Prevention and treatment method for tobacco black shank

Abstract

The invention provides a method for preventing and treating tobacco black shank, which is used for preventing and treating the tobacco black shank by adopting a method of biological breeding, transgenosis, in-vitro application or mixing with other medicaments, and can be used for effectively preventing and treating the tobacco black shank in a seedling stage and a vigorous growth stage. It is proved for the first time that astaxanthin can effectively prevent and treat tobacco black shank, transgenic tobacco of a key gene of astaxanthin shows obvious disease resistance after being inoculated with pathogenic bacteria of the tobacco black shank, but wild control tobacco shows obvious susceptibility. The application of external astaxanthin is carried out on the basis of the transgenic plant, and the tobacco also shows the black shank resistance characteristic.

Description

Technical field

[0001] The present invention relates to the technical field of prevention and treatment of tobacco black tibia, and particularly to a method for prevention and treatment of tobacco black tibia. Background technology

[0002] Tobacco black tibia is caused by the vascular disease caused by the soil-borne oozing bacteria Phytophthora parasitica var.nicotianae, commonly known as tobacco blight, also known as tobacco blight, black root, black stalk madness and aconitia. It is a global tobacco disease and occurs in the Americas, Africa and Asia. It is one of the most devastating diseases in tobacco. Tobacco black tibia has a high incidence rate, rapid spread, and difficult prevention and treatment, causing huge losses to tobacco production every year. The disease is widely distributed in China, among which Yunnan, Guizhou, Sichuan, Henan and Shandong have the most serious incidence. The occurrence of diseases is closely related to varieties, farming types, seedling bed pre-planting, cultivation management, and topography. Tobacco black tibia can infect and harm any stage of fertility of tobacco, but it mainly harms to tobacco. The seedlings are affected in a catastrophic manner. When the tobacco plants are on the rise for a long time, they are manifested as wilting and yellowing of leaves, dwarfing the plant, necrosis of the roots and stem bases, and death of the entire plant in severe cases. When the stem is drawn from the diseased stem, the marrow part can be seen to shrink in the shape of a brown disc, with white mycelium in between. Tobacco black tibia is divided into 4 physiological species according to its pathogenic ability, namely No. 0, No. 1, No. 2 and No. 3. Three physiological species, No. 0, No. 1 and No. 3, were found in the United States, and No. 2 in South Africa. Small species No. 0 and No. 1 are widely distributed worldwide, and the main physiological small species in the tobacco cultivation areas in my country are also No. 0 and No. 1.

[0003] The main prevention and control measures for tobacco black tibia are as follows: breeding disease-resistant varieties, crop rotation, biological control and application of chemical fungicides. Breeding disease-resistant varieties is the most economical and effective way to prevent and treat, but no tobacco varieties that are completely resistant to black tibia have been found. The rapid mutation of Phytophthora tobacco has greatly reduced the disease resistance of existing disease-resistant varieties, leading to a pandemic. Rotation and intercropping with grass crops or non-host crops can reduce the reproduction and accumulation of Phytophthora tobacco in the soil. It is a good measure to control tobacco black tibia, but it is difficult to promote and apply on a large scale. The advantages of chemical pesticides such as storage resistance, convenient transportation, low cost and fast effect are still the main means to prevent and treat tobacco black tibia, but they also lead to serious consequences such as increased bacterial resistance, decreased tobacco leaf quality, environmental pollution, and accumulation of pesticide residues, which are not conducive to the green development of the tobacco industry. Plant metabolites have the advantages of green and environmental protection, and have become a hot topic of research in biological pesticides. Some plant metabolites have also played an important role in the prevention and control of tobacco black tibia. For example, extracts of 19 Chinese medicinal materials such as 19 Chinese medicinal materials, lemongrass essential oil, allicin, etc. have a significant inhibitory effect on the growth of tobacco black tibia bacteria, but there are currently very few commercial preparations that can be used for actual production. Therefore, it is crucial to develop and develop efficient and low-toxic plant-derived fungicides against black tibia.

[0004] Therefore, it is necessary to develop a method for the prevention and treatment of tobacco black tibia. Contents of invention

[0005] The object of the present invention is to provide a method for preventing and treating tobacco black tibia. This method adopts astaxanthin transgenic or in vitro administration to prevent and treat tobacco black tibia, and can effectively prevent and treat tobacco black tibia during the seedling stage and long-term prosperity.

