Apoptosis bionic nano-drug delivery carrier as well as preparation method and application thereof
By coupling serine and hydroxyl-containing nanocarriers in nanodelivery vectors with trivalent phosphorus compounds in nanodelivery vectors, imitating cell apoptosis behavior, apoptotic bionic nanodrug delivery vectors were prepared, solving the problem of insufficient biocompatibility and targeting of existing vectors, and achieving higher biosafety and therapeutic functions.
Patent Information
- Application Number
- CN202510131494.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-06
- Publication Date
- 2025-05-09
AI Technical Summary
The existing nanodelivery vectors have poor biocompatibility and insufficient targeting, and are only used as carriers and do not participate in the therapeutic effect, resulting in low utilization.
Apoptotic bionic nanodrug delivery carrier was prepared by coupling the protective group-bearing serine with a hydroxyl-containing nanocarrier using a trivalent phosphorus-containing compound, and then by oxidation and deprotection group reaction. The vector mimics apoptotic behavior, combines PS signaling, enhances biocompatibility and targeting, and imparts therapeutic functions to the vector.
The biosafety and targeting of nanodrug delivery vehicles are improved, the carrier is given therapeutic function, and the drug load and release function is retained.
Smart Images
Figure CN119954987A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of nano drug delivery system, in particular to an apoptosis biomimetic nano drug delivery carrier and a preparation method and application thereof. Background Art
[0002] Nano drug delivery system is a drug delivery system based on nanotechnology, which delivers drugs to specific parts or targets in the body through nanomaterials (such as nanoparticles, nanocapsules, liposomes, etc.) to improve the efficacy of drugs and reduce side effects. Although nano drug delivery systems have significant advantages in drug delivery, there are still many problems to be faced. For example, nanomaterials (such as metal particles or synthetic polymers) may cause toxic side effects or induce immune responses to organisms, thereby affecting safety; there are still many unknowns about the long-term behavior and mechanism of nanomaterials in the body, which may lead to potential risks.
[0003] Most current nano-delivery carriers have poor biocompatibility and insufficient targeting, which limits their application in many aspects. At the same time, nanomaterials only serve as carriers and do not participate in therapeutic effects, so they must be loaded with additional therapeutic drugs, and their utilization rate is low. Summary of the invention
[0004] In order to solve the above technical problems, the present invention provides an apoptosis bionic nano drug delivery carrier and a preparation method and application thereof.
[0005] To achieve the above object, the present invention is implemented according to the following technical solutions:
[0006] One of the technical solutions of the present invention is an apoptosis biomimetic nano drug delivery carrier, the structural formula of which is:
[0007]
[0008] In the formula: the R group is one or more of hydrogen, methyl, serine phosphoyl, 2-hydroxypropyl, sulfobutyl and carboxymethyl; n≥6, and the apoptosis biomimetic nano drug delivery carrier is cyclic and / or chain-shaped.
[0009] Preferably, 6≤n≤10, and the apoptotic bionic nano drug delivery carrier is cyclic; or 50≤n≤500, and the apoptotic bionic nano drug delivery carrier is a mixture of cyclic and chain.
