNP site Ks8.1 genotype AA. The above-mentioned screening or selecting corn lines or strains or varieties resistant to stalk rot, specifically includes screening corn plants with SNP site Ks7 genotype AA and SNP site Ks8.1 genotype GG or SNP site Ks7 genotype AA or SNP site Ks8.1 genotype GG.

[0023] The present application also provides a method for identifying or assisting in identifying corn stalk rot resistance, which is any one of the following:

[0024] M1, the method comprises detecting the genotypes of SNP1 site and SNP2 site in the genome of the corn to be tested, and identifying or assisting in identifying the corn stalk rot resistance according to the genotypes, wherein the SNP1 site is a site on chromosome 5 of corn, the nucleotide species of which is A or G, which is the 50th nucleotide of SEQ ID No. 9 in the sequence listing; and the SNP2 site is a site on chromosome 5 of corn, the nucleotide species of which is A or G, which is the 50th nucleotide of SEQ ID No. 16 in the sequence listing.

[0025] M2, the method comprises detecting the genotype of the SNP1 site in the genome of the corn to be tested, and identifying or assisting in identifying the corn stalk rot resistance according to the genotype.

[0026] In the above-mentioned M1 method, the corn stalk rot resistance of the corn to be tested with the genotype AAGG of the SNP site is higher than that of the corn to be tested with the genotype GGGG or GGAA of the SNP site, and the corn to be tested with the genotype GGGG of the SNP site has higher stalk rot resistance than the corn to be tested with the genotype GGAA of the SNP site; the genotype AAGG of the SNP site is the homozygous type of SNP1 site A and the homozygous type of SNP2 site G, the genotype GGGG of the SNP site is the homozygous type of SNP1 site G and the homozygous type of SNP2 site G, and the genotype GGAA of the SNP site is the homozygous type of SNP1 site G and the homozygous type of SNP2 site A.

[0027] The present application also provides a method for breeding corn, which comprises detecting the genotype of the aforementioned SNP site in the genome of corn, and selecting corn with the genotype AAGG of the SNP site as the parent for breeding, wherein AAGG is the homozygous type of SNP1 site A and the homozygous type of SNP2 site G.

[0028] The breeding purpose of the method includes selecting corn with resistance to stalk rot.

[0029] In the above application or / and method, the substance for detecting the polymorphism or genotype of SNP1 and SNP2 can be determined by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment length polymorphism, single strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. The SNP chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele specific primer extension reaction, chip based on "one-step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.

[0030] The application also provides the above-mentioned substance or the above-mentioned method in corn breeding.

[0031] The application also provides a product for detecting the polymorphism or genotype of SNP site in corn genome, which is the above-mentioned substance, and is any one of the following:

[0032] C1) a product for detecting single nucleotide polymorphism or genotype related to corn stalk rot resistance;

[0033] C2) a product for identifying or assisting in identifying corn stalk rot resistance;

[0034] C3) a product for corn breeding;

[0035] C4) a product for screening or selecting corn lines or strains or varieties resistant to corn stalk rot;

[0036] C5) a product for screening or selecting corn lines or strains or varieties susceptible to corn stalk rot.

[0037] In the above product, the substance is as follows D1), D2) or D3):

[0038] D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site;

[0039] D2) the substance is a PCR reagent containing the primer composition of D1);

[0040] D3) the substance is a kit containing the primer composition of D1) or the PCR reagent of D2).

[0041] In the above applications and methods, the PCR primers can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as32P; binding moieties such as biotin; haptens such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with nucleic acid or protein sequences, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly without a label (e.g., the sequence is read directly).

[0042] In the above applications and methods, the product can be a reagent or a kit or a system, which can include a combination of reagents or kits, instruments, and analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, a microplate reader, and online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), a combination product consisting of PCR primers, PARMS master mix reagents, online software SNP decoder, and a real-time PCR instrument. The product can include the above-described substances for detecting the polymorphism or genotype of SNP1, SNP2, and / or SNP3 sites in the corn genome.

[0043] In the above applications or products, the primer composition is F1-1, F1-2, F2-1, and / or F2-2:

[0044] F1-1, a primer set consisting of a single-stranded DNA represented by SEQ ID No. 1 in the sequence listing, a single-stranded DNA represented by SEQ ID No. 2 in the sequence listing, and a single-stranded DNA represented by SEQ ID No. 3 in the sequence listing;

[0045] F1-2, a primer set consisting of a single-stranded DNA in which the nucleotide sequence is from position 179 to position 200 of SEQ ID No. 7 in the sequence listing and the position 200 is A, a single-stranded DNA in which the nucleotide sequence is from position 181 to position 200 of SEQ ID No. 7 in the sequence listing and the position 200 is G, and a single-stranded DNA represented by SEQ ID No. 7 from position 228 to position 251 in the sequence listing;

[0046] F2-1, a primer set consisting of a single-stranded DNA represented by SEQ ID No. 4 in the sequence listing, a single-stranded DNA represented by SEQ ID No. 5 in the sequence listing, and a single-stranded DNA represented by SEQ ID No. 6 in the sequence listing;

[0047] F2-2, a primer set consisting of a single-stranded DNA whose nucleotide sequence is from position 178 to 202 of SEQ ID No. 8 in the sequence listing and the position 202 is A, a single-stranded DNA whose nucleotide sequence is from position 178 to 202 of SEQ ID No. 8 in the sequence listing and the position 202 is G, and a single-stranded DNA represented by SEQ ID No. 8 from position 272 to 291 in the sequence listing.

[0048] The present application also provides the use of the aforementioned product in corn breeding.

