A molecular marker related to purple leaf character of Lagerstroemia indica and application thereof

Abstract

The present application relates to the technical field of crape myrtle germplasm identification, and particularly relates to a molecular marker related to purple leaf character of crape myrtle and application thereof. The molecular marker is designed based on 32 bp insertion / deletion at 789140-789171 bp of chromosome 12 of crape myrtle reference genome, and the polymorphism of bases at the site can be used for early identification of the purple leaf character of crape myrtle, especially early identification of the germplasm with perennial purple leaves, purple young leaves and green mature leaves. The InDel molecular marker and primer provided by the present application are high in accuracy, strong in specificity, good in stability, simple and convenient in detection, high in economy and efficiency, and can be widely applied to early accurate identification of leaf color in crape myrtle natural population and hybrid population, and provide technical support for molecular marker assisted genetic breeding of the purple leaf character of crape myrtle.

Description

Technical Field

[0001] This invention relates to the field of crape myrtle germplasm identification technology, and in particular to a molecular marker related to the purple leaf trait of crape myrtle and its application. Background Technology

[0002] Crape myrtle ( Lagerstroemia indica Lagerstroemia indica (L.) is a summer-flowering shrub or small tree belonging to the Lythraceae family, native to Asia. Due to its excellent ornamental value and resilience, it has been widely introduced, cultivated, and utilized worldwide, making it a landscaping tree species with significant market potential. Purple-leaved Lagerstroemia indica is an important germplasm resource. Compared to green-leaved Lagerstroemia indica, its leaves are rich in anthocyanins, which have the ability to scavenge reactive oxygen species, resist ultraviolet damage, and protect against pathogens, thus improving the plant's resistance to environmental stress. Furthermore, the vibrant color of its leaves allows for simultaneous appreciation of both flowers and foliage, compensating for the lack of color diversity in the landscape during non-flowering seasons and enhancing the ornamental and commercial value of Lagerstroemia indica. Therefore, continued breeding of purple-leaved Lagerstroemia indica varieties is essential.

[0003] Currently, research on the purple leaf trait of Lagerstroemia indica is limited and faces several challenges. Firstly, the breeding of purple-leaved Lagerstroemia indica still relies on traditional artificial hybridization and pollination, with leaf color determined visually. Besides purple-leaved and green-leaved varieties, there exists a type where young leaves are purple, but mature leaves turn green. In this type, only the top young leaves of mature plants are purple, while seedlings are purple. In early identification, this type often interferes with the screening results for perennially purple-leaved Lagerstroemia indica. Furthermore, the purple leaf color of Lagerstroemia indica is easily affected by external environmental factors such as strong light and high or low temperatures, drought, and nitrogen deficiency. These factors also frequently interfere with breeders' evaluation of the purple leaf trait.

[0004] Previous researchers discovered that "LiHY5-LiMYB75+LibHLH1 / 4- LiCHS / LiANS "Transcription factor cascade regulation is involved in the formation of purple leaves in crape myrtle, but..." LiHY5 In the crape myrtle purple-leaf hybrid population, the genotyping and leaf color trait segregation are not completely consistent, making it difficult to utilize... LiHY5 Accurately and quickly screen out purple-leaved individuals from hybrid populations. To rapidly and accurately identify the purple-leaved trait, there is an urgent need to establish a rapid and efficient method for identifying crape myrtle purple-leaved germplasm, providing technical support for the breeding and identification of purple-leaved varieties. Summary of the Invention

[0005] To address the aforementioned technical challenges, this invention utilizes BSA combined with RNA-seq and targeted metabolomics analysis to identify a 32bp deletion co-segregated with the purple leaf trait of Lagerstroemia indica. Based on this, a molecular marker (InDel) associated with the purple leaf trait of Lagerstroemia indica is first provided. This molecular marker is defined as a 32bp sequence insertion or deletion at positions 789140-789171 bp on chromosome 12 of the Lagerstroemia indica reference genome PRJCA013427.

[0006] Insertion-deletion (InDel) markers are polymorphic markers at the nucleotide level, possessing advantages such as wide distribution, ease of detection, low cost, and high security. The molecular markers screened in this invention, associated with the purple leaf trait of Lagerstroemia indica, can rapidly and efficiently identify this trait, which is of great significance for the identification of Lagerstroemia indica germplasm resources and marker-assisted breeding.

[0007] In the specific implementation process, the Lagerstroemia indica reference genome PRJCA013427 can be downloaded from the National Genome Science Data Center (https: / / ngdc.cncb.ac.cn / ).

[0008] In the specific implementation process, the 32bp sequence is as shown in SEQ ID No.1 (TGAGGAGGCCCTGACCGCCGCTGAGGTCCCTC).