[0010] The second technical solution of the present invention is a method for preparing an apoptosis biomimetic nano drug delivery carrier, comprising the following steps:
[0011] S1. A trivalent phosphorus-containing compound, serine with a protective group and a catalyst in a molar ratio of (2-5):(2-6):1 are mixed in 20 mL of an organic solvent to react; wherein the trivalent phosphorus-containing compound is a phosphorus reagent with a protective group:
[0012]
[0013] In the formula: the R1 group is at least one of methyl, ethyl, nitrile ethyl, tert-butyl, 2-propenyl and benzyl;
[0014] The serine with a protective group is a serine with a protective group on the carboxyl group or the amino group:
[0015]
[0016] In the formula: R2 group is one or more of trityl, benzyl, p-methoxybenzyl, 2,4-dimethoxybenzyl, tert-butyloxycarbonyl, allyloxycarbonyl, p-toluenesulfonyl, 9-fluorenylmethoxycarbonyl and benzyloxycarbonyl; R3 group is one or more of methyl, ethyl, tert-butyl, 2-propenyl, benzyl, p-methoxybenzyl and diphenylmethyl;
[0017] The catalyst is an imidazole compound;
[0018] S2, adding a hydroxyl-containing nanocarrier to the above reaction system for reaction, wherein the molar ratio of the hydroxyl-containing nanocarrier to the trivalent trivalent phosphorus-containing compound is 1:1-1:10; wherein the hydroxyl-containing nanocarrier is a nanocarrier composed of a hydroxyl-containing polymer, and the hydroxyl-containing polymer is one or more of polyvinyl alcohol, polyethylene glycol, polysaccharide and polysaccharide derivatives;
[0019] S3, adding 1-1.2 mL of oxidant to the above reaction system to carry out oxidation reaction;
[0020] S4. Add excess anhydrous ethanol to the above reaction system to precipitate a white solid. The filtered solid is redissolved in pure water or an organic solvent. 1.05-2.0 times the molar amount of the deprotection reagent required for the deprotection reaction is added. Finally, the reaction solution is dialyzed in pure water for 3 days. After freeze-drying, a white solid product is obtained, namely the apoptosis-mimetic nanodrug delivery carrier, and the carrier particle size is 1-1000 nanometers.
[0021] Preferably, the phosphorus reagent with a protecting group is one or more of N,N,N',N'-tetraisopropylphosphoramidite methyl, 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphorodiamidite, tert-butyltetraisopropylphosphorodiamidite, 2-propenyl-N,N,N',N'-tetraisopropylphosphorodiamidite and benzyl-N,N,N',N'-tetraisopropylphosphorodiamidite.
[0022] Preferably, the serine with a protecting group is one or more of N-trityl-L-serine ester, N-tert-butoxycarbonyl-L-serine benzyl ester, allyloxycarbonyl-L-serine methyl ester, N-9-fluorenylmethoxycarbonyl-L-serine methyl ester, N-tert-butoxycarbonyl-L-serine tert-butyl ester and p-toluenesulfonyl-L-serine methyl ester.
[0023] Preferably, the catalyst is one of imidazole hydrochloride, 4,5-dicyanoimidazole and 2-cyanoimidazole.
[0024] Preferably, the oxidant is one of hydrogen peroxide, tert-butyl peroxide and tert-butyl toluene peroxide.
[0025] Preferably, the deprotection reagent is trifluoroacetic acid, Pd / C-hydrogen, sodium hydroxide, lithium hydroxide, sodium methoxide, concentrated ammonia, triethylamine, 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) and one of piperidine.
[0026] Preferably, the organic solvent is one or more of dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), acetonitrile, ethyl acetate and tetrahydrofuran.
[0027] The third technical solution of the present invention is the use of an apoptosis-mimetic nano drug delivery carrier as an anti-inflammatory material or for drug delivery.
[0028] Compared with the prior art, the present invention utilizes trivalent phosphorus compounds to couple serine with a protective group and a hydroxyl-containing nanocarrier, and then obtains an apoptosis-mimetic nanodrug delivery carrier by oxidation and deprotection of the protective group; the apoptosis-mimetic nanodrug delivery carrier of the present invention mimics the behavior of cell apoptosis, combines PS signals with nano drug delivery systems, and utilizes PS to "disguise" nanomaterials as "self" components in the body, thereby reducing harmful immune responses and guiding the production of beneficial immune responses, thereby effectively enhancing biocompatibility; it can effectively improve biosafety and targeting, and at the same time, give the carrier therapeutic functions, and retain the carrier's drug loading and release functions. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 The phagocytic effect of macrophages on the fluorescently labeled apoptotic bionic nano drug delivery carrier in Example 7.
[0030] Figure 2 This is the effect of the apoptosis-mimetic nanodrug delivery carrier of Example 6 on macrophage inflammatory factors.
[0031] Figure 3This is the drug loading condition of the apoptosis-inspired nanodrug delivery carrier.
[0032] Figure 4 The reactants and products of Example 6 were mixed and ground with potassium bromide, and then the functional group structure was detected by Fourier transform infrared spectrometry. DETAILED DESCRIPTION
[0033] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.