[0049] The present application also provides a DNA molecule, which is any one of the following:

[0050] N1) a DNA molecule whose nucleotide sequence is SEQ ID No. 7 in the sequence listing or from position 179 to 251 of SEQ ID No. 7 or from position 181 to 251 of SEQ ID No. 7;

[0051] N2) a DNA molecule whose nucleotide sequence is SEQ ID No. 8 in the sequence listing or from position 178 to 291 of SEQ ID No. 8;

[0052] N3) a composition consisting of N1) and N2).

[0053] The present application also provides the use of the aforementioned DNA molecule in any one of the following,

[0054] A1) identifying or assisting in identifying corn stalk rot resistance;

[0055] A2) screening or selecting a corn line or strain or variety resistant to stalk rot;

[0056] A3) screening or selecting a corn line or strain or variety susceptible to stalk rot;

[0057] A4) corn breeding;

[0058] A5) preparing a product for identifying or assisting in identifying corn stalk rot resistance;

[0059] A6) preparing a product for screening or selecting a corn line or strain or variety resistant to corn stalk rot;

[0060] A7) preparing a product for screening or selecting a corn line or strain or variety susceptible to corn stalk rot;

[0061] A8) preparing a product of corn breeding.

[0062] The SNP sites provided by the present application can be used for identifying or assisting in identifying the resistance to corn stalk rot or for corn breeding. In breeding of corns resistant to stalk rot, corns with the genotype AA at the SNP1 site and the genotype GG at the SNP2 site, or corns with the genotype AA at the SNP1 site or the genotype GG at the SNP2 site are preferably selected as parents for breeding. BRIEF DESCRIPTION OF DRAWINGS

[0063] Figure 1 QTL mapping of the stem rot disease rating of F. graminearum under the conditions of single environment and combined analysis of multiple environments; in the QTL mapping result diagram, the lines represent the QTL mapping results of the F. graminearum stem rot related traits on the 5th chromosome of corn under different environments; the X axis represents the genetic map position, in units of cM; and the Y axis represents the LOD value. In the analysis of the additive effect of the QTL, the lines represent the additive effect values of different QTLs; the X axis represents the genetic map position, in units of cM; and the Y axis represents the additive effect value, with positive and negative values representing the direction of action.

[0064] Figure 2 Effect verification and fine mapping of the target QTL; (A) QTL effect verification; (B) QTL fine mapping; (C) DSI distribution of the offspring of a heterozygous single plant. The QTL effect verification and fine mapping were performed by using the recombinant offspring verification method, and t test was used to analyze whether there was a difference in DSI between the resistant allele homozygous offspring and the susceptible allele homozygous offspring of each recombinant single plant. If there is a significant difference (P < 0.05) in DSI between the two genotypes, it is inferred that the parent recombinant individual carries the resistant gene, represented by R; on the contrary, if there is no significant difference (P > 0.05) between the two genotypes, it is inferred that the parent recombinant individual does not carry the resistant gene, represented by S. The black rectangle represents the homozygous resistant allele segment; the white rectangle represents the homozygous susceptible allele segment; and the gray rectangle represents the heterozygous allele segment. The molecular markers are the markers used in the analysis results. The column chart represents the DSI distribution of plants of different genotypes. “*” represents P < 0.05, “**” represents P < 0.01, and “***” represents P < 0.001. DETAILED DESCRIPTION

[0065] The present application will be further described in detail below in conjunction with the specific embodiments. The examples given are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.

[0066] Fusarium graminearum: recorded in the non-patent literature "Li Yaling, Long Shusheng, Ma Bingyuan. Comparison of culture characteristics of Fusarium graminearum [J]. Shaanxi Agricultural Science. 1989(4): 36-37", which can be obtained from Northwest A&F University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes. Disease-resistant parent inbred line KA105 (KA105 for short): recorded in the non-patent literature "Wang Boxin, Wang Yahui, Chen Pengfei, Liu Xudongyu, Feng Zhiquan, Hao Yinchuan, Zhang Renhe, Zhang Xinghua, Xue Jiquan. Combining ability analysis of maize inbred lines derived from Shaanxi A group and Shaanxi B group under different density conditions [J]. Crop Science. 2017, 43(9): 1328-1336", which can be obtained from Northwest A&F University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes. Disease-susceptible parent inbred line KB204 (KB204 for short): recorded in the non-patent literature "Tian Xiaokang. Evaluation and correlation analysis of disease resistance of maize inbred lines from Shaanxi A group and Shaanxi B group [D]. Northwest A&F University. 2020", which can be obtained from Northwest A&F University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes. RIL family: the F2 population is generated by crossing the disease-resistant inbred line KA105 and the disease-susceptible inbred line KB204, and the F7-8 generation is formed by single-seed descent continuous selfing to form the F 7:8 Recombinant inbred line (RIL) population, a total of 240 copies.

[0067] Population 1 (Pop. 1): including disease-resistant inbred line KA105, disease-susceptible inbred line KB204 and RIL family. The specific information is as follows:

[0068] Table 1 RIL family (240 copies)

[0069]

[0070]

[0071]

[0072] The experimental methods in the following examples are all routine methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available, unless otherwise specified. The data in the following examples are processed using Statistics Analysis System (SAS) 9.2 statistical software, and the experimental results are expressed as BLUP values. One-way ANOVA test is used, and P<0.05 (*) indicates significant difference, P<0.01 (**) and P<0.001 (***) indicate extremely significant difference.

[0073] Example 1: Establishment of a method for detecting resistance to corn stalk rot

[0074] I. Conversion of SNP markers to KASP markers and design of primer sets for detecting the markers

[0075] The two SNP markers identified in Example 3 were converted to KASP markers for use in molecular marker-assisted selection breeding. The primer sets for detecting the KASP markers based on the KASP technology are KASP primer sets, including a KASP primer pair for SNP1 and a KASP primer pair for SNP2.

