Grape VvbHLH137 gene capable of changing plant fruit shape and its application
By cloning and overexpressing the grape VvbHLH137 gene, the shape of tomato fruit was regulated, which solved the difficult problem of genetic regulation of grape fruit shape, achieved significant changes in fruit shape and increased endogenous hormone content, and met consumers' demand for fruit appearance quality.
Patent Information
- Application Number
- CN202510448475.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-10
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-04-10
AI Technical Summary
Existing research has failed to effectively explain the genetic regulatory mechanism of grape fruit shape, and the genetic factors affecting fruit shape differences have not been fully utilized, resulting in fruit shape improvements being unable to meet consumer demand.
By cloning and overexpressing the grape VvbHLH137 gene, the shape of tomato fruit was regulated, causing the fruit to be longitudinally elongated into an elongated ox-heart shape, increasing the content of gibberellin GA3 and cytokinin tz, and improving the fruit shape to a conical structure with an overall outward bulge at the bottom.
It significantly changes the shape of the plant's fruit, making it elongated longitudinally into an elongated ox heart shape, increases the plant height and leaf length, and increases the content of endogenous hormones to meet consumers' demand for fruit appearance quality.
Smart Images

Figure CN119955816B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biotechnology, and in particular to a grape VvbHLH137 gene capable of changing the shape of plant fruits and its application. Background Art
[0002] Grape( Vitis vinifera Grapes (L.) are an important cultivated fruit tree worldwide, with a long industrial chain and extensive applications for fresh consumption, winemaking, dried fruit, and juice production. my country's grape industry primarily focuses on fresh consumption, and when consumers choose fresh fruit, the appearance and quality of the fruit are the most intuitive considerations, directly impacting the fruit's commercial value and economic benefits.
[0003] Wild grape fruits are usually round. After a long period of natural selection and artificial domestication, cultivated grape fruits have a rich variety of shape variations, including: oblong, oval, round, flat, ovoid, heart-shaped, curved, waisted, etc.
[0004] Grapes with novel and unique shapes are usually more popular with consumers. Therefore, clarifying the developmental regulatory mechanisms that affect fruit shape is of great significance for cultivating fresh-eating grape varieties with excellent quality that meet the needs of the consumer market.
[0005] Fruit shape variation is influenced by numerous factors, including environmental factors such as high temperature and drought, as well as varietal factors (genetic material), tree nutrition, and plant hormones. Exogenous plant hormone treatment can improve fruit shape, but genetic factors play a decisive role. Therefore, in-depth research on the molecular mechanisms regulating fruit shape and identifying the factors influencing traits through internal genetic mechanisms is the fundamental approach to improving grape shape.
[0006] bHLH transcription factors are the second largest transcription factor family in plants and play an important role in signal transduction, adverse stress, anthocyanin biosynthesis and plant growth and development.
[0007] Existing studies have found that Arabidopsis AtbHLH137 The gene directly targets cell cycle regulators and regulates Arabidopsis cell expansion and cell cycle progression in a cytokinin-dependent manner, thereby promoting the longitudinal growth of Arabidopsis pods. [1] .
[0008] Existing research has found that grape HkDJ Many genes are involved in regulating the synthesis and metabolism of anthocyanins in the peel and the metabolism of active oxygen during fruit ripening. [2-3] , no reports so far HkDJ Research results on genes involved in regulating grape berry shape.
[0009] References:
[0010] [1] Park J, Lee S, Park G, et al. Cytokinin-Responsive GrowthRegulatorregulates cell expansion and cytokinin-mediated cell cycle progression[J]. Plant Physiology ,2021, 186(3): 1734-1746.
[0011] [2] Fasoli M, RichterC L, Zenoni S, et al. Timing and order of themmolecular events marking the onset of berry ripening in grapevine[J]. Plant Physiology , 2018, 178(3):1187-1206.
[0012] [3] Sun L, Li SC, Tang XP, et al. Transcriptome analysis reveal theputative genes involved in light-induced anthocyanin accumulation in grape'Red Globe'( V.vinifera L.)[J]. Gene ,2020, 728:144284.