[0034] Unless otherwise specified, the raw materials and reagents used in the following examples were commercially available or synthesized according to conventional methods in the art.
[0035] Example 1
[0036] 2.78g N, N, N', N'-tetraisopropylphosphoramidite methyl and 3.61g N-trityl-L-serine methyl ester were added to a 100mL round-bottom flask and dissolved with 20mL dimethyl sulfoxide. 2.08g imidazole hydrochloride was added under ice bath and stirring, and the reaction was continued at low temperature for 0.5 hours, followed by reaction at room temperature for 2 hours. 1.56g β-cyclodextrin was dissolved in 5mL dimethyl sulfoxide and added to the above system, and the reaction was continued for 5 hours. 1mL tert-butyl peroxide was added and reacted for 0.5 hours. A large amount of anhydrous ethanol was added to the reaction system to precipitate a white solid, and the filtered solid was redissolved in pure water, followed by addition of 0.55g sodium methoxide and stirring for 30 minutes. Finally, the reaction solution was dialyzed in pure water for 3 days, and a white solid product was obtained after freeze-drying. The particle size was detected using a laser dynamic scattering instrument, and the average particle size was 1.62±0.31nm.
[0037] Example 2
[0038] In a 100mL round-bottom flask, add 3.03g of tert-butyl tetraisopropyl phosphate diamidite and 2.63g of N-tert-butyloxycarbonyl serine tert-butyl ester, and dissolve them with 15mL of N,N-dimethylformamide. Add 1.73g of 4-cyanoimidazole under ice bath and stirring, continue to react at low temperature for 0.5 hours, and then react at room temperature for 4 hours. Dissolve 1.96g of hydroxypropyl cyclodextrin in 5mL of N,N-dimethylformamide and add it to the above system, and continue to react for 8 hours. Add 1mL of 30% hydrogen peroxide solution and react for 0.5 hours. A large amount of anhydrous ethanol was added to the reaction system to precipitate a white solid. The filtered solid was redissolved in 5mL of N,N-dimethylformamide, and 1.12mL of trifluoroacetic acid was added and stirred for 2 hours. Finally, the reaction solution was dialyzed in pure water for 3 days, and a white solid product was obtained after freeze-drying. The particle size was detected using a laser dynamic scattering instrument, and the average particle size was 1.73
[0039] ±0.42nm.
[0040] Example 3
[0041] Add 2.91g 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphorodiamidite and 3.43g N-9-fluorenylmethoxycarbonyl-L-serine methyl ester to a 100mL round-bottom flask and dissolve with 18mL N,N-dimethylformamide. Add 1.85g imidazole hydrochloride under ice bath and stirring, continue to react at low temperature for 0.5 hours, and then react at room temperature for 3.5 hours. Dissolve 1.43g methyl-β-cyclodextrin in 5mL N,N-dimethylformamide and add to the above system, and continue to react for 10 hours. Add 1.2mL tert-butyl peroxide solution and react for 0.5 hours. Add a large amount of anhydrous methanol to the reaction system to precipitate a white solid. The filtered solid is redissolved in water and 0.2g lithium hydroxide is added and stirred for 3 hours. Finally, the reaction solution is dialyzed in pure water for 3 days, and a white solid product is obtained after freeze-drying. The particle size was measured using a laser dynamic scattering instrument, and the average particle size was 1.79±0.29 nm.
[0042] Example 4
[0043] Add 3.35g benzyl-N,N,N',N'-tetraisopropylphosphorodiamidite and 2.96g N-tert-butyloxycarbonylserine benzyl ester to a 100mL round-bottom flask and dissolve them with 20mL acetonitrile / dimethyl sulfoxide mixed solution. Add 2.13g 4,5-dicyanoimidazole under ice bath and stirring, continue to react at low temperature for 0.5 hours, and then react at room temperature for 3.5 hours. Dissolve 3.5g cyclodextrin polymer in 10mL dimethyl sulfoxide and add it to the above system, and continue to react for 12 hours. Add 1.2mL 30% hydrogen peroxide solution and react for 0.5 hours. Add a large amount of anhydrous ethanol to the reaction system to precipitate a white solid. The filtered solid is redissolved in 5mL N,N-dimethylformamide, and 1.12mL trifluoroacetic acid is added and stirred for 2 hours. Finally, the reaction solution is dialyzed in pure water for 3 days, and a white solid product is obtained after freeze-drying. The particle size was measured using a laser dynamic scattering instrument, and the average particle size was 10.33±1.21 nm.