[0076] The KASP primer pair of SNP1 includes two upstream primers (primer Ks7-X and primer Ks7-Y) and one downstream primer (primer Ks7-R). SNP1 is located at the 200th nucleotide of the DNA molecule shown in SEQ ID No. 7 of the sequence table in the corn genome. Primer Ks7-X is a primer with a FAM fluorescent tag sequence (5'-gaaggtgaccaagttcatgct-3') at the 5' end, and primer Ks7-R amplifies the fragment of SNP1 as A (corresponding to 179-251 of SEQ ID No. 7, and the 200th nucleotide is A), and the fluorescence signal of the FAM group can be read by a microplate reader or a fluorescence quantitative PCR instrument; primer Ks7-Y is a primer with a HEX fluorescent tag sequence (5'-gaaggtcggagtcaacggatt-3') at the 5' end, and primer Ks7-R amplifies the fragment of SNP1 as G (corresponding to 181-251 of SEQ ID No. 7, and the 200th nucleotide is G), and the fluorescence signal of the HEX group can be read by a microplate reader or a fluorescence quantitative PCR instrument. The KASP primer pair of SNP2 includes two upstream primers (primer Ks8.1-X and primer Ks8.1-Y) and one downstream primer (primer Ks8.1-R). SNP2 is located at the 202nd base of the DNA molecule shown in SEQ ID No. 8 of the sequence table in the corn genome. Primer Ks8.1-X is a primer with a FAM fluorescent tag sequence (5'-gaaggtgaccaagttcatgct-3') at the 5' end, and primer Ks8.1-R amplifies the fragment of SNP2 as A (corresponding to 178-291 of SEQ ID No. 8, and the 202nd nucleotide is A), and the fluorescence signal of the FAM group can be read by a microplate reader or a fluorescence quantitative PCR instrument; primer Ks8.1-Y is a primer with a HEX fluorescent tag sequence (5'-gaaggtcggagtcaacggatt-3') at the 5' end, and primer Ks8.1-R amplifies the fragment of SNP2 as G (corresponding to 178-291 of SEQ ID No. 8, and the 202nd nucleotide is G), and the fluorescence signal of the HEX group can be read by a microplate reader or a fluorescence quantitative PCR instrument.

[0077] Table 2 KASP markers for QTL effect verification

[0078]

[0079]

[0080] Note: Lowercase gaaggtgaccaagttcatgct is specific fluorescent tag sequence FAM; Lowercase gaaggtcggagtcaacggatt is specific fluorescent tag sequence HEX.

[0081] II. Detection method

[0082] 1. DNA extraction

[0083] Genomic DNA of the leaves of the corn to be tested was extracted, and a template solution was obtained by dilution. The DNA concentration in the template solution was 30-40 ng / μL.

[0084] 2. KASP molecular marker detection

[0085] First, 6 primers were diluted to 100 μM with ddH2O, and then primer working solutions were prepared according to the following formulations. The primer working solutions included primer working solution 1 and primer working solution 2, which were used in the KASP reaction system as follows. Primer working solution 1: primer Ks7-X 12 μL, primer Ks7-Y 12 μL, primer Ks7-R 30 μL, ddH2O 46 μL. Primer working solution 2: primer Ks8.1-X 12 μL, primer Ks8.1-Y 12 μL, primer Ks8.1-R 30 μL, ddH2O 46 μL. KASP reaction system: including 2 μL HiGeno 2x Probe Mix, 1 μL DNA template (20-50 ng / μL), 0.944 μL ddH2O and 0.056 μL primer working solution.

[0086] KASP was performed on a Bio-Rad T100 Thermal Cycler PCR amplifier, and a Touch down PCR amplification program was used. The KASP reaction program was as follows: 94°C pre-denaturation for 15 min, first amplification reaction, 94°C denaturation for 20 s, 65°C annealing for 60 s, 10 cycles, second amplification reaction, 94°C denaturation for 20 s, 55°C annealing and extension for 60 s, 38 cycles. The experiment also set up a blank control (NTC) without adding template DNA in the reaction system, and 1 or more blank controls were set for each plate.

[0087] 3. Fluorescence scanning was performed.

[0088] PCR reaction products were scanned and fluorescence data were read using a FLUOstar Omega microplate reader (BMG Labtech, Offenburg, Germany). Genotype data were read and cluster analysis was performed using the SNP typing software KclusterCaller (V 3.4.1.36; LGC Hoddesdon, UK). Genotype of FAM allele was X:X, genotype of HEX allele was Y:Y, and heterozygote genotype was X:Y. FAM excitation wavelength was 485 nm and emission wavelength was 520 nm. HEX excitation wavelength was 535 nm and emission wavelength was 556 nm. System reference fluorescence ROX excitation wavelength was 575 nm and emission wavelength was 610 nm.

[0089] If the fluorescence of the primer working solution 1 shows only the fluorescence signal of the FAM group, the Ks7 (i.e. SNP1) genotype of the corn to be tested is AA (i.e. the homozygous type of Ks7 as A in the corn genome); if it shows only the fluorescence signal of the HEX group, the Ks7 genotype of the corn to be tested is GG (i.e. the homozygous type of Ks7 as G in the corn genome); if it shows both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group, the Ks7 genotype of the corn to be tested is AG (i.e. the heterozygous type of Ks7 as A and G in the corn genome). If the fluorescence of the primer working solution 2 shows only the fluorescence signal of the FAM group, the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is AA (i.e. the homozygous type of Ks8.1 as A in the corn genome); if it shows only the fluorescence signal of the HEX group, the Ks8.1 genotype of the corn to be tested is GG (i.e. the homozygous type of Ks8.1 as G in the corn genome); if it shows both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group, the Ks8.1 genotype of the corn to be tested is AG (i.e. the heterozygous type of Ks8.1 as A and G in the corn genome).

