SNP loci associated with wheat salt tolerance and their application in predicting wheat salt tolerance

Abstract

This invention discloses a SNP locus associated with wheat salt tolerance and its application in predicting wheat salt tolerance, belonging to the field of molecular marker breeding technology. The SNP locus of this invention is located at position 1655 of the CDS region of the TaHKT1;1-B gene. When the base at this locus is G, the corresponding wheat is salt-tolerant; when the base at this locus is A, the corresponding wheat is not salt-tolerant. Based on this SNP locus, a method for predicting wheat salt tolerance has been developed, which can predict the maximum relative root length of wheat after salt stress, saving costs, improving selection efficiency, and thus accelerating the breeding process. This provides new potential opportunities for efficient screening of superior alleles and the breeding of salt-tolerant and drought-resistant wheat varieties.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker breeding technology, specifically involving SNP sites related to wheat salt tolerance traits and their application in predicting wheat salt tolerance. Background Technology

[0002] Wheat, as one of the world's major food crops, has its yield and quality directly impacting food security. However, soil salinization is a significant factor limiting wheat production. Globally, approximately 20% of irrigated farmland is affected by salinization, leading to a significant decline in wheat yields. Therefore, developing salt-tolerant wheat varieties is an important way to address the challenges of salinization and increase wheat production.

[0003] Salt tolerance in wheat is a complex quantitative trait regulated by multiple genes. These genes are involved in various physiological processes, including ion homeostasis, osmotic regulation, and antioxidant defense. Traditional breeding methods rely on phenotypic selection, but because salt tolerance is greatly influenced by the environment, phenotypic selection is inefficient and time-consuming. Therefore, developing molecular markers related to salt tolerance can accelerate the breeding process of salt-tolerant wheat varieties.

[0004] Molecular marker technology is an important tool in modern agricultural breeding, enabling the direct detection of genes or genomic regions associated with target traits. Commonly used molecular markers include SSRs (simple sequence repeats), SNPs (single nucleotide polymorphisms), and AFLPs (amplified fragment length polymorphisms). These marker technologies have been widely applied in wheat genetic diversity analysis, gene mapping, and marker-assisted selection (MAS).

[0005] In recent years, with the rapid development of genomics and bioinformatics technologies, researchers have identified numerous QTLs (quantitative trait loci) and candidate genes related to salt tolerance in wheat. However, the number of existing molecular markers is limited, and the stability and applicability of most markers still require further validation. Therefore, developing molecular markers related to wheat salt tolerance not only provides efficient and stable molecular tools for wheat salt tolerance breeding, but the application of these markers will also significantly improve the efficiency and accuracy of wheat salt tolerance breeding, making an important contribution to addressing the global challenge of soil salinization and ensuring food security. Summary of the Invention

[0006] To address the problems existing in the prior art, the purpose of this invention is to provide SNP sites related to wheat salt tolerance traits and their application in predicting wheat salt tolerance.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The SNP site associated with salt tolerance in wheat is located at position 1655 of the CDS region of the TaHKT1;1-B gene. When the base at this site is G, the CDS sequence of the TaHKT1;1-B gene is as shown in SEQ ID NO:1, and the corresponding wheat is wheat with salt tolerance. When the base at this site is A, the CDS sequence of the TaHKT1;1-B gene is as shown in SEQ ID NO:2 or SEQ ID NO:3, and the corresponding wheat is wheat without salt tolerance.

[0009] The application of the above-mentioned SNP sites associated with wheat salt tolerance traits in predicting wheat salt tolerance.

[0010] Based on the above scheme, the salt tolerance trait is that the maximum relative root length is relatively long after salt stress during the wheat germination period.

[0011] A method for predicting wheat salt tolerance involves determining the base class at position 1655 of the CDS region of the wheat TaHKT1;1-B gene. When the base at this position is G, the CDS sequence of the TaHKT1;1-B gene is as shown in SEQ ID NO:1, and the corresponding wheat is wheat with salt tolerance. When the base at this position is A, the CDS sequence of the TaHKT1;1-B gene is as shown in SEQ ID NO:2 or SEQ ID NO:3, and the corresponding wheat is wheat without salt tolerance.