[0044] Example 5
[0045] 3.05g of tert-butyl tetraisopropyl phosphate diamidite and 2.71g of N-tert-butyloxycarbonyl serine tert-butyl ester were added to a 100mL round-bottom flask and dissolved with 20mL of acetonitrile / tetrahydrofuran mixed solution. 1.51g of imidazole hydrochloride was added under ice bath and stirring, and the reaction was continued at low temperature for 0.5 hours, followed by reaction at room temperature for 2.5 hours. 3.7g of sulfobutyl cyclodextrin was dispersed in 10mL of dimethyl sulfoxide and added to the above system, and the reaction was continued for 18 hours. 1.2mL of 30% hydrogen peroxide solution was added and reacted for 0.5 hours. A large amount of anhydrous ethanol was added to the reaction system to precipitate a white solid, and the filtered solid was redissolved in dimethyl sulfoxide, and 1.5mL of trifluoroacetic acid was added and stirred for 2 hours. Finally, the reaction solution was dialyzed in pure water for 3 days, and a white solid product was obtained after freeze-drying. The particle size was detected using a laser dynamic scattering instrument, and the average particle size was 1.97±0.96nm.
[0046] Example 6
[0047] Add 3.10g of tert-butyl tetraisopropyl phosphate diamidite and 2.75g of N-tert-butyloxycarbonyl serine tert-butyl ester to a 100mL round-bottom flask and dissolve them with 20mL of acetonitrile / tetrahydrofuran mixed solution. Add 0.4g of 4,5-dicyanoimidazole under ice bath and stirring, continue to react at low temperature for 0.5 hours, and then react at room temperature for 2.5 hours. Dissolve the cyclodextrin polymer in 10mL of dimethyl sulfoxide and add it to the above system, then add 0.2g of 4,5-dicyanoimidazole every 10 minutes until the total amount added is 2g, and continue to react for 10 hours. Add 1.31mL of 30% hydrogen peroxide solution and react for 0.5 hours. Add a large amount of anhydrous ethanol to the reaction system to precipitate a white solid. The filtered solid is redissolved in N,N-dimethylformamide, and 1.8mL of trifluoroacetic acid is added and stirred for 1.5 hours. Finally, the reaction solution is dialyzed in pure water for 3 days, and a white solid product is obtained after freeze-drying. The particle size was measured using a laser dynamic scattering instrument, and the average particle size was 9.82±1.22nm.
[0048] After mixing and grinding the reactants and products with potassium bromide, the functional group structure was detected by Fourier infrared spectrometry, such as Figure 4 As shown. Figure 4 It can be seen that compared with the reactants, the product has an increase of 1751 cm -1 and 1250cm -1 The absorption peaks at 340 and 360 correspond to the stretching vibrations of the C=O of the product carboxyl group and the P=O in the phosphate group, respectively.
[0049] Example 7
[0050] Add 3.07g of tert-butyl tetraisopropyl phosphate diamidite and 2.75g of N-tert-butyloxycarbonyl serine tert-butyl ester to a 100mL round-bottom flask and dissolve them with 20mL of dimethyl sulfoxide. Add 1.1g of 4,5-dicyanoimidazole under ice bath and stirring, continue to react at low temperature for 0.5 hours, and then react at room temperature for 2.5 hours. Dissolve 1.23g of β-cyclodextrin in 10mL of dimethyl sulfoxide and add it to the above system, then add 1.1g of 4,5-dicyanoimidazole and continue to react for 10 hours. Add 1.29mL of 30% hydrogen peroxide solution and react for 0.5 hours. Add a large amount of anhydrous ethanol to the reaction system to precipitate a white solid. The filtered solid is redissolved in dimethyl sulfoxide, and 2mL of trifluoroacetic acid is added and stirred for 1 hour. Finally, the reaction solution is dialyzed in pure water for 3 days, and a white solid product is obtained after freeze-drying. The particle size was measured using a laser dynamic scattering instrument, and the average particle size was 1.52±0.48nm.