[0090] Therefore, the genotype of the corn plant to be tested can be defined according to the following rules:

[0091] AAGG genotype: if the fluorescence of the reaction system using the primer working solution 1 shows only the fluorescence signal of the FAM group and the fluorescence of the reaction system using the primer working solution 2 shows only the fluorescence signal of the HEX group, the Ks7 (i.e. SNP1) genotype of the corn to be tested is AA and the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is GG. The identification accuracy of AAGG is = the number of AAGG genotype plants resistant to stem rot / the number of AAGG genotype plants x 100%.

[0092] AAAA genotype: if the fluorescence in the reaction system using primer working solution 1 shows only the fluorescence signal of FAM group and the fluorescence in the reaction system using primer working solution 2 shows only the fluorescence signal of FAM group, then the Ks7 (i.e. SNP1) genotype of the corn to be tested is AA and the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is AA. The identification accuracy of AAAA = resistant AAAA genotype plants / AAAA genotype plants x 100%.

[0093] GGGG genotype: if the fluorescence in the reaction system using primer working solution 1 shows only the fluorescence signal of HEX group and the fluorescence in the reaction system using primer working solution 2 shows only the fluorescence signal of HEX group, then the Ks7 (i.e. SNP1) genotype of the corn to be tested is GG and the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is GG. The identification accuracy of GGGG = resistant GGGG genotype plants / GGGG genotype plants x 100%.

[0094] GGAA genotype: if the fluorescence in the reaction system using primer working solution 1 shows only the fluorescence signal of HEX group and the fluorescence in the reaction system using primer working solution 2 shows only the fluorescence signal of FAM group, then the Ks7 (i.e. SNP1) genotype of the corn to be tested is GG and the Ks8.1 (i.e. SNP2) genotype of the corn to be tested is AA. The identification accuracy of GGAA = resistant GGAA genotype plants / GGAA genotype plants x 100%.

[0095] Example 2, detecting corn stalk rot resistance using the method of Example 1

[0096] I. Actual determination of corn stalk rot resistance

[0097] 1. Field design

[0098] The 240 RIL (RIL family) of the parents KA105 and KB204 and their combinations were identified for stalk rot resistance in Yangling, Shaanxi and Sanyuan, Shaanxi in 2019-2020. The site and year were uniformly defined as the environment, abbreviated as "year + first letter of the site", such as 2019YL. The field test adopted an incomplete randomized block design, 2 replicates were set in each environment, single row planting, row length 4m, row spacing 0.6m, density 5500 plants / acre. The field management measures were the same as the management of local field corn.

[0099] 2. Pathogen culture

[0100] Fusarium graminearum strain culture: single spore isolated pathogen strains were inoculated on PDA (Potato Dextrose Agar) medium, and dark culture was performed in a 25 °C constant temperature incubator for 5-7 days. When the mycelium grew on the surface of the medium, it was inoculated on the sterile corn kernel medium together with the medium, and the inoculum of Fusarium graminearum was propagated. Fusarium graminearum inoculum propagation: single spore isolated pathogen strains were inoculated on PDA (Potato Dextrose Agar) medium, and dark culture was performed in a 25 °C constant temperature incubator for 5-7 days. When the mycelium grew on the surface of the medium, it was inoculated on the sterile corn kernel medium together with the medium, and the inoculum of Fusarium graminearum was propagated. PDA solid medium preparation: fresh potatoes were washed, peeled, and cut into pieces. 200 g of the potatoes were boiled in boiling water for 30 min, 8 layers of gauze were used for filtration, and the filtrate was collected. 20 g of glucose was weighed and dissolved, 15 g of agar powder was weighed, heated and dissolved, and then poured into the filtrate. The solution was stirred uniformly, and the volume was made up to 1 L. High-temperature high-pressure sterilization was performed at 121 °C / 20 min, and the solution was divided and cooled for use or stored in a 4 °C refrigerator.

[0101] 3. Field inoculation

[0102] The soil burial wound root method was used for field inoculation during the tasseling stage of corn. The inoculated kernels were stirred and mixed before inoculation. A pit was dug near the roots of the plants at a distance of 5-10 cm, and part of the root was cut to create a wound. 75-85 g of corn kernels with the fungus were placed in the pit, and the soil was covered and compacted. After the inoculation was completed, field irrigation was performed to keep the soil moist and promote the reproduction and infection of the pathogen.

[0103] 4. Trait investigation

[0104] After 50-55 days of inoculation, the split stem method was used to identify the occurrence of corn stalk rot in the field. The plants were cut at the fruiting site and split longitudinally along the stem. The infection of the pathogen and the degree of pith tissue necrosis at the root and stem base were observed, and the stalk rot disease rating scale (DRS) was used for phenotypic identification of stalk rot. There were 5 grades:

[0105] Grade 1: highly resistant, normal plant, no obvious disease;

[0106] Grade 3: resistant, normal stem surface of the plant, brown lesions appeared at the stem tip;

[0107] Grade 5: moderately resistant, soft and faded stem base of the plant, with obvious water spots; part of the pith tissue between the first and second nodes at the stem base shriveled and decomposed, with brown lesions;

[0108] 7: sick, the lower stem of the plant gradually changed from green to brown, the stem was soft and severely dehydrated, the internal stem pith tissue was decomposed into a filamentous shape, severely atrophied, and the stem nodes appeared white or magenta-colored mycelium; the root system was soft, dry, sparse, but not collapsed; the ear began to droop;

[0109] 9: highly susceptible, the stem of the plant was hollow and constricted, only necrotic vascular bundle tissue remained inside the stem, the stem nodes and internodes were black and had a magenta mark; the root system was sparse, rotten and hollow, the plant was folded or collapsed; the bract of the female ear was dry and loose, and the female ear was drooping.

[0110] Select 10 plants with consistent growth vigor from each family, and record the stem rot disease classification one by one. The average value is used as the phenotype value of each family. The average value of the disease classification of a single family is used to calculate the BLUP value representing the multi-environment combined analysis phenotype value of the family. The BLUP value of the disease classification is between 1 and 2, which is highly resistant; between 2.01 and 3, which is resistant; between 3.01 and 5, which is moderately resistant; between 5.01 and 7, which is susceptible; between 7.01 and 9, which is highly susceptible. Record the number of days from sowing to 50% of the plants shedding pollen for each family.