[0009] In specific implementation, the molecular marker is the insertion or deletion of the sequence shown in SEQ ID No. 1 after the 62nd base of the sequence shown in SEQ ID No. 2 (GAGTTCGGGGATCTAGACTGGCTAGCTGACATGGGTCTCCTTGGGGAGCAAATCACTCATCAAGCTCCCGGTTTCTCAGCCAAGCAACTTCCCTGTCCCGAATTGCCGAACCAACAAGCTCACCATCTCCTCCCAGAAGAAACAGAGGATCGAAGTCCCTGCATATGATGACGACGATGATGAGGAGCACTT).

[0010] In the specific implementation process, if the 32bp sequence is missing, it is identified as a crape myrtle variety with heritable purple leaves all year round; if the 32bp sequence is not missing, it is identified as a crape myrtle variety with purple young leaves and green mature leaves or a crape myrtle variety with green leaves all year round.

[0011] Furthermore, the present invention provides primers for amplifying the molecular marker, the primers being shown in SEQ ID No. 3 (GAGTTCGGGGATCTAGACTGGC) and SEQ ID No. 4 (AAGTGCTCCTCATCATCGTCGT).

[0012] Detection reagents or kits containing the primers described herein are also within the scope of protection of this invention.

[0013] Furthermore, the present invention provides the application of the aforementioned molecular markers or primers in identifying the purple leaf trait of Lagerstroemia indica.

[0014] More specifically, the present invention provides a method for identifying the purple leaf trait of crape myrtle, comprising: performing PCR amplification of the genomic DNA of the sample to be tested using the primers described above.

[0015] In the specific implementation process, the samples to be tested include crape myrtle varieties with heritable purple leaves all year round, crape myrtle varieties with purple young leaves and green mature leaves, or crape myrtle varieties with green leaves all year round.

[0016] Preferably, the heritable crape myrtle varieties with perennial purple leaves include: 'Ebony Fire', 'Ebony Glow', 'Ebony and Ivory', and purple-leaved hybrids.

[0017] Preferably, the crape myrtle varieties with purple young leaves and green mature leaves include 'Dynamite', 'Red Rocket', 'Whit III', etc.

[0018] Preferably, the evergreen crape myrtle varieties include: 'Arapahoe', 'Pocomoke', 'Binfen Jiaren', and their hybrid offspring with green leaves.

[0019] In the specific implementation process, the PCR amplification reaction conditions are as follows (25 μl system): 12.5 μl of 2×Rapid TaqMaster Mix, 1 μl of 10 μM upstream primer, 1 μl of 10 μM downstream primer, 1 μl of DNA template, and ddH2O to make up to 25 μl.

[0020] In the specific implementation process, the PCR amplification procedure is as follows:

[0021] (1) Pre-denaturation at 95℃ for 3 min;

[0022] (2) Denaturation at 95℃ for 15 seconds;

[0023] (3) Anneal at 61℃ for 15s;

[0024] (4) Extend at 72℃ for 30 seconds;

[0025] (5) Repeat steps (2), (3), and (4) a total of 35 times;

[0026] (6) Extend at 72℃ for 2 minutes.

[0027] In the specific implementation process, it also includes: using agarose gel electrophoresis to detect the amplification products. If there are bands at both 224 bp and 192 bp, or only at 192 bp, it is identified as a heritable crape myrtle variety with perennial purple leaves; if there is only a band at 224 bp, it is identified as a crape myrtle variety with purple young leaves and green mature leaves, or a crape myrtle variety with perennial green leaves.

[0028] Preferably, the agarose gel is a 1% agarose gel.

[0029] In practice, the electrophoresis detection time can be appropriately extended as needed until the marker runs completely apart and the two bands of the amplified product are completely separated.

[0030] Preferably, the kit used for extracting genomic DNA from Crape Myrtle is a novel plant genomic DNA rapid extraction kit (DN15, Aidlab).

[0031] Preferably, the extracted crape myrtle genomic DNA samples are tested for purity and quality using 1% agarose gel electrophoresis and a micro-ultraviolet spectrophotometer.

[0032] Furthermore, this invention also provides the application of the aforementioned molecular markers, primers, applications, or methods in the genetic breeding or germplasm resource analysis of Lagerstroemia indica.

[0033] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0034] (i) The method of the present invention is fast and efficient, and can identify the purple leaf expression of individual crape myrtle individuals in natural and hybrid populations during the juvenile stage of crape myrtle seedlings, avoiding the interference of young purple crape myrtle and the influence of environmental factors causing the leaves to turn purple.

[0035] (ii) No expensive instruments and equipment or complicated procedures are required; only commonly used instruments such as PCR instruments are needed to identify the results.

[0036] (iii) High sensitivity, small sample requirement, DNA can be extracted from a single leaf for detection.