[0013] The information disclosed in the background section is only intended to enhance understanding of the overall background of the invention and should not be considered as an admission or any form of suggestion that the information constitutes the prior art already known to a person of ordinary skill in the art. Summary of the Invention
[0014] In response to the above-mentioned technical problems, the present application provides a grape VvbHLH137 gene capable of changing the shape of plant fruits and its application. The gene can increase the longitudinal length of tomato fruits and regulate their fruit shape. After regulation, the tomato fruit shape has a distinct bottom and tip with a uniform convex structure, changing from the original round shape to an elongated bull heart shape.
[0015] The present application provides a grape VvbHLH137 gene capable of changing the shape of plant fruits. The nucleotide sequence of the VvbHLH137 gene is shown in SEQ ID NO.1.
[0016] Preferably, the plant fruit is a tomato fruit.
[0017] Preferably, it is used to increase the content of gibberellin GA3 and cytokinin tz in tomato fruits.
[0018] Preferably, the tomato fruit shape is improved in that the bottom as a whole bulges outward to form a conical bulge structure, and the overall shape of the fruit is an elongated ox heart shape.
[0019] Preferably, it is used to improve the height of tomato plants and the length of their leaves.
[0020] Preferably, the amino acid encoded by the VvbHLH137 gene is shown in SEQ ID NO.2.
[0021] Another aspect of the present application provides a use of a recombinant expression vector in regulating tomato fruit shape, wherein the recombinant expression vector contains the nucleotide sequence of the above-mentioned VvbHLH137 gene as shown in SEQ ID NO.1.
[0022] Another aspect of the present application provides an application of an engineered bacterium in regulating tomato fruit shape, wherein the engineered bacterium comprises the nucleotide sequence of the above-mentioned VvbHLH137 gene as shown in SEQ ID NO.1.
[0023] Another aspect of the present application provides a method for regulating tomato fruit shape, comprising overexpressing the nucleotide sequence of the VvbHLH137 gene as shown in SEQ ID NO.1.
[0024] The beneficial effects of this application include:
[0025] 1) The grape VvbHLH137 gene, capable of altering fruit shape, and its applications, provided in this application, demonstrate for the first time that the grape-derived VvbHLH137 gene can significantly alter fruit shape, elongating it longitudinally to an elongated bull-heart shape. This is of great significance for a comprehensive understanding of the biological functions of bHLH transcription factors in plants. This invention not only enriches the theory of the regulation of fruit shape during grape fruit development but also has applications in genetic engineering breeding for improved fruit shape.
[0026] 2) The grape VvbHLH137 gene and its application that can change the shape of plant fruits provided in this application; tomato plants overexpressing the VvbHLH137 gene have the characteristics of taller plant height and longer leaf length; the shape of tomato fruits grafted from plants overexpressing the VvbHLH137 gene has the characteristic of forming a conical protrusion at the bottom; and the content of gibberellin GA3 and cytokinin tz in the grafted fruits is significantly higher than that of the wild type. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1The fruit of the strain numbered F2-337 45 days after flowering in the E42-6×Rizamat hybrid F2 population provided in Example 1 of the present application;
[0028] Figure 2 This is an agarose gel electrophoresis detection diagram of the PCR product of the grape VvbHLH137 gene clone in Example 1 provided in this application; wherein: the marker is the DL2000 marker, and the target band is the amplified band result of the VvbHLH137 gene;
[0029] Figure 3 This is the map information of the overexpression vector pSAK778 in Example 2 provided in this application;
[0030] Figure 4 This is a graph showing the results of positive identification of transgenic plants by PCR amplification and agarose gel electrophoresis in Example 3 provided herein; OE1 to OE8 are PCR amplification bands of eight different transgenic tomato lines; the last lane is the DL2000 marker;
[0031] Figure 5 This is a graph showing the relative expression levels of the VvbHLH137 gene in wild-type and transgenic tomato lines in Example 4 provided herein; wherein: WT is the relative expression level of the VvbHLH137 gene in wild-type tomato, and OE1 to OE8 are the relative expression levels of the VvbHLH137 gene in eight different transgenic tomato lines;
[0032] Figure 6 These are phenotypic images of the wild-type tomato plant (WT) and the transgenic tomato line (OE3) obtained in Example 5 of the present application. (a) is a photo of the plant; (b) is a photo of the leaves; (c) is a photo of the mature fruit; and (d) is a photo of the longitudinal section of the mature fruit.