[0111] 5. Phenotype data analysis

[0112] In order to evaluate the significance of genotype, environment variance and the interaction between the two, the "PROC MIXED" program in SAS (V9.2) software was used to calculate the variance components, and the mixed linear model was: y = μ + gi + ej + ε, where μ represents the total mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype as a fixed effect, flowering period as a covariate, environment, intra-environment repetition, genotype and environment interaction as random effects. The variance analysis result value is used to calculate the broad-sense heritability (H 2 ) of stem rot resistance: where, is the genetic variance, represents the genotype and environment interaction variance, is the error term, n is the number of environments; r is the number of repetitions. In order to eliminate the influence of environmental variation on the phenotype, the best linear unbiased prediction (Best Linear Unbiased Prediction, BLUP) of each family is estimated by the mixed linear model of SAS (V9.2), and the BLUP value is used as the data of multi-environment combined analysis to draw the phenotype distribution histogram of each trait, calculate the correlation coefficient of the phenotype, and locate the multi-environment combined QTL.

[0113] 6. Identification of corn stem rot resistance using Ks7 and Ks8.1

[0114] The genotypes of Ks7 and Ks8.1 of the corns to be tested shown in Table 1 were detected according to the method of Example 2.

[0115] The disease grading and genotype results of the corns to be tested shown in Table 1 are shown in Table 3, and the heterozygous genotypes are not listed in Table 3. Among the 239 recombinant inbred lines in addition to the target QTL fine mapping family 638RIL-31 in the Pop.1 population, a total of 91 recombinant inbred lines were homozygous genotypes at the Ks7 and Ks8.1 molecular markers.

[0116] The phenotypic identification of the RIL family was based on the selection of 10 plants with consistent growth in a single environment, and the occurrence of stem rot was observed and recorded one by one. Finally, the average value of the 10 materials was taken as the phenotype value of the family; the disease grading of a single family was analyzed by using the BLUP value.

[0117] Table 3 Allelic genotypes of molecular markers Ks7 and Ks8.1 and phenotypes

[0118]

[0119]

[0120]

[0121]

[0122] Note: Ks7: AA (resistant allele), GG (susceptible allele); Ks8.1: GG (resistant allele), AA (susceptible allele)

[0123] Table 4 Significant analysis of disease grading of stem rot by molecular markers Ks7 and Ks8.1

[0124] Ks7 Ks8.1 Phenotype RIL family number BLUP value AA GG Disease resistant 26 3.16 ± 0.27 c ]] GG GG Disease resistant 13 <![CDATA[4.69±0.38 b ]]> GG AA Disease susceptible 44 5.36 ± 0.25 a ]]

[0125] Note: Ks7: AA (resistant allele), GG (susceptible allele); Ks8.1: GG (resistant allele), AA (susceptible allele). Different lowercase letters indicate significant difference (P<0.05).

[0126] The single statistical results of molecular marker Ks7 and molecular marker Ks8.1 are shown in Table 5 and Table 6. The BLUP value of the recombinant inbred lines with genotype AA at SNP1 (i.e. Ks7) site was significantly lower than that of the recombinant inbred lines with genotype GG (P<0.001). The BLUP value of the recombinant inbred lines with genotype GG at SNP2 (i.e. Ks8.1) site was significantly lower than that of the recombinant inbred lines with genotype AA (P<0.001).

[0127] Table 5 Disease grade significance analysis of different genotypes of molecular marker Ks7

[0128]

[0129] Note: Single-tailed t-test was used for phenotype significance analysis, "*" represents significant at 0.05 level, "**" represents significant at 0.01 level, "***" represents significant at 0.001 level.

[0130] Table 6 Disease grade significance analysis of different genotypes of molecular marker Ks8.1

[0131]

[0132] Note: Single-tailed t-test was used for phenotype significance analysis, "*" represents significant at 0.05 level, "**" represents significant at 0.01 level, "***" represents significant at 0.001 level.

[0133] The above results show that SNP molecular markers Ks7 and Ks8.1 closely linked to the target QTL can be used for identification of corn stalk rot resistance. In breeding of corns resistant to stalk rot, it is best to select corns with SNP site Ks7 genotype AA and SNP site Ks8.1 genotype GG, or corns with SNP site Ks7 genotype AA or SNP site Ks8.1 genotype GG as parents for breeding, or only corns with SNP site Ks7 genotype AA as parents for breeding.

[0134] Supplementary Table 3

[0135]

[0136]

[0137] Note: "638RIL-53-1", "638RIL-53-2", "638RIL-53-3", "638RIL-53-4" represent different single plants of 638RIL-53 family, and other plants are the same.

[0138] Example 3, Mining of SNP for Detection of Corn Stalk Rot

[0139] 1. QTL positioning of corn F. graminearum stalk rot resistance

[0140] Method:

[0141] (1) Trait investigation

[0142] Stalk rot incidence was evaluated in the field 50-55 days after inoculation with Fusarium graminearum pathogen by the split stem method. The plants were cut at the earing position and split longitudinally along the stem to observe the pathogen infection and the extent of pith tissue necrosis at the root and stem base. The disease rating scale (DRS) was used to evaluate the stalk rot phenotype, as described in detail in Example 2, Section 4.

[0143] Ten plants with uniform growth vigor were selected from each family, and the disease rating scale was observed and recorded for each plant. The average value was used as the phenotype value of each family. The mean of the disease rating scale of each family was used to calculate the BLUP value representing the multi-environment joint analysis phenotype value of the family. The BLUP value of the disease rating scale was between 1-2, which was highly resistant; between 2.01-3, which was resistant; between 3.01-5, which was moderately resistant; between 5.01-7, which was susceptible; between 7.01-9, which was highly susceptible. The number of days from sowing to 50% of the plants shedding pollen was investigated and recorded for each family.