[0037] (iv) High specificity: Primers are designed based on the specific fragment inserted in the perennial purple-leaved crape myrtle to accurately identify whether the crape myrtle contains this specific fragment. This invention can accurately identify perennial purple-leaved crape myrtle germplasm, and has high reference value for the precise identification of crape myrtle germplasm and the development of molecular marker-assisted breeding technology, and is suitable for widespread application. Attached Figure Description

[0038] Figure 1 This is a schematic diagram of the InDel molecular marker location and upstream and downstream specific primers.

[0039] Figure 2 These are the molecular marker identification results of different leaf color plants in the crape myrtle leaf color group.

[0040] Figure 3 These are the results of molecular marker identification among different Lagerstroemia indica germplasms. Detailed Implementation

[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. In the embodiments provided in this specification, where specific techniques or conditions are not specified, they are performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0042] To screen Lagerstroemia indica germplasm with perennial purple leaves better and faster and to achieve molecular marker-assisted selection breeding of Lagerstroemia indica, the Lagerstroemia indica cultivar 'Arapahoe' with green leaves and the cultivar 'Ebony Embers' with purple leaves were re-sequenced, and two leaf color mixed pools were constructed from the F1 leaf color segregation population for sequencing. Subsequently, through BSA combined with RNA-seq and targeted metabolomics analysis, a 32-bp specific deletion was found at positions 789,140-789,171 bp on chromosome 12 of purple-leaved Lagerstroemia indica. This deletion was also found in perennial purple-leaved Lagerstroemia indica cultivars such as 'Ebony Fire', 'Ebony Glow', 'Ebony and Ivory' and purple-leaved lines of hybrid offspring, but not in cultivars with purple young leaves and green mature leaves ('Dynamite', 'RedRocket', 'Whit III') and cultivars with perennial green leaves ('Arapahoe', 'Pocomoke', 'Pink Beauty') and green-leaved lines of hybrid offspring. For the 32-bp deletion fragment, a pair of primers was designed. The schematic diagram of the InDel molecular marker position and the upstream and downstream specific primers is as Figure 1 shown. By extracting the DNA of Lagerstroemia indica and using this pair of primers for simple techniques such as PCR amplification, agarose gel electrophoresis and imaging analysis, the present invention can quickly and accurately identify whether the Lagerstroemia indica seedlings are germplasm with perennial purple leaves. This identification method is convenient, fast, efficient, accurate and inexpensive, and is suitable for popularization. The following are more specific examples.

[0043] Example

[0044] Select the tested Lagerstroemia indica germplasm. The tested Lagerstroemia indica germplasm includes the hybrid female parent 'Arapahoe' (M54, with perennial green leaves), the hybrid male parent 'Ebony Embers' (BD4, with perennial purple leaves), the 'Arapahoe' × 'Ebony Embers' F1 population (79 plants), 'Ebony Embers' × No. 32 (No. 32 in the M54×BD hybrid population, with perennial purple leaves), hybrid offspring lines B1-B9 and B40-B42 (with perennial purple leaves) and B110-B112 (with green leaves), perennial purple-leaved cultivars 'Ebony Fire', 'Ebony Glow', 'Ebony Embers' and 'Ebony and Ivory', cultivars with purple young leaves and green mature leaves 'Dynamite', 'Red Rocket' and 'Whit III', and cultivars with perennial green leaves 'Arapahoe', 'Pocomoke', 'Pink Beauty', 'Pink Exquisite', 'Pink Elf', 'Exquisite'. All the above materials are preserved by the Lagerstroemia indica research group of Beijing Forestry University.

[0045] 1. Template DNA extraction:

[0046] 0.1 g of crape myrtle leaves were ground with liquid nitrogen, and subsequent steps were performed according to the instructions of the novel plant genomic DNA rapid extraction kit (DN15, Aidlab). The extracted DNA sample was tested for purity and quality by 1% agarose gel electrophoresis and micro-ultraviolet spectrophotometry.

[0047] 2. Preparation of the PCR amplification reaction system:

[0048] The PCR reaction conditions are as follows (25 μl system): 12.5 μl of 2×Rapid Taq Master Mix, 1 μl of 10 μM upstream primer, 1 μl of 10 μM downstream primer, 1 μl of DNA template, and ddH2O to a final volume of 25 μl. Place the reaction tubes in a PCR instrument and proceed with the reaction program as follows:

[0049] 1) Pre-denaturation at 95℃ for 3 minutes;

[0050] 2) Denaturation at 95℃ for 15 seconds;

[0051] 3) Annealing temperature: 61℃, annealing time: 15s;

[0052] 4) Extend at 72℃ for 30 seconds;

[0053] 5) Repeat steps 2), 3), and 4) 35 times;

[0054] 6) Extend at 72℃ for 2 minutes;

[0055] 7) Store at 4℃.