[0033] Figure 7 Graph showing the results of hormone content determination in fruits of the wild type (WT) and the transgenic tomato line (OE3) obtained in Example 5 of the present application. The letters a and b above the bar graph indicate significant differences. DETAILED DESCRIPTION
[0034] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the present invention is not limited in any way. Any changes or improvements made based on the teachings of the present invention fall within the scope of protection of the present invention.
[0035] Example
[0036] Unless otherwise specified, the materials and instruments used in the following examples were obtained from commercial channels; the detection methods used were all existing methods unless otherwise specified.
[0037] Example 1: Construction of grape VvbHLH137 gene overexpression vector and genetic transformation into tomato
[0038] The steps for cloning the VvbHLH137 gene are as follows:
[0039] The experimental materials were obtained from the grape breeding resource garden of the Xinjiang Uygur Autonomous Region Grape and Fruit Research Institute (E42°54'41″, N90°17'17″). 'Xinya', the F1 generation, was obtained through conventional hybridization using 'E42-6' as the female parent and 'Rizamat' as the male parent. 'Xinya' was further self-pollinated to produce the F2 generation. Seeds from the F2 population were obtained in 2012, sown and cultivated into seedlings in 2013, and transplanted in the spring of 2014. A Dulong trellis configuration was adopted, with a north-south orientation and a plant spacing of 0.5 × 4.0 m. Conventional fertilization, watering, and pest and disease management practices were implemented. The hybrid offspring began to produce small amounts of fruit in 2016-2017 and reached stable fruiting in 2018. A phenotypic investigation of fruit agronomic traits was conducted at the Xinjiang Uygur Autonomous Region Grape and Fruit Research Institute from August to September 2019. An F2 generation plant (numbered F2-337) with oblong fruit was selected for further research. In mid-June 2020, fruits 45 days after flowering were collected as sample materials for RNA extraction (e.g. Figure 1 Total RNA was extracted from the fruit using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd.) according to the kit instructions.
[0040] Toyobo reverse transcription kit ReverTra Ace ® qPCR RT Master Mix was used according to the kit instructions to reverse transcribe the obtained total RNA to obtain grape berry cDNA.
[0041] Then, the obtained grape fruit cDNA was used as a template and the high-fidelity enzyme 2×Phanta was used. ® Max MasterMix (Dye Plus) was used for PCR amplification to obtain the coding region sequence of the target gene.
[0042] Based on the VvbHLH137 open reading frame in the existing grape berry cDNA, specific primers containing restriction endonuclease BamHI and XhoI sites were designed using Primer6 software. The primer sequences are as follows:
[0043] Upstream primer: 5'- ATGGATCC ATGGCAGCCTTTTCGTATCAACAC-3′, as shown in SEQ ID NO. 3;
[0044] Downstream primer: 5'- ATCTCGAG TTAATTGAAAGAACACAAGTTGTTG-3′, as shown in SEQ ID NO. 4;
[0045] Reaction system: template cDNA 2 µl, upstream primer 2 µl, downstream primer 2 µl, 2× Phanta Max MasterMix (Dye Plus) 25 µl, ddH2O 19 µl.
[0046] The reaction procedure was as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 58°C annealing for 40 s, 72°C extension for 15 s, 35 cycles; and 72°C full extension for 5 min. The PCR products were detected by electrophoresis on a 1.5% agarose gel. The results were as follows: Figure 2 As shown, the amplified fragment was aligned with the DL2000 marker and the electrophoresis band was about 1000 bp in size. The full length of the coding region sequence of VvbHLH137 is known to be 1050 bp, so the obtained band should be the target band.
[0047] The target fragment was recovered from the agarose gel electrophoresis product obtained in the previous step using a universal DNA purification kit (Tiangen Biochemical Technology Co., Ltd.). The target fragment was then ligated into the pClone007 vector using the pClone007 Versatile Simple Vector Kit (Beijing Qingke Biotechnology Co., Ltd.). The ligated recombinant vector was then transformed into competent Escherichia coli DH5α cells using the standard freeze-thaw method. After identification by PCR, positive clones were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing. Sequencing results revealed a 1050-bp coding region sequence for the target gene, as shown in SEQ ID NO. 1. This sequence showed no base differences compared to the grapevine reference genome, confirming that the nucleotide sequence amplified by PCR was indeed the VvbHLH137 gene sequence. This gene encodes 349 amino acids, as shown in SEQ ID NO. 2.