[0144] (2) Phenotype data analysis

[0145] To evaluate the significance of genotype, environment variance, and the interaction between the two, the "PROC MIXED" program in SAS (V9.2) was used to calculate the variance components. The mixed linear model was: y = μ + gi + ej + ε, where μ represents the overall mean of the phenotype, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype is a fixed effect, flowering period is a covariate, and environment, intra-environment replication, and genotype-environment interaction are random effects. The variance analysis result value is used to calculate the Broad-sense heritability (H 2 ) of stalk rot resistance: where, is the genetic variance, represents the genotype-environment interaction variance, is the error term, n is the number of environments, and r is the number of replicates. To eliminate the effect of environmental variation on the phenotype, the Best Linear Unbiased Prediction (BLUP) of each family was estimated using the SAS (V9.2) mixed linear model. The BLUP value was used as the multi-environment joint analysis data to draw the phenotype distribution histogram of each trait, calculate the phenotypic correlation coefficient, and perform multi-environment joint QTL mapping.

[0146] (3) Linkage map construction: At the 5-6 leaf stage of maize, 5 young leaves with consistent growth vigor were selected from each family and mixed. The genomic DNA was extracted using the conventional CTAB method. Genotyping analysis was performed using the Maize6H-60K chip independently developed by the Maize Research Center of Beijing Academy of Agriculture and Forestry Sciences. The QTL ICImapping 4.2 software was used to construct the linkage map. The Kosambi function was selected to estimate the genetic distance. Finally, 48087 polymorphic SNP markers were screened, and 7200 bin markers were obtained after removing redundant markers.

[0147] (4) QTL mapping: Based on the constructed high-density genetic linkage map, the phenotypic values of the four stem rot evaluation indexes in the mapping population were analyzed in a single environment and multiple environments to detect the resistance QTL of Fusarium head blight. The composite interval mapping method (CIM) of Windows QTLCartographer V2.5 software was used for initial positioning and genetic effect analysis. The threshold value was set as LOD = 3, and the confidence interval of the target QTL was determined according to the 2-LOD value on both sides of the LOD value peak. Results: The resistance of RIL population and parent materials to F. graminearum stem rot was identified in four environments (2019YL, 2019SY, 2020YL and 2020SY). The statistical analysis results showed that the stem rot resistance of the resistant parent KA105 and the susceptible parent KB204 was significantly different (Table 7). The RIL population showed extensive continuous variation in different environments, indicating that the stem rot resistance was a quantitative trait controlled by multiple genes.

[0148] Table 7 Phenotypic distribution of parents and recombinant inbred lines in multiple environments

[0149]

[0150] Note: 2019YL: Yangling in 2019; 2019SY: Sanyuan in 2019; 2020YL: Yangling in 2020; 2020SY: Sanyuan in 2020; BLUP: joint analysis of multiple environments.

[0151] In Pop.1 population, the variation range of disease classification was 1-9, the mean was between 2.91-5.43, and the coefficient of variation was 33%-65%. The disease classification in a single environment showed a skewed normal distribution, and the BLUP value in multiple environment joint analysis showed a normal distribution. The joint variance analysis results showed that (Table 7), the difference between genotypes in RIL population was extremely significant, the difference between environments and the interaction between genotypes and environments was extremely significant, and the genetic variance estimate was greater than the variance estimate of environment and genotype-environment interaction, indicating that the genetic factor was the main source of variation. The heritability of stem rot resistance in Pop.1 population was 81%.

[0152] Table 8 Variance and heritability analysis of multiple-environment stem rot phenotype indicators

[0153]

[0154] Note: *** indicates P < 0.001.

[0155] Using the phenotypic data of disease rating in single and multiple environments and BLUP values, QTLs for F. graminearum stem rot resistance were located. A QTL (qSr5-1) was detected on chromosome 5 bin5.05 (Table 9), with a physical position between 178,021,534 bp and 183,318,514 bp (B73 RefGen_V3), about 5.30 Mb. The QTL was co-located in 2020YL, 2020SY and BLUP values (Table 9), with LOD values between 3.87 and 7.48, and the explained phenotypic variation was 5.22% - 12.10%, and the resistance allele was derived from the resistant parent KA105. Figure 1

[0156] Table 9 QTL analysis of F. graminearum stem rot disease rating in single and multiple environments

[0157] Trait Environment Chromosome Left flanking marker Right flanking marker LOD Contribution rate R 2 (%)]] DRS 2020YL 5 AX-91854907 AX-107957427 3.87 5.48 DRS BLUP 5 AX-108028348 AX-108105099 7.48 12.1 DRS 2020SY 5 AX-108028348 AX-108105099 4.98 5.22

[0158] 2. Validation and fine mapping of QTLs for corn stem rot resistance

[0159] Methods: QTL effect validation and fine mapping were performed by recombination offspring verification method. According to the results of QTL initial mapping, the remaining heterozygous lines with fixed other background genotypes in the target segment were screened in the RIL population, and KASP markers were developed to screen individuals with exchanges in the target segment. The key recombinant individuals were verified by the genotypes and stem rot phenotypes of their offspring to validate the effect and fine map the QTL. Each recombinant single plant was planted with 60-180 plants for genotype and stem rot disease rating identification, and the disease severity index (DSI) of each genotype was calculated. The difference in corn F. graminearum stem rot resistance between different genotypes was analyzed by one-tailed t test. If there was a significant difference (P < 0.05) between different genotypes, it indicated that the QTL was located in the heterozygous region, and vice versa.

