Use of a serpind1 inhibitor in the preparation of a medicament for the treatment of wet age-related macular degeneration

Abstract

The application discloses application of a SERPIND1 inhibitor in preparation of a drug for treating wet age-related macular degeneration. The application finds that SERPIND1 is obviously increased in expression after antagonizing VEGFA in a laser-induced CNV animal model and in CNV. SERPIND1 can be knocked down by a glass cavity injection shRNA in a mouse wet AMD model, so that CNV and inflammation can be obviously inhibited. In an in vitro experiment, siRNA targeting SERPIND1 can inhibit the proliferation, migration, tube formation and other in vitro neovascularization functions of endothelial cells, and inhibit the expression of various inflammatory factors of endothelial cells. In addition, inhibiting SERPIND1 can also reduce the adhesion of immune cells and the migration of vascular endothelial cells, and reduce inflammation. These findings show that targeting SERPIND1 can effectively inhibit the neovascularization and inflammation of wAMD at the same time, suggesting that targeting SERPIND1 can become a new strategy for treating wet AMD, and has important clinical application value.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological medicine, and particularly relates to application of a SERPIND1 inhibitor in preparation of a medicament for treating wet age-related macular degeneration. BACKGROUND

[0002] Age-related macular degeneration (AMD) is also called senile macular degeneration. AMD is one of the important degenerative diseases of the eye, is an important factor leading to visual loss in adults over 50 years old, and is the main cause of irreversible blindness. According to statistics, there were about 196 million AMD patients in the world in 2020, and the number of AMD patients in the world is expected to reach 288 million in 2040. At present, the treatment means and efficacy for AMD are very limited.

[0003] AMD is usually divided into dry AMD and wet AMD (wAMD). wAMD is the main type of AMD blindness, accounting for more than 90% of AMD blindness. Choroidal neovascularization (CNV) is the key pathological manifestation of wAMD, and anti-VEGF is the main method for treating wAMD. However, the current anti-VEGF drugs have many problems, such as that many patients do not respond completely to anti-VEGF treatment, resulting in poor treatment effect; long-term intravitreal injection of anti-VEGF drugs may lead to drug resistance and increase the possibility of occurrence of various complications such as intraocular inflammation; more importantly, anti-VEGF is difficult to solve the problems of inflammation and subretinal fibrosis. At present, many studies have confirmed that wAMD is closely related to the inflammatory process, and the inflammatory response is also a key factor leading to poor anti-VEGF treatment effect in patients. For example, a clinical study with a sample of 60 people pointed out that about 2 / 3 of wAMD patients had a significant increase in the expression level of IL-17, IL-12 and other inflammatory cytokines in the aqueous humor. At the same time, in nearly half of the wAMD patients, the average concentration of IFN-γ and IL-4 was significantly higher than that of the healthy control group, which indicated that many inflammatory factors might be involved in the pathogenesis of wAMD. In addition, studies have shown that in aqueous humor samples of 21 wAMD patients, the expression level of inflammatory factors increased in about 16 patients after anti-VEGF treatment. Therefore, it is urgent to find the key factor for regulating inflammation in the process of wAMD neovascularization to provide a new strategy for treating wAMD.

[0004] SERPIND1 belongs to the superfamily of serpin genes, which play a role in many processes, mainly including inflammation, blood coagulation and cancer metastasis. Previous studies have found that SERPIND1 activates inflammation and affects the progression of primary acute angle-closure glaucoma. However, the role of SERPIND1 in ocular wAMD neovascularization and inflammation has not been reported, and no ophthalmic drug targeting SERPIND1 has entered the clinical research stage. SUMMARY

[0005] The purpose of the present application is to provide the use of SERPIND1 inhibitors in the preparation of drugs for treating wet age-related macular degeneration.

[0006] Therefore, the first object of the present application is to provide the use of SERPIND1 as a target in screening drugs that inhibit the neovascularization function of endothelial cells and smooth muscle cells and the inflammatory capacity.

[0007] Preferably, the drug includes but is not limited to a drug for preventing and / or treating wet age-related macular degeneration.

[0008] Preferably, the drug is a drug that down-regulates the expression of SERPIND1.

[0009] The second object of the present application is to provide the use of a drug that regulates the expression of SERPIND1 in the preparation of a drug that inhibits the neovascularization function of endothelial cells and smooth muscle cells and the inflammatory capacity.

[0010] Preferably, the drug includes but is not limited to a drug for preventing and / or treating wet age-related macular degeneration.

[0011] Preferably, the drug is an inhibitor of SERPIND1.

[0012] Preferably, the drug includes a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is an inhibitor of SERPIND1.

[0013] Preferably, the inhibitor of SERPIND1 includes a small molecule inhibitor targeting SERPIND1, a nucleotide that inhibits the expression of SERPIND1 protein.