[0012] Based on the above scheme, using the cDNA of the wheat to be tested as a template, a nucleic acid fragment containing the 1655th base of the CDS region of the TaHKT1;1-B gene was amplified by PCR using specific primers. By detecting the type of base at this site, it was determined whether the wheat to be tested is a wheat with salt tolerance.

[0013] Based on the above scheme, the specific primers consist of two left primers shown in SEQ ID NO:4 and SEQ ID NO:5 and one right primer shown in SEQ ID NO:6.

[0014] Based on the above scheme, different fluorescent labels were set at the 5' ends of the two left primers; after PCR amplification, the data were read using fluorescence typing software.

[0015] Based on the above scheme, the 5' ends of the two left primers, Allele-specific primer 1 and Allele-specific primer 2, are respectively equipped with two different fluorescent labels, FAM and HEX.

[0016] Based on the above scheme, the PCR reaction system is as follows: 5 μL of cDNA from the wheat sample to be tested at a concentration of 100 ng / μL, 5 μL of HiGeno 2x Probe Mix and 0.14 μL of SNP-Specific Primers, and ddH2O is added to make up to 10 μL;

[0017] The preparation method of SNP-Specific Primers is as follows: Mix 12 μL of 100 μM Allele-specific primer 1-FAM, 12 μL of 100 μM Allele-specific primer 2-HEX, and 30 μL of 100 μM Common,reverse primer, and add ddH2O to make up to 100 μL.

[0018] Based on the above scheme, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61-55℃ for 40 s, 10 cycles, with a decrease of 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, 28 cycles, and storage at 4℃.

[0019] Advantages of the technical solution of this invention:

[0020] This invention, based on genetic variation analysis of the TaHKT1;1-B gene in natural wheat populations, obtained a SNP locus associated with wheat salt tolerance and developed a method for predicting wheat salt tolerance, providing a new tool for wheat breeding work and helping to achieve new breakthroughs and development in the field of wheat breeding.

[0021] The method of this invention can predict the maximum relative root length of wheat after salt stress, saving costs, improving selection efficiency, and thus accelerating the breeding process. It provides new potential opportunities for the efficient screening of superior alleles and the breeding of salt- and drought-resistant wheat varieties.

[0022] Furthermore, by analyzing the superior allelic variations of the TaHKT1;1 gene, we can gain a deeper understanding of its specific function and mechanism of action in wheat's salt stress response. This will help to improve the molecular regulatory network of wheat salt tolerance and reveal the mechanisms of physiological and biochemical changes in wheat under salt stress conditions. Attached Figure Description

[0023] Figure 1 Genotyping results of the tested wheat varieties read by fluorescence genotyping software;

[0024] Figure 2 The results show the comparison of the maximum relative root length of different genotypes of wheat varieties after germination salt stress. Detailed Implementation

[0025] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. The following embodiments are merely illustrative and are not intended to limit the scope of the invention in any way.

[0026] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the experimental materials, reagents, and chemicals used in the following embodiments can be obtained through general channels.

[0027] In the following examples, the maximum relative root length refers to the ratio of the average maximum root length measured in the treatment group to the average maximum root length measured in the control group; the calculation formula is: maximum relative root length = average maximum root length of the treatment group / average maximum root length of the control group.

[0028] Example 1

[0029] The SNP locus associated with salt tolerance in wheat is located at position 1655 of the CDS region of the TaHKT1;1-B gene. When the base at this locus is G, the CDS sequence of the TaHKT1;1-B gene is shown in SEQ ID NO:1, and the genotyping result is TaHKT1;1-B-Hap I. The corresponding wheat is a wheat with salt tolerance, and its maximum relative root length after salt stress during germination is relatively long. When the base at this locus is A, the CDS sequence of the TaHKT1;1-B gene is shown in SEQ ID NO:2 or SEQ ID NO:3, and the genotyping result is TaHKT1;1-B-Hap II or TaHKT1;1-B-Hap III. The corresponding wheat is a wheat without salt tolerance, and its maximum relative root length after salt stress during germination is relatively short.