[0160] DSI (%) = (disease rating x number of plants in the corresponding rating) x 100 / (maximum disease rating x total number of plants)

[0161] Results:

[0162] ​(1) In the F8 RIL family of Pop. 1, 1 heterozygous genotype was screened in the target resistance QTL candidate interval, and the remaining heterozygous line material 638RIL-31 with relatively fixed background genotype was obtained. After selfing, the seeds of the offspring of the segregation population were obtained. The developed molecular markers were used to screen individuals with exchanges in the target segment (Table 5). Key recombinant individuals were fine-mapped by offspring test method. Each recombinant individual was planted for 100-200 plants to identify the genotype and the stem rot resistance phenotype. The effect verification of the target QTL showed that the homozygous allele from the disease-resistant parent could significantly improve the field resistance of stem rot (P<0.001) Figure 2 A) Among them, the DSI of the KA105 / KA105 genotype plant with pure disease resistance was 24.55% in Yangling in 2021, and the DSI of the KB204 / KB204 genotype plant with pure disease resistance was 61.62%; the DSI of the KA105 genotype plant with pure disease resistance was 33.49% in Yangling in 2022, and the DSI of the KB204 genotype plant with pure disease resistance was 49.05%, and the t test result showed that there was a very significant difference in DSI between the two genotypes (P<0.001). In summary, the effect detection of the resistance QTL located by the remaining heterozygous line 638RIL-31 showed that the two-year test results reached a very significant difference, indicating that the genetic effect of the QTL really exists, and the target QTL site with pure disease resistance allele can stably reduce the DSI by 15.56%-37.07%, significantly improving the field resistance of corn to stem rot of Fusarium graminearum.

[0163] (2) In the candidate interval of the target QTL, molecular markers were added to design molecular marker primers with the corn B73 reference genome V3 version sequence as the reference. The molecular markers Ks7 and Ks8.1 at both ends of the candidate interval. Ks7 is located at position 178607304 of chromosome 5 of corn, which is named SNP1, and the nucleotides near the SNP site are shown in SEQ ID No. 7 of the sequence table, wherein the 200th base is the SNP site, that is, B73 RefGen_V3 https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3) is A / G polymorphism. In SEQ ID No. 7, R is A or G, and the genotype of the SNP site has the following three types: AA, AG or GG. The GG is the homozygous type of the SNP site being G, the AA is the homozygous type of the SNP site being A, and the AG is the heterozygous type of the SNP site being A and G. The corn variety with the SNP site genotype of AA or AG has significantly higher resistance to stalk rot than the corn variety with the SNP site genotype of GG. Ks8.1, located at 182486805 of chromosome 5 of corn, is named SNP2, and the nucleotides of the SNP site and its vicinity are shown in SEQ ID No. 8 of the sequence table, wherein the 202nd base is the SNP site, i.e. B73 RefGen_V3 https: / / www.maizegdb.org / genome / assembly / B73%20RefGen_v3 ) is A / G polymorphism. In SEQ ID No. 7, R is A or G, and the genotype of the SNP site has the following three types: AA, AG or GG. The GG is the homozygous type of the SNP site being G, the AA is the homozygous type of the SNP site being A, and the AG is the heterozygous type of the SNP site being A and G. The corn variety with the SNP site genotype of AA or AG has significantly higher resistance to stalk rot than the corn variety with the SNP site genotype of GG. Ks8.1, located at 182486805 of chromosome 5 of corn, is named SNP2, and the nucleotides of the SNP site and its vicinity are shown in SEQ ID No. 8 of the sequence table, wherein the 202nd base is the SNP site, i.e. B73 RefGen_V3

[0164] (3) The progeny of the segregation population is divided into four recombination types by using the newly developed markers, and the fine mapping of the resistance QTL is carried out by the progeny test method. The results show that there is a significant difference in DSI between the plants carrying the homozygous KA105 genotype and the homozygous KB204 genotype in types I and IV (P<0.05) Figure 2 , and there is no significant difference in DSI between the plants carrying the homozygous genotype in types II and III (P>0.05). It is thus judged that the KA105 donor fragment of type IV carries the target QTL. According to whether each type carries the target QTL, it can be inferred that the site is located between the markers Ks7 and Ks8.1 in the type I and IV heterozygous interval, with a physical distance of about 3.87 Mb (corresponding to the B73 genome RefGen_V3 information). Among them, there is a significant difference in DSI between the plants carrying the homozygous resistant genotype and the homozygous susceptible genotype in type IV (P<0.05) Figure 2 . In summary, the resistance QTL is located between the molecular markers Ks7 and Ks8.1 with a physical distance of about 3.87 Mb, and the allele from the resistant parent can significantly improve the field resistance to stalk rot.

[0165] SEQ ID No. 7 Ks7: (Chr.5_178607304, B73 RefGen_V3)

[0166] TGGCCATTAGGGCCTCTTTCTACTTCTAGAGGTGGTTGTTTCGCATGCGAAGACTCCTTAGCAAAAGTTGTTCCTTGGTGTTCATGTTAAGGTCCTCTTTCTCTTGGAGGATGTATTTGTATTCTTTAGTGGTGGGCTTAGGTGGTAGCGGCCACTTGTGGTGCTCTGGGAGTGAAGTCTGTGGAACGAACGAAGACCTRAAGATGTCTTTGAGTTAGTGGGAGCTAGATGGTTGTTTTCTTGACAGGTCGGTCCAAACTTTGGCCTGATAGGGGTGTCTCTAGGAGTTGAAAGGAACATGTTCGAGGGTCTCCGAATTGCATGTGTGGACACTTCCTTTGGGGATGAATGGCTCTTTGTGGCGAGGGAAAGTTGGGTCTCTATGGCTAGCTCATTGATG

[0167] SEQ ID No. 8 Ks8.1 : (Chr. 5_182486805, B73 RefGen_V3)