[0014] Preferably, the nucleotide that inhibits the expression of SERPIND1 protein includes siRNA or shRNA.

[0015] Preferably, the siRNA is AUGAAGAUGUUAUCGAAAGUG.

[0016] Preferably, the shRNA is CCGGCCCAGTAGAAATGACGCACAACTCGAGTTGTGCGTCATTTCTACTGGGTTTTTG (SEQ ID NO. 1).

[0017] The present application also provides a drug for inhibiting the angiogenic function of endothelial cells and smooth muscle cells and the inflammatory ability, such as a drug for treating wet age-related macular degeneration, which comprises an inhibitor of SERPIND1 as an active ingredient.

[0018] Preferably, the preparation of the drug is an ophthalmic preparation. Preferably, the ophthalmic preparation includes but is not limited to eye drops, eye ointment, eye spray, eye gel, eye patch, intraocular injection, ophthalmic microspheres, ocular implant, periocular injection and ophthalmic sustained-release preparation.

[0019] The present application finds that SERPIND1 is significantly increased in expression after antagonizing VEGFA in a laser-induced CNV animal model and in CNV. Knocking down SERPIND1 by intravitreal injection of shRNA can significantly inhibit CNV and inflammation in a mouse model of wet AMD. In vitro experiments using siRNA targeting SERPIND1 can inhibit the proliferation, migration, tube formation and other in vitro angiogenic functions of endothelial cells, and inhibit the expression of various inflammatory factors by endothelial cells. In addition, inhibiting SERPIND1 can also reduce immune cell adhesion and vascular endothelial cell migration, and reduce inflammation. These findings indicate that targeting SERPIND1 can effectively inhibit angiogenesis and inflammation in wAMD at the same time, suggesting that targeting SERPIND1 can become a new strategy for the treatment of wet AMD, and has important clinical application value. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Figure for mouse CNV model experiment, wherein A, B are qPCR experiments for detecting the expression amount of SERPIND1 in RPE-choroid complex in CNV modeling and intravitreal injection of 1 μg VEGF-A neutralizing antibody for 7 days, respectively; C is a qPCR experiment for detecting the knockdown efficiency of shSERPIND1. D is an immunofluorescence experiment for detecting the angiogenesis and inflammatory response of RPE-choroid complex in CNV mice after knocking down SERPIND1 (markers are IB4 and Iba1, respectively) (n = 9), (scale bar = 100 μm). Figure 2Knockdown of SERPIND1 in HREC cells and detection of the function of in vitro neovascularization of endothelial cells, wherein A is qPCR to verify the knockdown efficiency of SERPIND1 in HREC cells (n = 4); B is CCK8 experiment to detect the relative survival rate of HREC cells 48 hours after knockdown of SERPIND1 (n = 4); C is cell counting experiment to detect the proliferation of HREC cells 24-72 hours after knockdown of SERPIND1 (n = 3); D is to detect the migration ability of HREC cells after knockdown of SERPIND1 (n = 4); E is to detect the tube formation ability of HREC cells after knockdown of SERPIND1 (n = 3).

[0021] Figure 3 THP-1 cell (macrophage) adhesion endothelial cell experiment and transendothelial migration experiment, wherein A is to detect the ability of THP-1 cells to adhere to endothelial cells after knockdown of SERPIND1 in HREC cells under the stimulation of LPS (1 μg / mL) (n = 3); B is to detect the transendothelial migration ability of THP-1 cells after knockdown of SERPIND1 in endothelial cells under the stimulation of LPS (n = 3), (scale = 50 μm).

[0022] Figure 4 Knockdown of SERPIND1 in HREC cells and detection of the expression of inflammatory factors in endothelial cells. A is qPCR to detect the expression of TNF-a, CXCL1 / 2, CCL2 / 5 and other inflammatory factors after knockdown of SERPIND1 (n = 4). DETAILED DESCRIPTION

[0023] The following examples are further illustrations of the present application and are not intended to limit the present application. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the reagents and materials used are commercially available.

[0024] The materials are commercially available unless otherwise specified.

[0025] Human primary retinal endothelial cells (HREC): purchased from Sibcro (Shanghai) Biotechnology Co., Ltd;

[0026] Human leukemia mononuclear cells (THP-1): purchased from Angio-proteomie.

[0027] Table 1 siRNA sequence information

[0028] Sequence (5'-3') siCTRL UUCUCCGAACGUGUCACGUTT siSERPIND1 AUGAAGAUGUUAUCGAAAGUG

[0029] Table 2 shRNA sequence information

[0030]

[0031] Table 3 qPCR primer sequence information

[0032]

[0033]

[0034] Experimental Example 1: Knockdown of SERPIND1 can inhibit pathological neovascularization and reduce inflammation levels in CNV model mice.