[0051] Application Example 1
[0052] Redissolve 1 part of the product of Example 7 in pure water, add 1 part of coumarin 6 and stir for 24 hours, and filter to obtain fluorescently labeled apoptosis biomimetic nano drug delivery carrier particles. Similarly, stir and mix 1 part of hydroxypropyl cyclodextrin and 1 part of coumarin 6 in water for 24 hours to obtain ordinary nanoparticles with fluorescent labels. Co-culture these labeled particles with macrophages to observe their uptake. The uptake amount is obtained by calculating the total fluorescence intensity of the cells, which also reflects the targeting effect from the side. Figure 1 As shown, apoptotic bionic nanoparticles have a higher fluorescence uptake than ordinary nanoparticles in the same period of time, which means that apoptotic bionic nanoparticles are targeted to macrophages.
[0053] Application Example 2
[0054] Macrophages stimulated by physiological saline, lipopolysaccharide, apoptosis biomimetic nano drug delivery carrier particles plus lipopolysaccharide in Example 6, and ordinary nanoparticles plus lipopolysaccharide were collected respectively. RNA extraction was performed using an RNA extraction kit (Meiji Bio, item number R4111-03), followed by quantification of RNA concentration by a micro-ultraviolet analysis spectrometer and reverse transcription of RNA into cDNA by a reverse transcription kit (Novizan, item number R223-01), and then referring to the instructions for real-time fluorescence quantitative PCR (Novizan, item number Q312-02), using the cDNA after each group of inversion as a template, adding the primers to be tested and amplifying in the qRT-PCR instrument. At least three parallel experiments were set up for each experiment to detect the expression levels of inflammatory marker genes TNF-α and iNOS in each group. The primer sequences (Shengong Bioengineering) are as follows:
[0055] TNF-α (positive): CCCTCACACTCAGATCATCTTCT;
[0056] TNF-α (anti): GCTACGACGTGGGCTACAG;
[0057] iNOS (positive): GTTCTCAGCCCAACAATACAAGA;
[0058] iNOS (reverse): GTGACGGGTCGATGTCAC;
[0059] like Figure 2 As shown in the figure, lipopolysaccharide, as a typical inflammatory inducing substance, increases the expression of inflammatory cytokines in macrophages. Apoptotic cell biomimetic nanoparticles can effectively reduce the gene expression levels of inflammatory cytokines TNF-α and iNOS induced by LPS, indicating that these nanoparticles have a certain anti-inflammatory effect.
[0060] Application Example 3
[0061] The same as Example 1 was used, but only 0.1 part of coumarin 6 was added as a model drug to test the loading of nanoparticles. Figure 3 As shown, there is no significant difference in the loading of coumarin 6 between apoptotic bionic nanoparticles and ordinary nanoparticles, indicating that the use of apoptotic bionics has no significant effect on the drug loading of nanoparticles.
[0062] In summary, the apoptosis biomimetic nano drug delivery carrier of the present invention can effectively improve biosafety and targeting, while at the same time giving the carrier therapeutic function and retaining the drug loading and release function of the carrier.
[0063] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.
Claims
1. An apoptosis-inspired bionic nano drug delivery carrier, characterized in that: Its structural formula is: In the formula: the R group is one or more of hydrogen, methyl, serine phosphoyl, 2-hydroxypropyl, sulfobutyl and carboxymethyl; n≥6, and the apoptosis biomimetic nano drug delivery carrier is cyclic and / or chain-shaped.
2. The apoptosis-inspired bionic nano drug delivery carrier according to claim 1, characterized in that: 6≤n≤10, and the apoptosis biomimetic nano drug delivery carrier is ring-shaped; or 50≤n≤500, and the apoptosis biomimetic nano drug delivery carrier is a mixture of ring and chain.