[0048] SEQ ID NO.1:
[0049] >VvbHLH137 cds:protein_coding
[0050] atggcagccttttcgtatca acacccaccttttcttcttg actcagtttt cttgccgagt 60
[0051] actcccatta agatgtctgg tttatggag ccaccacttg tttctctcag 120
[0052] tttttccctt ctgaatctct tcatgaggtt cctgctgatg ctagggttca tgaaagtcg 180
[0053] tctcttcaac acagctcaaa ggtcactctc agtgacaatg agccttgtgt gacccagaaa 240
[0054] ctgagcacag actcttcgtc agtggtggat aggcttgaac ttggtgaaca ggtcacccag 300
[0055] aaggtggctc ccatagagag ggagagaag aggaagagca gagatgggtc ttccttgact 360
[0056] tctgctcaat cgaaggatgc aagagaaggg aaaggaaaga aggcaaaga aggcagtggt 420
[0057] ctggtgaagg atggagaaga ggagcagctc aaagcagaca agaaggatca gaaaagcc 480
[0058] tctgaagagc ctccaaccgg ctacattcat gtaagagcaa ggaggggcca agcaacagac 540
[0059] agccacagcc ttgcagagag ggtaagagagaaaatca gtgagaggat gaagctcttg 600
[0060] caagcacttg ttcctggttg tgacaaggtt actggaaagg cccttatgtt ggatgaaata 660
[0061] atcaactatg tccagtccct acagaatcaa gtagagttcc tctctatgaa gcttgcttct 720
[0062] gtgaatccta tgttctatga ctttggcatg gacctagatg cactcatggt gaggccagag 780
[0063] agattgagtg ccttgacatc accactgcca tctctgcaac aatgcagtcc ttcccagcc 840
[0064] acagcttatg ctgatacaac caccaccttc actgcaacaa ataactatcc tgttatggac 900
[0065] acttcagctt caattttatt tcaccagggg caaaggctaa atgtcttctc acaggataat 960
[0066] ggtagtctat tgtgggatgt ggatgatcaa agacagaagt tcattaatcc atctggactc 1020
[0067] atcagcaaca acttgtgttc tttcaattaa 1050
[0068] SEQ ID NO.2:
[0069] >VvbHLH137 domain-containing protein OS=Vitis vinifera OX=29760 GN=VIT_17s0000g00430 PE=4 SV=1
[0070] MAAFSYQHPP FLLDSVFLPS TPIKMSGFME EGNTTTCFSQ FFPSESLHEV PADARVHEST 60
[0071] SLQHSSKVTL SDNEPCVTQK LSTDSSSSVVD RLELGEQVTQ KVAPIERERK RKSRDGSSLT 120
[0072] SAQSKDAREG KGKKAKKGSG LVKDGEEEQL KADKKDQKKA SEEPPTGYIH VRARRGQATD 180
[0073] SHSLAERVRR EKISERMKLL QALVPGCDKV TGKALMLDEI INYVQSLQNQ VEFLSMKLAS 240
[0074] VNPMFYDFGM DLDALMVRPE RLSALTSPLP SLQQCSPSQP TAYADTTTTTF TATNNYPVMD 300
[0075] TSASILFHQG QRLNVFSQDN GSLLWDVDDQ RQKFINPSGL ISNNLCSFN 349
[0076] Example 2 Construction of overexpression vector pSAK778-VvbHLH137
[0077] The VvbHLH137 containing the VvbHLH137 gene obtained in Example 1 was cleaved using restriction endonucleases BamHI and XhoI. - pClone007 recombination cloning vector and pSAK778 expression vector (pSAK778 vector map as shown in Figure 3 The VvbHLH137 vector was double-digested with enzymes (as shown) and incubated at 37°C for 6 h. VvbHLH137 was then ligated with the linearized pSAK778 vector using T4 DNA ligase at 25°C overnight and transformed into Escherichia coli DH5α.