[0056] 3. Agarose gel electrophoresis:

[0057] Electrophoresis was performed on a 1% agarose gel, and the band positions were indicated by a 2,000 bp DNA marker. The electrophoresis time could be extended as needed until the marker was completely separated and the two bands of the amplified product were completely separated. Finally, the gel was imaged on a gel imaging system.

[0058] 4. Result determination:

[0059] Observe the amplified bands. If there are two bands (224 bp and 192 bp) or only one 192 bp band, the variety is a heritable perennial purple-leaved crape myrtle. If there is only one 224 bp band, the variety is a crape myrtle with purple young leaves and green mature leaves or perennial green leaves.

[0060] In this embodiment, amplification was performed on 40 purple-leaf progeny and 39 green-leaf progeny. The molecular marker identification results of plants with different leaf colors in the crape myrtle leaf color population are as follows: Figure 2 As shown, the samples included: 79 plants from the 'Arapahoe' × 'Ebony Embers' F1 population, and lines B1-B9 and B40-B42 (purple leaves) from the 'Ebony Embers' × 32 lineage (line 32 in the F1 population). Lines B1-B110-B112 (green leaves) were also included. Molecular marker identification results among different Lagerstroemia indica germplasms are shown below. Figure 3 As shown, the samples include: 'Ebony Fire' (BD1), 'Ebony Glow' (BD2), 'Ebony Embers' (BD4), 'Ebony and Ivory' (BD5), 'Dynamite' (DY), 'Red Rocket' (HHJ), 'Whit III' (TER), 'Arapahoe' (M54), 'Pocomoke' (M52), 'Bright Pink Beauty' (BFJR), 'Pink Delicate' (FLL), 'Pink Elf' (FJL), and 'Delicate' (LL).

[0061] The results showed that the purple-leaved progeny all contained two bands in the electrophoresis results—224 bp and 192 bp, respectively, while the green-leaved progeny contained only one 224 bp band. The lines containing only the 192 bp band were extremely stunted with purplish-black leaves and often died after one year of growth. Electrophoresis results of four perennial purple-leaved varieties, three young-leaved purple-mature-leaved green varieties, and six perennial green-leaved varieties showed that the perennial purple-leaved varieties ('Ebony Fire', 'Ebony Glow', 'EbonyEmbers', 'Ebony and Ivory') all had two bands (224 bp and 192 bp), while the young-leaved purple-mature-leaved green varieties ('Dynamite', 'Red Rocket', 'Whit III') and the six perennial green-leaved varieties ('Arapahoe', 'Pocomoke', 'Binfen Jiaren', 'Fen Linglong', 'Fen Jingling', 'Linglong') had only one 224 bp band.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker associated with the purple leaf trait in Lagerstroemia indica, characterized in that, The molecular marker is an insertion or deletion of the sequence shown in SEQ ID No. 1 after the 62nd base of the sequence shown in SEQ ID No.

2.

2. The molecular marker of claim 1, wherein If the 32bp sequence is deleted, it is identified as a Lagerstroemia indica variety with perennial purple leaves; if the 32bp sequence is not deleted, it is identified as a Lagerstroemia indica variety with purple young leaves and green mature leaves or a Lagerstroemia indica variety with perennial green leaves.

3. Use of the primer for detecting the molecular marker of claim 1 in identifying the purple leaf trait of Lagerstroemia indica.

4. Use according to claim 3, characterized in that, The primer is shown in SEQ ID No. 3 and SEQ ID No.

4.

5. A method for identifying the purple leaf trait of C. rosea, characterized by, It comprises: PCR amplification of the genomic DNA of the sample to be tested using the primer of claim 4; Agarose gel electrophoresis is used to detect the amplification product, if there are bands at 224bp and 192bp at the same time, or only at 192bp, it is identified as a Lagerstroemia indica variety with perennial purple leaves; if there is only a band at 224bp, it is identified as a Lagerstroemia indica variety with purple young leaves and green mature leaves or a Lagerstroemia indica variety with perennial green leaves.

6. The method of claim 5, wherein, The program of the PCR amplification is as follows: (1) 95℃ pre-denaturation for 3min; (2) 95℃ denaturation for 15s; (3) 61℃ annealing for 15s; (4) 72℃ extension for 30s; (5) cycle steps (2), (3), (4) for 35 times; (6) 72℃ extension for 2min.

7. Use of the primer for detecting the molecular marker of claim 1, the use of claim 3 or 4, or the method of claim 5 or 6 in genetic breeding related to the purple leaf trait of Lagerstroemia indica or analysis of germplasm resources related to the purple leaf trait of Lagerstroemia indica.

Images