[0168] AGTGTCTCAGACTGGTATTAGCATAGCAACAAAAGTGGCTTAATAGATGTTCAGAATTGAGCGACACTACAGTCAAAGATGCACAACACTTGACACTAGCTTGTACACAGTAAAATTCTTCTCTGGTACACCGTACACATCAGGAGACGAAACAAAACTCCTGCGCTCTCTTATTTAACCAAGATCAGGGACTATGAGGTARTCCTCGTCGTCGGTGACCTCGATCCGGGCCTTTCTTCGCTCTGGCGAACCCCAGCGCCGCCGACGGCGGTTTGGCCGGCCTGTAGTACGCCGCGTCGTTCGCCGCCTGGTATCCGAAAAGCTCCGGCACATCCGCCAACGTCCTGCTGGCTTTGGGCGCCTGCTCGTGGAAGAGGTCGATGTCGGCGAACCACTCCAGC

[0169] Ks7 is named SNP1 and Ks8.1 is named SNP2.

[0170] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the application.

Claims

1. Any of the following applications of a substance for detecting polymorphism or genotype of a SNP site in a corn genome, A1) Identify or assist in identifying resistance to corn stalk rot; A2) Screening or breeding maize lines, strains or varieties that are resistant to stalk rot; A3) Screening or breeding corn lines, strains or varieties susceptible to stalk rot; A4) Preparation of products for identifying or assisting in identifying resistance to corn stalk rot; A5) preparing products for screening or breeding maize lines, strains or varieties resistant to stalk rot; A6) preparing products for screening or breeding maize lines, varieties or varieties susceptible to stalk rot; The SNP site is any of the following: P1, the SNP sites are SNP1 and SNP2, the SNP1 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No. 9 in the sequence list, which is A or G; the SNP2 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No. 16 in the sequence list, which is A or G; P2, the SNP site is SNP1 site, the SNP1 site is a SNP in the corn genome, which is the 50th nucleotide of SEQ ID No.9 in the sequence list, which is A or G; P3. The SNP site is SNP2, which is a SNP in the corn genome and is the 50th nucleotide of SEQ ID No. 16 in the sequence list, which is A or G.

2. The use according to claim 1, characterized in that The substance is as follows D1), D2) or D3): D1) the substance is a primer composition for amplifying a corn genomic DNA fragment including the SNP site; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

3. The use according to claim 2, characterized in that The primer composition is F1 and / or F2: F1, a primer set consisting of the single-stranded DNA shown in SEQ ID No. 1 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 3 in the sequence listing; F2. A primer set consisting of the single-stranded DNA shown in SEQ ID No. 4 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 5 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 6 in the sequence listing.

4. A method for identifying or assisting in identifying corn stalk rot resistance, characterized in that: The method is any of the following: M1. The method includes detecting the genotypes of SNP1 and SNP2 sites in the maize genome to be tested, and identifying or assisting in identifying maize stalk rot resistance based on the genotypes, wherein the SNP1 site is a site on maize chromosome 5, the nucleotide type of which is A or G, and is the 50th nucleotide of SEQ ID No. 9 in the sequence listing; the SNP2 site is a site on maize chromosome 5, the nucleotide type of which is A or G, and is the 50th nucleotide of SEQ ID No. 16 in the sequence listing; M2. The method includes detecting the genotype of the SNP1 site in the maize genome to be tested, and identifying or assisting in identifying maize stalk rot resistance based on the genotype, wherein the SNP1 site is a site on maize chromosome 5, the nucleotide type of which is A or G, and is the 50th nucleotide of SEQ ID No. 9 in the sequence listing; In the method described in M1 or M2 above, the corn with the genotype of AA or AG at the SNP1 site has a higher resistance to stalk rot than the corn with the genotype of GG, and the corn with the genotype of GG or AG at the SNP2 site has a higher resistance to stalk rot than the corn with the genotype of AA.

5. A method for breeding corn resistant to stalk rot, characterized in that: The method includes detecting the genotypes of a SNP1 site and a SNP2 site in a corn genome, and selecting corn with a genotype of AAGG as a parent for breeding, wherein the AAGG is a homozygous type in which the SNP1 site is A and the SNP2 site is a homozygous type in which the SNP1 site is G, the SNP1 site is a site on chromosome 5 of corn, the nucleotide type of which is A or G, and is the 50th nucleotide of SEQ ID No. 9 in the sequence list; and the SNP2 site is a site on chromosome 5 of corn, the nucleotide type of which is A or G, and is the 50th nucleotide of SEQ ID No. 16 in the sequence list.

6. Use of the method of claim 4 in breeding maize for resistance to stalk rot, wherein the maize chromosome to be tested comprises a DNA segment having a nucleic acid sequence that is at least 85%, at least 90%, or at least 95% identical to the sequence shown in SEQ ID NO. 9, or / and a nucleic acid sequence that is at least 85%, at least 90%, or at least 95% identical to the sequence shown in SEQ ID NO.

16.

7. The use of DNA molecules in any of the following: A1) Identify or assist in identifying resistance to corn stalk rot; A2) Screening or breeding maize lines, strains or varieties that are resistant to stalk rot; A3) Screening or breeding corn lines, strains or varieties susceptible to stalk rot; A4) Preparation of products for identifying or assisting in identifying resistance to corn stalk rot; A5) preparing products for screening or breeding maize lines, strains or varieties resistant to maize stalk rot; A6) preparing products for screening or breeding maize lines, varieties or varieties susceptible to maize stalk rot; The DNA molecule is any one of the following: N1) The nucleotide sequence is SEQ ID No. 7 in the sequence listing or the DNA molecule of positions 179 to 251 of SEQ ID No. 7 or positions 181 to 251 of SEQ ID No. 7; N2) The nucleotide sequence is SEQ ID No. 8 in the sequence listing or the DNA molecule at positions 178-291 of SEQ ID No. 8; N3) A combination of N1) and N2).

Images