[0006] In order to achieve the above-mentioned object, the present invention adopts the following technical solutions: In a first aspect of the present invention, a method for controlling tobacco black tibia is provided, and the method comprises at least one of the following methods: Method 1: Construct astaxanthin transgenic plants; Method 2: In vitro administration of astaxanthin; Method 3: In vitro, a mixture of astaxanthin and tobacco black tibia prevention and treatment agents were administered.

[0007] Further, the method of constructing an astaxanthin transgenic plant comprises: The key genes CBFD and HBFD of cloned astaxanthin were linked to the expression vector to obtain a recombinant expression vector; The leaves of tobacco seedlings were infected with the Agrobacterium solution containing the recombinant expression vector, and the infected leaves were spread flat on the MS culture medium, cultured at 28°C at dark, and then transferred to a differentiation culture medium with corresponding antibiotics, and cultured under light until callus is produced; The callus tissue is cultured and transferred to the rooting medium to induce rooting. After rooting, it is transferred to soil for continuous cultivation to obtain transformed plants; The transformed plants were genetically identified to obtain tobacco plants that could stably produce astaxanthin.

[0008] Further, the cloned astaxanthin synthesis key genes CBFD and HBFD are linked to the expression vector to obtain a recombinant expression vector, specifically including: The PCR product 1 was obtained by amplifying the CBFD gene using the primers shown in SEQ ID NO.4-5 with the synthetic SEQ ID NO.1 nucleic acid molecule as a template; PCR product 2 was obtained by amplifying the HBFD gene using the primers shown in SEQ ID NO.6-7 with the synthetic SEQ ID NO.2 nucleic acid molecule as a template; Synthesis and obtain the 2A-linked peptide nucleic acid molecule shown in SEQ ID NO.3; The fusion fragment CBFD-2A-HBFD fragment was obtained by amplifying the fusion fragment CBFD-2A-HBFD fragment using the mixture of the 2A-linked peptide nucleic acid molecules as templates; The fusion fragment CBFD-2A-HBFD was cloned into the pENTR-D-TOPO vector using restriction endonuclease sites SacII and AscI; The fusion fragment was recombined to the pBin19-attR-Flag vector containing the 2× CaMV35S promoter (Zhuangmeng Bio, Cat No. ZK1941) by the Gateway® LR Clonase® II Enzyme mix (Invitrogen)-mediated LR reaction to obtain the expression vector pBin-CBFD-2A-HBFD-Flag.

[0009] In the above technical solutions, The LR reaction includes: using the pENTR-D-TOPO vector as an entry clone containing the target gene and a pBin19-attR-Flag vector containing the 2×CaMV35S promoter (Zhuangmeng Bio, Catalog No. ZK1941) and a Gateway LRClonase enzyme to construct an expression clone and obtain the expression vector pBin-CBFD-2A-HBFD-Flag.

[0010] Further, the in vitro administration of astaxanthin comprises: Astaxanthin at a concentration of 90 mg / kg-110 mg / kg was applied to tobacco seeds or plants. Astaxanthin with a concentration of 90 mg / kg-110 mg / kg (the mass of astaxanthin is 0.2%-0.4% of the weight of tobacco seeds) or spray astaxanthin with a concentration of 90 mg / kg-110 mg / kg on tobacco seedlings or seedlings. Astaxanthin of the present invention can be obtained by expressing proteins with recombinant vectors, or can be obtained directly through commercial purchase, and can be used with conventional products. Astaxanthin used in the specific implementation of the present invention was purchased from Shanghai Yuanye Biotechnology Co., Ltd., with the product number: S35114-5g, and the molecular formula of astaxanthin is C 40 H 52 O 4 , CAS number is: 7542-45-2.

[0011] Further, the concentration of 90 mg / kg-110 mg / kg is an astaxanthin aqueous emulsion. The preparation method adopts the conventional astaxanthin aqueous emulsion preparation method. In the embodiment of the present invention, 0.5 g astaxanthin is mixed with 25 mL fish oil (purchased from Baiaoke (Beijing) Biotechnology Co., Ltd., item number: R049116) and 25 mL distilled water, and emulsified using a homogenizer (2000 rpm, emulsified for 5 min) to obtain an aqueous emulsion of about 100 mg / kg of astaxanthin concentration.