[0030] SEQ ID NO:1(5'→3')

[0031]

[0032] SEQ ID NO:2(5’→3’)

[0033]

[0034] SEQ ID NO:3(5’→3’)

[0035]

[0036] Example 2

[0037] The primer set for detecting the SNP site described in Example 1 includes two left primers shown in SEQ ID NO:4 and SEQ ID NO:5 and one right primer shown in SEQ ID NO:6; the 5' ends of the two left primers are respectively equipped with different fluorescent labels, the specific sequences of which are as follows:

[0038] Allele-specific primer 1-FAM:

[0039] 5'-FAM-GAAGGTGACCAAGTTCATGCTGGTTCAAGGCGTACACCCTCAG-3' (SEQ ID NO: 4);

[0040] Allele-specific primer 2-HEX:

[0041] 5'-HEX-GAAGGTCGGAGTCAACGGATTGGTTCAAGGCGTACACCCTCAA-3' (SEQ ID NO: 5);

[0042] Common, reverse primer: 5'-CGGTGCTGTCCTTCTACATGGATGC-3' (SEQ ID NO: 6).

[0043] The nucleic acid sequences amplified by the allele-specific primer 1-FAM (left primer) and the common, reverse primer (right primer) are shown in SEQ ID NO:7.

[0044] SEQ ID NO:7(5'→3')

[0045] GAAGGTGACCAAGTTCATGCTGGTTCAAGGCGTACACCCTCAGAGGGAAGAAAAC CCTGAATGTGCATCCATGTAGAAGGACAGCACCG

[0046] The nucleic acid sequences amplified by the Allele-specific primer 2-HEX left primer and the Common, reverse primer right primer are shown in SEQ ID NO:8.

[0047] SEQ ID NO:8(5'→3')

[0048] GAAGGTCGGAGTCAACGGATTGGTTCAAGGCGTACACCCTCAAAGGGAAGAAAA CCTGAATGTGCATCCATGTAGAAGGACAGCACCG

[0049] Example 3

[0050] Application of SNP sites in Example 1 and primer sets in Example 2 in predicting wheat salt tolerance

[0051] (1) Extract total RNA from wheat leaves to be tested and reverse transcribe it into cDNA as a template; the extraction method can be the existing method, or the following method can be used:

[0052] ① Take fresh wheat leaves, quickly freeze them in liquid nitrogen, and then grind them into powder using a mortar and pestle.

[0053] ② Transfer the ground powder to an RNase-free centrifuge tube, add 1 mL of TRIzol reagent, mix thoroughly, and let stand at room temperature for 5 minutes.

[0054] ③ Add 0.2 mL of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 3 minutes. Centrifuge at 12,000 × g for 15 minutes at -4℃. The sample will separate into three layers, with RNA in the upper aqueous phase.

[0055] ④ Transfer the upper aqueous phase to a new centrifuge tube, add 0.5 mL of isopropanol, mix gently, and let stand at room temperature for 10 minutes. Centrifuge at -4℃ for 12,000×g for 10 minutes, and the RNA will precipitate at the bottom of the tube.

[0056] ⑤ Discard the supernatant, add 1 mL of 75% ethanol, and mix gently. Centrifuge at -4℃ for 7,500×g for 5 minutes, and discard the supernatant.

[0057] ⑥ Dry the RNA precipitate at room temperature for 5-10 minutes, then add 20-50 μL of DEPC water to dissolve the RNA.

[0058] ⑦ Use a spectrophotometer or fluorometer to determine the RNA concentration and purity. The A260 / A280 ratio should be between 1.8 and 2.0.

[0059] ⑧ Prepare the reverse transcription reaction system: Prepare the following reaction system in an RNase-free centrifuge tube (20 μL system as an example): RNA template 1-5 μL; Oligo(dT) primer / random primer 1 μL; dNTPs (10 mM each) 1 μL; DEPC water to a final volume of 12 μL. Mix gently and centrifuge briefly.