[0078] After the correct sequence was verified by bacterial liquid PCR and Sanger sequencing, the plasmid was extracted using the Tiangen plasmid mini kit, and then the recombinant plasmid pSAK778-VvbHLH137 was transformed into Agrobacterium tumefaciens LBA4404. The operation process was as follows: at least 2 μg of plasmid was added to the competent cells of Agrobacterium tumefaciens LBA4404, gently mixed and placed in an ice bath for 5 min, the centrifuge tube was placed in liquid nitrogen for quick freezing for 5 min, and then quickly placed in a 37°C water bath for 5 min, and then the centrifuge tube was returned to the ice bath for 5 min. Finally, 600 ul of antibiotic-free YEP liquid medium (10 g of yeast powder, 10 g of peptone, and 5 g of sodium chloride were dissolved in 1 L of distilled water, the pH value was adjusted to 7.0±0.2, and then sterilized at high temperature) was added under sterile conditions. After shaking and reviving the culture on a shaker at 28°C for 2-3 h, an appropriate amount of concentrated bacterial liquid was spread on YEP solid medium supplemented with rifampicin (Rif) and spectinomycin (Spec), and the culture was continued at 28 The cells were inverted and cultured at 4°C for 2 days. After the single colonies proliferated, PCR was performed to identify the positive colonies.
[0079] Example 3 Construction of tomato genetic transformation system
[0080] The Agrobacterium culture carrying the pSAK778-VvbHLH137 recombinant expression vector was cultured in a shaking incubator at 28°C until the OD 600 nm After the value reached 0.6-0.8, well-growing sterile MicroTom cherry tomato seedlings (cotyledons fully expanded but true leaves not yet emerged) were selected. Wild-type tomato cotyledons were cut using sterile forceps and scissors. The resulting explants were inoculated with Agrobacterium carrying the recombinant vector for 10 minutes. Any residual bacterial solution on the surface was gently removed using sterile filter paper. The explants were then sterilely cultured on MS solid medium (Beijing Solebow Technology Co., Ltd.) containing 1.5 mg / L zeatin under low light conditions. Two days later, the explants were transferred to MS solid medium containing 100 mg / L kanamycin and 1.5 mg / L zeatin and continued to be cultured in a light incubator (16 h light at 25°C / 8 h dark at 18°C). The medium was replaced every two weeks. When the explants formed callus with buds, the zeatin concentration was adjusted to 1.0 mg / L. After adventitious buds developed from the callus, they were separated and transferred to rooting medium (1 / 2 MS solid medium containing 0.1 mg / L auxin and 50 mg / L kanamycin) for further culture. When the explants grew robustly and had well-developed root systems in the rooting medium, leaves from different tomato lines were collected and genomic DNA from the leaves was extracted using a plant genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). PCR amplification and positive plant identification were performed using the DNA as a template. The PCR positive identification primers were:
[0081] 35S-F: 5'-GAAAGGCTATCATTCAAGATCTCTC-3', as shown in SEQ ID NO. 5;
[0082] VvbHLH137-R:5'-ATCTCGAGTTAATTGAAAGAACACAAGTTGTTG-3', as shown in SEQ ID NO.6, the results are as follows Figure 4 As shown, the transgenic plants all showed the target band at around 1000 bp. The full length of the VvbHLH137 coding region is known to be 1050 bp, indicating that the exogenous grape VvbHLH137 gene was successfully inserted into the genome of the 8 identified tomato plants, and they were transgenic positive plants.
[0083] The transgenic tissue culture seedlings were then transferred to a 25°C light incubator for hardening. Two days later, the hardened tissue culture seedlings were transplanted into a nutrient soil pot that had been sterilized at high temperature and high pressure (sterilized at 121°C and 0.1 MPa for 30 min) and fully soaked with water. Cover with plastic film to keep it moist. After the tomato seedlings have passed the seedling acclimatization period and the leaves have fully expanded, remove the plastic film, provide normal temperature and light, and strengthen water, fertilizer, and pest and disease management.
[0084] Example 4 Identification of high-expressing transgenic tomato lines
[0085] Young leaves of the wild-type and transgenic tomato-positive plants obtained in Example 3 were collected. The Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit, the Toyobo Reverse Transcription Kit ReverTraAce® qPCR RT Master Mix, and the Roche Fluorescence Quantification Kit LightCycler® 480 SYBR Green I Master were used to extract tomato total RNA from the plant samples, synthesize cDNA, and perform fluorescence quantitative PCR amplification.