[0012] Further, the tobacco black tib disease prevention and control agent includes one of 50% enoylmorpholine compound agent (purchased from Shandong Xinxing Pesticide Co., Ltd., pesticide registration certificate number PD20140127), 80% mancozeb compound agent (purchased from Henan Yongguan Qiaodi Agricultural Technology Co., Ltd., pesticide registration certificate number PD20094560), and 50% fluorine-aluminum compound agent (purchased from Sinochem Agrochemical Co., Ltd., pesticide registration certificate number PD20095462). The mass ratio of the in vitro astaxanthin and tobacco black tibia prevention and control agent is 1:2-4, and the concentration of the astaxanthin is 90 mg / kg-110 mg / kg.

[0013] In a second aspect of the invention, there is provided the use of astaxanthin or an organism containing astaxanthin in the prevention and treatment of tobacco black tibia.

[0014] Further, the astaxanthin-containing organism includes at least one of a nucleic acid molecule containing astaxanthin, a vector capable of expressing astaxanthin, and a transformant containing the vector.

[0015] One or more technical solutions in embodiments of the present invention have at least the following technical effects or advantages: 1. A method for preventing and treating tobacco black tibia provided by an embodiment of the present invention. It adopts biological breeding, genetically modified, in vitro administration or mixed with other agents to prevent and treat tobacco black tibia, and can effectively prevent and treat tobacco black tibia during the seedling stage and long-term prosperity. (1) The present invention proves for the first time that astaxanthin can effectively prevent and treat tobacco black tibia. Transgenic tobacco with the key gene of astaxanthin showed obvious resistance to disease after inoculation with the pathogen of black tibia, but wild-type control tobacco showed obvious sensitivity. Tobacco also exhibits anti-black tibia properties on the basis of transgenic plants. Astaxanthin-transgenic tobacco has obvious resistance to tobacco black tib disease, and the incidence rate is reduced by 70-80% compared with controls. (2) In vitro administration of astaxanthin can also improve the resistance of tobacco.

[0016] 2. The implementation process of the method of the present invention is simple and convenient, environmentally friendly, and has broad application prospects. Attached description of the drawings

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiment will be briefly introduced below. It is obvious that the accompanying drawings in the description of the following description are some embodiments of the invention. For those of ordinary skill in the art, other accompanying drawings can also be obtained based on these accompanying drawings without expending creative labor.

[0018] Figure 1 Growth of wild-type tobacco (left) and astaxanthin-transgenic tobacco (right) for inoculation of black tibia; Figure 2 It is the effect of astaxanthin transgenic on the activities of tobacco CAT, POD, SOD, PPO and PAL; Figure 3 Effects of astaxanthin or astaxanthin, allicin and copper rosinate compound agents on the defense enzyme activity in tobacco in vitro. Specific implementation methods

[0019] The present invention will be specifically explained in the following in light of specific embodiments and examples, and the advantages and various effects of the present invention will be presented more clearly. Those skilled in the art will understand that these specific embodiments and examples are used to illustrate the invention and not to limit the invention.

[0020] Throughout the specification, unless otherwise specified, terms used herein are to be understood as meanings as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as those skilled in the art to which the invention belongs. If there is a contradiction, this manual will take precedence.

[0021] Unless otherwise specified, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through commercial purchase or through existing methods.

[0022] The culture medium formula used in the examples of the present invention is as follows: (1) Differentiation medium MS medium (Murashige and Skoog medium) 4.4 g / L Sucrose 30 g / L Agar 15 g / L 6-BA (cytokinin) 50 mg / L Use KOH to adjust the pH to about 5.8, sterilize at 121°C for 20 min, add 100 mg / L kanamycin and 50 mg / L cephalomycin, and aliquot it to the Petri dish.

[0023] (2) Rooting medium MS medium (Murashige and Skoog medium) 2.2 g / L Sucrose 15 g / L Agar 7.5 g / L Use KOH to adjust the pH to about 5.8, sterilize at 121°C for 20 min, add 100 mg / L kanamycin and 50 mg / L cephalomycin, and aliquot it to the Petri dish.

[0024] The following will be described in detail on the prevention and treatment of tobacco black tibia in this application in light of examples and experimental data.

[0025] Example 1. Construction of astaxanthin transgenic plants and identification of disease resistance 1. Construction of astaxanthin transgenic plants 1. Construction of recombinant expression vectors Cloning astaxanthin synthesis key genes CBFD and HBFD are linked to expression vectors to ensure stable protein expression.