3. A method for preparing the apoptosis biomimetic nano drug delivery carrier according to claim 1 or 2, characterized in that: The following steps are involved: S1. A trivalent phosphorus-containing compound, serine with a protective group and a catalyst in a molar ratio of (2-5):(2-6):1 are mixed in 20 mL of an organic solvent to react; wherein the trivalent phosphorus-containing compound is a phosphorus reagent with a protective group: In the formula: the R1 group is at least one of methyl, ethyl, nitrile ethyl, tert-butyl, 2-propenyl and benzyl; The serine with a protective group is a serine with a protective group on the carboxyl group or the amino group: In the formula: R2 group is one or more of trityl, benzyl, p-methoxybenzyl, 2,4-dimethoxybenzyl, tert-butyloxycarbonyl, allyloxycarbonyl, p-toluenesulfonyl, 9-fluorenylmethoxycarbonyl and benzyloxycarbonyl; R3 group is one or more of methyl, ethyl, tert-butyl, 2-propenyl, benzyl, p-methoxybenzyl and diphenylmethyl; The catalyst is an imidazole compound; S2, adding a hydroxyl-containing nanocarrier to the above reaction system for reaction, wherein the molar ratio of the hydroxyl-containing nanocarrier to the trivalent trivalent phosphorus-containing compound is 1:1-1:10; wherein the hydroxyl-containing nanocarrier is a nanocarrier composed of a hydroxyl-containing polymer, and the hydroxyl-containing polymer is one or more of polyvinyl alcohol, polyethylene glycol, polysaccharide and polysaccharide derivatives; S3, adding 1-1.2 mL of oxidant to the above reaction system to carry out oxidation reaction; S4. Add excess anhydrous ethanol to the above reaction system to precipitate a white solid. The filtered solid is redissolved in pure water or an organic solvent. 1.05-2.0 times the molar amount of the deprotection reagent required for the deprotection reaction is added. Finally, the reaction solution is dialyzed in pure water for 3 days. After freeze-drying, a white solid product is obtained, namely the apoptosis-mimetic nanodrug delivery carrier.
4. The method for preparing the apoptosis biomimetic nano drug delivery carrier according to claim 3, characterized in that: The phosphorus reagent with a protecting group is one or more of N,N,N',N'-tetraisopropylphosphoramidite methyl, 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphorodiamidite, tert-butyltetraisopropylphosphorodiamidite, 2-propenyl-N,N,N',N'-tetraisopropylphosphorodiamidite and benzyl-N,N,N',N'-tetraisopropylphosphorodiamidite.
5. The method for preparing the apoptosis biomimetic nano drug delivery carrier according to claim 3, characterized in that: The serine with a protecting group is one or more of N-trityl-L-serine ester, N-tert-butyloxycarbonyl-L-serine benzyl ester, allyloxycarbonyl-L-serine methyl ester, N-9-fluorenylmethoxycarbonyl-L-serine methyl ester, N-tert-butyloxycarbonyl-L-serine tert-butyl ester and p-toluenesulfonyl-L-serine methyl ester.
6. The method for preparing the apoptosis biomimetic nano drug delivery carrier according to claim 3, characterized in that: The catalyst is one of imidazole hydrochloride, 4,5-dicyanoimidazole and 2-cyanoimidazole.
7. The method for preparing the apoptosis biomimetic nano drug delivery carrier according to claim 1, characterized in that: The oxidant is one of hydrogen peroxide, tert-butyl peroxide and tert-butyl peroxide toluene.
8. The method for preparing the apoptosis biomimetic nano drug delivery carrier according to claim 1, characterized in that: The deprotection reagent is one of trifluoroacetic acid, Pd / C-hydrogen, sodium hydroxide, lithium hydroxide, sodium methoxide, concentrated ammonia, triethylamine, 1,8-diazabicyclo[5.4.0]undec-7-ene and piperidine.
9. The method for preparing the apoptosis biomimetic nano drug delivery carrier according to claim 1, characterized in that: The organic solvent is one or more of dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), acetonitrile, ethyl acetate and tetrahydrofuran.
10. Use of the apoptosis biomimetic nano drug delivery carrier as claimed in claim 1 or 2 as an anti-inflammatory material or in drug delivery.