[0060] ⑨ Incubate the reaction tube in a 65°C water bath or PCR instrument for 5 minutes to allow the RNA secondary structure to unwind. Immediately place the reaction tube on ice to cool for 2 minutes.

[0061] ⑩ Add reverse transcriptase and buffer: 4 μL 5× reverse transcription buffer; 1 μL RNase inhibitor; 1 μL reverse transcriptase; DEPC water to a final volume of 20 μL. Mix gently and centrifuge briefly.

[0062] Place the reaction tubes in a PCR instrument or water bath and perform the reaction under the following conditions: 25°C, 5-10 minutes (primer annealing); 42°C, 50-60 minutes (cDNA synthesis); 70°C, 15 minutes (enzyme inactivation). After the reaction is complete, immediately place the reaction tubes on ice.

[0063] After reverse transcription, the cDNA can be used directly in subsequent experiments. For long-term storage, the cDNA can be stored at -20℃ or -80℃.

[0064] (2) Using the cDNA of the wheat sample to be tested obtained above as a template, PCR amplification was performed using the primer set of Example 2.

[0065] The PCR reaction system consisted of 5 μL of cDNA (100 ng / μL) from the wheat sample to be tested, 5 μL of HiGeno 2x Probe Mix (Beijing Jiacheng Biotechnology Co., Ltd.), and 0.14 μL of SNP-Specific Primers, with ddH2O added to bring the total volume to 10 μL.

[0066] The preparation method of SNP-Specific Primers is as follows: Mix 12 μL of 100 μM Allele-specific primer 1-FAM, 12 μL of 100 μM Allele-specific primer 2-HEX, and 30 μL of 100 μM right primer (Common, reverse primer), and add ddH2O to make up to 100 μL;

[0067] The PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61–55℃ for 40 s, 10 cycles, decreasing the temperature by 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, 28 cycles. Store at 4℃.

[0068] (3) After the reaction was completed, the obtained PCR amplification products were genotyped based on fluorescence signals using a real-time quantitative instrument (Bio-Rad C1000 TouchThermal Cycler). The excitation wavelength of FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength of HEX was 535 nm and the emission wavelength was 556 nm; and the system reference fluorescence ROX was excitation wavelength 575 nm and the emission wavelength was 610 nm. The genotyping data were read using commonly used fluorescence genotyping software (Bio-Rad CFX Maestro software).

[0069] Specifically: The PCR amplification products of the left primer (Allele-specific primer 1-FAM) carrying the fluorescent sequence FAM and the right primer (Common, reverse primer) were analyzed by software and represented by red dots, indicating that the cDNA sample to be tested was TaHKT1; 1-B-Hap I type; the maximum relative root length of this wheat sample after salt stress during germination was relatively long, indicating that it is salt-tolerant wheat.

[0070] The PCR amplification products of the left primer (Allele-specific primer 2-HEX) carrying the fluorescent sequence HEX and the right primer (Common, reverse primer) were analyzed by software and represented by blue dots, indicating that the cDNA sample to be tested was TaHKT1; 1-B-Hap II or TaHKT1; 1-B-Hap III. The maximum relative root length of this wheat sample after salt stress during germination was relatively short, indicating that it was a salt-intolerant wheat.

[0071] Example 4

[0072] Detection of actual wheat samples

[0073] The method described in Example 3 was used to test 110 wheat samples, and the genotyping results of the TaHKT1;1-B gene of the wheat samples were obtained, as shown in Table 1.

[0074] Table 1. Genotyping results of the TaHKT1;1-B gene in 110 natural wheat populations.

[0075]

[0076]

[0077]

[0078] (Note: HapⅠ represents TaHKT1; 1-B-Hap I, Hap II and Ⅲ represent TaHKT1; 1-B-Hap II or TaHKT1; 1-B-Hap Ⅲ).