[0026] Table 1 Nucleic acid sequence information of key genes CBFD and HBFD in astaxanthin synthesis CBFD gene sequence (5'-3'): ATGGCTGCTATTTCCGTGTTCTCCACCTTCCTACTCCCTTCCTTCCACAAGAACCTTCCTTCCACTCTAAGCAGGACATTCTCAACAGGCCTTGCCTTCTTTTTCTCTCCAGTGGTGGAGTCTCCAATGAGGAAGAAGAAGAAGACCCACAGAGCAGCTTGCATTTGCTCAGTTGCAGAGAGGACTAGGAACCTTGACATCCCACAGATTGAGGAGGAGGAGGAAA ACGAGGAGGAGCTTATTGAGCAGACCGATTCCGGAATCATCCACATCAAGAAGACTCTCGGAGGAAAGCAGTCTAGGATCTACCGGATCTATCGTGGCTCCAGTTTCTTGCCTCGGAATTCTTTCATGATCGGACCAGTGTACTTCAAGTTCTCCAGGCTCATGGAGTGCGGAGATATTCCAGTTGCAGAGATTTCGCAGCTTTCGTTGCAGCTGCTATT GGAACCGAGTTCCTTTCAGGTTGGTGCATAAGGAGCTTTGGCACGATTCCCTTTGGTACATCCACAAGTCCCACCATAGGTCTAGGAAGGGAAGGTTCGAGTTCAACGACGTTTCGCCATCATCAACGCTCTCCCAGCTATTGCTCTCATCAACGAGGGCTTCTCTAACGAGGGACTTCTTCCAGGAGCTTGTTTCGGAACAGGACTTGGTACTACTA CATCTTCCTCCACAACGGACTCTCTCTCACAGGAGATTCCCAGTGGGACTTATCGCTAACGTGCCATACTTCCATAAGCTTGCAGCTCACCAGATTCACCACTCAGGAAAGTTCCAGGGAGTTCCATTCGGTCTTTCCTTTCCTTGGACCACCAGGAGCTTGAGGAAGTTAGAGGAGGAACTGAGCTTGAGAGGAACTGAGTGATTTCCAGGACTGCTTCCACT (SEQ ID NO.1) HBFD gene sequence (5'-3'): ATGAGGACTCTTCACGGAGCTTGTCTTCCTTGGATCGAAACCAACTCCCTCATTGGAAGCTTGTGAAGGAGACTACCGTGGGTAACACTCCTTGTGTCTCCAACAAGACCCAGAACTCTAGGGTTCTTGTGGGG AGGAACAGGTAAGGTTGGAGGATCTACCGCTTTCGCTCTTTCTAAGTTCTCTCCAGACCTTAGGCTTGTGATTGGAGGAAGGAATAGGGAGAAGGGAGCTGTTGTGTCTAAGTTGGGCGAGAACTCAGAGTTCGTTGAGGTGAACGTGGATAGC ATGAGGTCACTTGAGTCCGCTTTCAAGGACGTTGATCTTGTGGTTCACGCAGGTCCATTTCAACAAGCAGAGAAGTGCACCGTTCTTGAGGCCGCTATTTCTAGGACCGCTTACGTTGACGTGCGATAACACCTTCCTCCATGCAG GCTAAGTCCTTCCACGATAAGGCAGTTGCTGCTAACGTGCCAGCTATTACAGCAGGCATCTTCCCAGGAGTGTCTAACGTGATTGCTGCAGAGCTTGTTAGATCAGCTAGGGATGAGAATACAGAGCCACAGAGGCTTAGGTTCTCTTACTTCA CAGCAGGATCAGGAGGAGCAGGACCAACCTCTCTTGTGACCTCTTTCTTGGAGAGAGGTTGGCTTACTCAGAAGGAGAGAAGGTGGAGCTTAAGCCATACACCGGAAAGCTCAACATCGACTTCGGAAAGGGAGTGGGAAAGAG ACGTTTACCTTGGAACCTTCCAGAAGTTAGGTCAGGACACGAGATCTTGGGAGTGCCAACAGTTTCAGCTAGGTTCGGAACCGCTCCATTCTTTTGGAATTGGGCCATGGTGGCTATGACTTCTCTTCTTCCACCAGGAATCCTCAGGGATAGGAA CATCATCGAGAAGCTCGCTAACTTCGTTTACCATCCGTGCAAGTGTTTGACGGAATTGCAGGAGAGTGCCTTGCTATGAGGGTTGATCTTGAGTGCGCTAACGGAAGGAACACCTTCCGCTATTCTCTCACGAGAGGCTTTCAGAGCTTGTTGGA ACTTCTACCGCCGTTTTCGCTCTTGCTATCCTTGAAGGATCCACTCAAGCAGGAGTTTGGTTCCCAGAAGAGCCAGAGGGAATTGCAGTTGGAGACAGGGAGCTTCTTCTTAAGAGAGCTAGCCAGGGAGCCATCAACTTCATCATCATGAAGCAG (SEQ ID NO.2) 2A-linked peptide gene sequence (5'-3'): AGTCGCGGGGCATGTCAACTCTTGAATTTTGACTTGCTGAAACTGGCTGGCGATGTAGAGTCAAACCCGGTCCG (SEQ ID NO.3) Construction process: The CBFD and HBFD genes were amplified by using the primers CBFD-F / R and HBFD-F / R in Table 2 to synthesize the 2A-linked peptide sequences. The PCR reaction conditions were: pre-denatment of 95℃ for 40s; denaturation of 95℃ for 30s, annealing of 58℃ for 30s, extension of 72℃ for 45s, and 30 cycles; extension after 72℃ for 5 min. PCR product recovery.