[0086] The tomato internal reference primer sequence is:
[0087] SlActin -F: 5'-GTCCTCTTCCAGCCATCCAT-3', as shown in SEQ ID NO. 7;
[0088] SlActin -R: 5'-ACCACTGAGCACAATGTTACCG-3', as shown in SEQ ID NO. 8;
[0089] The sequences of the fluorescent quantitative primers for the VvbHLH137 gene are:
[0090] VvbHLH137-F: 5′-TGATGTGTGATTGTGTGCCTATC-3′, as shown in SEQ ID NO. 9;
[0091] VvbHLH137-R: 5′-GTGACAATGAGCCTTGTGTGACCC-3′, as shown in SEQ ID NO. 10;
[0092] Use 2 -ΔΔCt The relative expression levels of the VvbHLH137 gene in the leaves of wild-type and transgenic plants were calculated by the PCR method. Three independent biological replicates were set for the expression analysis of all genes. Figure 5 As shown, the expression of VvbHLH137 gene was not detected in wild-type tomato WT; among the 8 transgenic lines, the expression levels of individual plants numbered OE3 and OE5 were relatively high, the expression levels of individual plants numbered OE7 and OE8 were relatively low, and no expression was found in line OE2.
[0093] Example 5 Comparison of fruit shape and hormone content between tomato overexpressing VvbHLH137 and wild-type tomato
[0094] The T2 generation seeds of the transgenic tomato (OE3) with the highest relative gene expression level and the wild-type tomato (WT) were sown in the same nutrient pots of the same size and given the same growth conditions and management measures. For specific management measures, refer to the existing transgenic tomato cultivation. The plant type, leaf morphology, fruit growth and development changes of the tomato plants were closely observed throughout the growth and development period. Figure 6 As shown in Figure 2, compared with wild-type plants, transgenic tomatoes have significant differences in plant morphology, mature leaf color, leaf shape, and mature fruit shape. In comparison, transgenic tomato plants are taller, with the height of transgenic plants being approximately 1.33 times that of wild-type plants (e.g. Figure 6 (a)); The leaves of the transgenic tomato plants were elongated and yellowish in color. The average length of the leaves of the wild-type plants was 5.00 cm, while the average length of the leaves of the transgenic plants increased to 6.86 cm (e.g. Figure 6 (b)); The transgenic tomato fruit was significantly elongated longitudinally, with a uniform convex structure formed on the bottom. The average fruit shape index (fruit length / fruit width) was about 1.45, which resulted in the fruit shape changing to an elongated bull heart shape (e.g. Figure 6 (c) ~ Figure 6 (d)). In addition, the HPLC-MS method was used to detect the gibberellin and cytokinin contents in the mature fruits of wild-type and transgenic plants. Figure 7As shown in the data, the contents of gibberellin GA3 and cytokinin tz in transgenic tomato fruits were significantly higher than those in the wild type. The content of gibberellin GA3 in the wild type tomato fruits was only 5.64 μg / g FW, while the content of gibberellin GA3 in the transgenic tomato fruits was 14.68 μg / g FW; the content of cytokinin tz in the wild type tomato fruits was 0.29 μg / g FW, while the content of cytokinin tz in the transgenic strain fruits was 0.71 μg / g FW.
[0095] The above results indicate that the VvbHLH137 gene can change the shape of plant fruits by increasing the content of endogenous hormones in plants.
[0096] Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A grape-derived gene sequence fragment is used to increase the content of gibberellin GA3 and cytokinin tz in tomato fruit, improve the shape of the tomato fruit to form a conical convex structure with the bottom convex outward, and increase the height of the tomato plant and the length of its leaves, characterized by: The gene sequence fragment is the VvbHLH137 gene, and the nucleotide sequence is shown in SEQ ID NO.
1.
2. Application of a recombinant expression vector in regulating tomato fruit shape, characterized in that: The recombinant expression vector contains the nucleotide sequence of the VvbHLH137 gene as claimed in claim 1 as shown in SEQ ID NO.1; After regulation, the tomato fruit shape has a distinct bottom and tip uniformly convex structure, changing from the original round shape to an elongated ox heart shape.
3. Application of an engineered bacterium in regulating tomato fruit shape, characterized in that: The engineered bacteria comprises the nucleotide sequence of the VvbHLH137 gene as claimed in claim 1 as shown in SEQ ID NO.1; After regulation, the tomato fruit shape has a distinct bottom and tip uniformly convex structure, changing from the original round shape to an elongated ox heart shape.
4. A method for regulating tomato fruit shape, characterized in that: The method comprises: a step of overexpressing the VvbHLH137 gene according to claim 1; after regulation, the tomato fruit shape has an obvious bottom and tip uniformly convex structure, and is transformed from the original round shape to an elongated bull heart shape.