[0079] The genotyping results of some wheat samples in Table 1 were read using fluorescence genotyping software (QuantStudio Design & Analysis Software). Figure 1 As shown, red dots indicate that the DNA sample to be tested is TaHKT1; 1-B-Hap type I, and blue dots indicate that the sample to be tested is TaHKT1; 1-B-Hap type II or TaHKT1; 1-B-Hap type III.

[0080] Wheat materials from Table 2 were treated with 160 mmol salt for three days after germination, and samples were collected for testing. Untreated wheat was used as a control group. The maximum root length before and after salt stress was measured for different genotypes of wheat, and the maximum relative root length after salt stress was calculated. The results are shown below. Figure 2 As shown, the maximum relative root length of haplotype TaHKT1;1-B-Hap I wheat after salt stress during germination was significantly greater than that of haplotype TaHKT1;1-B-Hap II / Hap III wheat after salt stress during germination.

[0081] The above test results show that the typing results are good, and the SNP sites in Example 1 can be further applied to the detection of breeding materials.

[0082] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. The application of SNP sites associated with wheat salt tolerance traits in predicting wheat salt tolerance, characterized in that, The SNP site is located at TaHKT1;1-B At position 1655 of the gene's CDS region, when the base at this site is G, the... TaHKT1;1-B The CDS sequence of the gene is shown in SEQ ID NO:1, and the corresponding wheat is a type of wheat with salt tolerance; when the base at this site is A, the... TaHKT1;1-B The CDS sequence of the gene is shown in SEQ ID NO:2 or SEQ ID NO:3, and the corresponding wheat is wheat that does not have the salt tolerance trait; the salt tolerance trait is the longer maximum relative root length after salt stress during the germination period of wheat.

2. A method for predicting wheat salt tolerance, characterized in that, Determining wheat TaHKT1;1-B The base class at position 1655 of the gene's CDS region; when the base at that position is G, the... TaHKT1;1-B The CDS sequence of the gene is shown in SEQ ID NO:1, and the corresponding wheat is a type of wheat with salt tolerance; when the base at this site is A, the... TaHKT1;1-B The CDS sequence of the gene is shown in SEQ ID NO:2 or SEQ ID NO:3, and the corresponding wheat is wheat that does not have the salt tolerance trait; the salt tolerance trait is the longer maximum relative root length after salt stress during the germination period of wheat.

3. The method for predicting wheat salt tolerance according to claim 2, characterized in that, Using the cDNA of the wheat sample as a template, specific primers were used for PCR amplification of cDNA containing... TaHKT1;1-B The nucleic acid fragment at position 1655 of the CDS region of the gene is used to determine whether the wheat being tested has the salt tolerance trait by detecting the type of base at this site.

4. The method for predicting wheat salt tolerance according to claim 3, characterized in that, The specific primers consist of two left primers shown in SEQ ID NO:4 and SEQ ID NO:5 and one right primer shown in SEQ ID NO:

6.

5. The method for predicting wheat salt tolerance according to claim 4, characterized in that, The 5' ends of the two left primers were each labeled with a different fluorescent marker; after PCR amplification, the data were read using fluorescence typing software.

6. The method for predicting wheat salt tolerance according to claim 5, characterized in that, The 5' ends of the two left primers, Allele-specific primer 1 and Allele-specific primer 2, are respectively labeled with two different fluorescent tags, FAM and HEX.

7. The method for predicting wheat salt tolerance according to claim 6, characterized in that, The PCR reaction system consisted of: 5 μL of cDNA from the wheat sample to be tested at a concentration of 100 ng / μL, 5 μL of HiGeno 2x Probe Mix, and 0.14 μL of SNP-Specific Primers, with ddH2O added to bring the total volume to 10 μL. The preparation method of SNP-Specific Primers is as follows: Mix 12 μL of 100 μM Allele-specific primer 1-FAM, 12 μL of 100 μM Allele-specific primer 2-HEX, and 30 μL of 100 μM Common, reverse primer, and add ddH2O to make up to 100 μL.

8. The method for predicting wheat salt tolerance according to claim 6, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61-55℃ for 40 s, 10 cycles, with a decrease of 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, 28 cycles, and storage at 4℃.

Images