[0027] Table 2 Related primer sequences Primer name Primer sequence (5'-3') CBFD-F AAACCGCGGATGGCTGCTATTTCCGTGT (SEQ ID NO.4) CBFD-R GACATGCCCCGCGACTAGTGGAAGACTGAGTCCTCT (SEQ ID NO.5) HBFD-F GTCAAACCCCGGTCCGATGAGGACTCTTCACGGAGC (SEQ ID NO.6) HBFD-R CTGCTTCATGATGAAGTTG (SEQ ID NO.7) The CBFD-2A-HBFD fragment was amplified by CBFD-F / HBFD-R using the recovery product and the 2A synthetic product mixture as templates. The PCR reaction conditions were: pre-denatment of 95°C for 40s; denaturation of 95°C for 30s, annealing of 58°C for 30s, extension of 72°C for 60s, and 30 cycles; extension after 72°C for 5 min. The PCR product was subjected to DNA gel electrophoresis and purified and recovered.

[0028] Utilize restriction enzyme sites Sac II and Asc I cloned the fusion fragment CBFD-2A-HBFD into the pENTR-D-TOPO vector (Invitrogen, K240020), and the fusion fragment was recombined to the pBin19-attR-Flag vector containing the 2× CaMV35S promoter by LR reaction mediated by Gateway® LR Clonase® II Enzyme mix (Invitrogen, K240020) to obtain the expression vector pBin-CBFD-2A-HBFD-Flag. The above expression vector was transferred to Agrobacterium LBA4404.

[0029] 2. Take the leaves of tobacco seedlings that have grown for about 3 weeks, disinfect, remove the main vein, and cut it into a shape of 1*1 cm in size. The above-mentioned leaves were infected with Agrobacterium solution containing the expression vector of interest, and the infected leaves were spread flat on the MS culture medium and cultured at 28°C in the dark. Two days later, it was transferred to a differentiation medium with the corresponding antibiotics and cultured under light until callus was produced. Transfer young tissues to the rooting culture medium to induce rooting, and transfer them to soil for further cultivation after the genetically modified tobacco takes root.

[0030] 3. Transgenic identification of the above-mentioned transformed plants to obtain transformation-positive plants. The expression levels of key genes and key enzyme proteins of astaxanthin synthesis in positive plants were detected to determine the stable expression of target genes in tobacco plants. The content of astaxanthin in the above-mentioned astaxanthin conversion plants was tested to obtain tobacco plants that can stably produce astaxanthin.

[0031] 2. Disease resistance identification The above plants were inoculated with black tibia pathogens. The inoculation method was carried out by the method of irrigated spore suspension of the pathogenic bacteria of black tibia. The specific methods were as follows.

[0032] (1) Activation of black tibia bacteria: Prepare oat culture medium to activate tobacco black tibia bacteria. Weigh 30 grams of oatmeal, add 1000 ml of water, heat it on a boiling water bath for 1 hour, filter the gauze and add water to supplement 1000 ml, add 17-20 grams of agarose and melt it, aliquot and sterilize (121 degrees Celsius, 20 minutes), then pour the plate, cool it and set aside. The preserved tobacco black tibia bacteria were fed onto oat culture medium plates and cultured in a 28°C incubator for 10 days. The vigorously growing white black tibia hyphae can be seen.

[0033] (2) Preparation of zoospore suspension of black tibia bacteria: use 0.1% KNO 3 Soak the mycelium on the plate in the solution, let stand for 24 hours at 25°C, and then let stand for 30 minutes at 4°C, and put KNO 3 Collect the solution into a 50ml test tube and set aside. Use the hemocytometer plate to count and adjust the spore concentration to 1×10 7 1 / mL.

[0034] (3) Tobacco seedlings are inoculated with zoospore suspension of black tibia: 5-6 leaves of astaxanthin-transgenic tobacco seedlings were taken as experimental materials, and wild tobacco seedlings with the same growth period were taken as controls. Use a scalpel to slightly damage the roots, and then each tobacco seedling was irrigated with 10 mL of black tibia spore suspension. The test was repeated three times, with 15 plants per repeating, totaling 45 plants.

[0035] Finally, the incidence of genetically modified astaxanthin tobacco and control tobacco was counted. Three weeks after inoculation, symptoms were observed and counted on astaxanthin transgenic seedlings and wild tobacco seedlings, and the disease index of the two materials was calculated according to the national standard GB / T23224-2008, and resistance evaluation was performed. The specific details of the national standard GB / T23224-2008 are as follows: High resistance or immunity (I): The condition index is 0; Disease resistance (R): The condition index is 0.1-20.0; Middle Anti-anti-Drug (MR): The disease index is 20.0-40.0; Medium sense (MS): The disease index is 40.1-60.0; Sensitive disease (S): The condition index is ≥60. The survey statistics are shown in the table below.

[0036] Table 3 The incidence of astaxanthin-transgenic tobacco black tibia

[0037] From Table 3, it can be seen that astaxanthin transgenic tobacco has obvious resistance to black tibia, while control tobacco shows sensitivity.

[0038] 3. Detection of enzyme activity in astaxanthin transgenic tobacco and wild-type tobacco Astaxanthin transgenic seedlings and wild-type seedlings with 5-6 leaves were taken for irrigated roots by irrigated bacterial fluid. Astaxanthin transgenic seedlings and wild-type seedlings with sterile water were used as controls. Each treatment was 3 replicates, 5 tobacco seedlings were each repeated, and a total of 15 tobacco seedlings were collected at the same location, and the activity of defense enzymes in the body before and after inoculation was detected. The result is Figure 2 It is shown that compared with wild type, the defense enzyme activity in astaxanthin transgenic tobacco is significantly increased, and some enzymes have a more obvious change after inoculation with black tibia.

[0039] Example 2. In vitro administration of astaxanthin 1. Inoculate wild-type tobacco seedlings with 5-6 leaves with black tibia zoospore suspension, use a scalpel to slightly damage the roots, and then each tobacco seedling is subjected to 10 mL of black tibia spore suspension.

[0040] 2. At the 5-day inoculation, the above plants were sprayed with astaxanthin (astaxanthin aqueous emulsion with a concentration of 90 mg / kg-110 mg / kg), and 15 tobacco seedlings in the treatment group were set up, and the astaxanthin concentration was 100 mg / kg; 15 tobacco seedlings in the control group were sprayed with astaxanthin concentration of 0 mg / kg. The test was repeated three times, with a total of 45 strains per treatment.

[0041] 3. After 3 weeks of spraying, the incidence of black tibia in tobacco seedlings in the treatment group and the control group was counted, and the disease index of the two materials was calculated according to the national standard GB / T23224-2008, and resistance evaluation was performed.

[0042] Table 4 Effects of external administration of astaxanthin on the incidence of tobacco black tibia

[0043] Depend on Figure 1 , Table 4 shows that compared with the control group, the treatment group of this application has obvious resistance to black tibia. It is shown that spraying natural astaxanthin directly on tobacco plants can improve tobacco resistance.

[0044] Example 3. In vitro administration of a mixture of astaxanthin and tobacco black tibia prevention and treatment agent 1. Inoculate wild-type tobacco seedlings with 5-6 leaves with black tibia zoospore suspension, use a scalpel to slightly damage the roots, and then each tobacco seedling is subjected to 10 mL of black tibia spore suspension.

[0045] 2. Start spraying the above plants with astaxanthin compound agent (composed of astaxanthin aqueous emulsion with a mass ratio of 1:2 and a concentration of 80% mancozeb compound agent) at 5 days, spraying once every 5 days apart. 15 tobacco seedlings inoculated with black tibia in the treatment group were set up, and the concentration of astaxanthin was sprayed was 100 mg / kg, and the concentration of allicin-copper rosinate was 200 mg / kg. 15 tobacco seedlings in the control group were sprayed, and the concentration of astaxanthin and allicin-copper rosinate was 0 mg / kg. The test was repeated three times, with a total of 45 strains per treatment.

[0046] 3. After 3 weeks of spraying, the incidence of black tibia in tobacco seedlings in the treatment group and the control group was counted, and the disease index of the two materials was calculated according to the national standard GB / T23224-2008, and resistance evaluation was performed.

[0047] Table 5 Effects of external administration of astaxanthin and allicin on the incidence of tobacco black tibia

[0048] As can be seen from Table 5, compared with the control group, the treatment group of this application has obvious resistance to black tibia. The enhancement of partial tobacco defense enzyme activity under the administration of mixed agents showed superposition effect ( Figure 3 ), it shows that mixing astaxanthin with existing chemical control agents for tobacco black tibia can reduce environmental pollution of chemical preparations and enhance drug efficacy.

[0049] The above-mentioned embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above-mentioned embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included within the protection scope of the present invention.

[0050] Finally, it is also to be noted that the term "including", "comprising" or any other variation thereof is intended to cover non-exclusive inclusions such that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also elements inherent to such processes, methods, article or device.

[0051] Although embodiments of the invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned of the basic inventive concepts. Therefore, the appended claims are intended to be construed as including the embodiments and all changes and modifications that fall within the scope of the invention.

[0052] It is obvious that those skilled in the art can make various modifications and variations of the invention without departing from the spirit and scope of the invention. Thus, if these modifications and variations of the invention fall within the scope of the claims and equivalents of the invention, the invention is also intended to include these modifications and variations.

Claims

1. A method for preventing and treating tobacco black shank, characterized in that: The method comprises at least one of the following: Method 1: Construction of astaxanthin transgenic plants; Method 2: in vitro administration of astaxanthin; Method 3: Apply a mixture of astaxanthin and a tobacco black shank disease control agent in vitro.

2. The method for preventing and treating tobacco black shank according to claim 1, characterized in that: The method for constructing an astaxanthin transgenic plant comprises: The cloned astaxanthin synthesis key genes CBFD and HBFD were connected to the expression vector to obtain a recombinant expression vector; Infecting tobacco seedlings with the Agrobacterium liquid containing the recombinant expression vector, spreading the infected leaves flat on MS medium, culturing them in the dark at 28° C., and then transferring them to a differentiation medium with corresponding antibiotics, and culturing them under light until callus tissue is generated; After the callus tissue is cultured, it is transferred to a rooting medium to induce rooting, and after rooting, it is transferred to soil for further culture to obtain a transformed plant; The transformed plants are subjected to transgenic identification to obtain tobacco plants capable of stably producing astaxanthin.

3. The method for preventing and treating tobacco black shank according to claim 1, characterized in that: The in vitro administration of astaxanthin comprises: The astaxanthin aqueous emulsion with a concentration of 90 mg / kg-110 mg / kg was sprayed on the roots of tobacco plants.

4. The method for preventing and treating tobacco black shank according to claim 1, characterized in that: The tobacco black shank control agent includes one of a compound of methacryloyl morph with a mass fraction of 50%, a compound of mancozeb with a mass fraction of 80%, and a compound of flumorph and aluminum ethylene with a mass fraction of 50%. The mass ratio of the in vitro applied astaxanthin to the tobacco black shank control agent is 1:2-4, and the astaxanthin adopts an astaxanthin aqueous emulsion with a concentration of 90 mg / kg-110 mg / kg.

5. Application of astaxanthin or organisms containing astaxanthin in preventing and treating tobacco black shank disease.

6. The use according to claim 5, characterized in that: The organism containing astaxanthin includes at least one of a nucleic acid molecule containing astaxanthin, a vector capable of expressing astaxanthin, and a transformant containing the vector.

Images