[0035] 1. Plasmid construction

[0036] shRNA targeting SERPIND1 (shSERPIND1 in Table 2) was designed by using pLKO.1 as a vector through the sigma website. The designed sequence was synthesized by Tsingke Biotechnology Co., Ltd., and connected with the pLKO.1 vector using T4 DNA ligase. All plasmids were transformed using DH5a, and extracted using a plasmid extraction kit (TIANGEN, DP117TA).

[0037] 2. Mouse choroid knockdown of SERPIND1 and anti-VEGF-A and laser-induced mouse choroidal neovascularization (CNV) model construction

[0038] 1) Four laser photocoagulation spots were irradiated on the eyes of adult mice in an area 1.5-2 mm away from the disc diameter (spot size 75 pm, power 90 mw, duration 75 ms). Laser photocoagulation was performed at 12, 3, 6, and 9 positions, avoiding large retinal blood vessels.

[0039] 2) The mouse vitreous cavity was injected with a shSERPIND1 (shSERPIND1 in Table 2) or shCTRL (shCTRL in Table 2) plasmid-jetPEI complex (plasmid concentration 1 ug / ul, 1 ul injected per eye). The mice were sacrificed 2 days later to collect the eyeballs, and the RPE-choroid complex was isolated for qPCR to verify the knockdown efficiency.

[0040] 3) The vitreous cavity was injected with a shSERPIND1 or shCTRL plasmid-PEI complex (plasmid concentration 1 ug / ul, 1 ul injected per eye), and a second injection was performed on the third day after CNV.

[0041] 4) The eyes were collected on day 7. The eyeballs were fixed in 4% PFA for 1 h, and the cornea, lens, lens, and vitreous body were removed, and the RPE-choroid complex was isolated. The RPE-choroid complex was washed with PBS and punched and blocked for 1 h with 5% horse serum, 5% BSA, and 0.5% Txiton X-100.

[0042] 5) Incubate RPE-choroid with Alexa Fluor 488 (1 :500) conjugated isolectin GS-IB4 and Ibal antibody (1 :400) with 1% donkey serum, 1% BSA and 0.1% Triton X-100 overnight at 4°C.

[0043] 6) Rinse RPE-choroid complex with PBS, incubate secondary antibody for 1 h at room temperature, and stain nuclei with DAPI for 5 min, wash with PBS three times. Lay flat with RPE facing up.

[0044] 7) Take images using fluorescent microscope and analyze CNV area using image analysis software program.

[0045] 3. Immunofluorescence staining

[0046] 1) Fix with 4% PFA for 30 min.

[0047] 2) Wash with PBS for 5 min, three times.

[0048] 3) Block with 5% BSA, 5% donkey serum and 0.5% Triton X-100 for 1 h at room temperature.

[0049] 4) Then add IB4 antibody (1 :400), Ibal antibody (1 :400) respectively, incubate overnight at 4°C in the dark.

[0050] 5) Wash with PBS three times for 5 min each.

[0051] 6) Add secondary antibody and incubate for 1 h at room temperature, remove secondary antibody, and stain nuclei with DAPI for 5 min.

[0052] 7) Wash with PBS three times for 5 min each.

[0053] 8) After mounting with antifluorescence quenching agent, observe using a fluorescent microscope and take pictures.

[0054] 4. Experimental results

[0055] As Figure 1As shown, we detected the expression of SERPIND1 at 7 days after CNV modeling and anti-VEGF-A, and the qPCR results showed that the expression of SERPIND1 was significantly up-regulated in the CNV model compared with the control group after anti-VEGF-A. In this regard, we designed shRNA targeting SERPIND1. Then CNV modeling was performed and shRNA was injected at the same time, and RPE-choroid complex was taken out 7 days later, and immunofluorescence staining was performed using markers of endothelial cells and microglia / macrophages (IB4 and Ibal). The staining results showed that the area of neovascularization was significantly smaller, and the enrichment of microglia / macrophages was reduced. The results showed that targeting SERPIND1 can significantly inhibit neovascularization and inflammatory response.

[0056] Example 2: Knockdown of SERPIND1 in endothelial cells can inhibit endothelial cell proliferation, migration, tube formation, reduce the adhesion of immune cells to endothelial cells and the transendothelial migration ability of immune cells, and reduce the expression of inflammatory factors.

[0057] 1. Resuscitation and culture of endothelial cells (HREC)

[0058] 1) Prepare endothelial cell complete medium: ECM 500 mL + 5% FBS + 1% P / S, store at 4°C.

[0059] 2) Prepare 10x PBS: Potassium dihydrogen phosphate (KH2PO4) 2.7 g + Sodium phosphate dibasic (Na2HPO4) 14.2 g + Sodium chloride (NaCl) 80 g + Potassium chloride (KCl) 2.0 g, add ddH2O to 1 L, mix well, and store at room temperature. When used, dilute with ddH2O to 1x PBS, and use after high-temperature sterilization.

[0060] 3) Preheat 50 mL of medium or PBS in a centrifuge tube.

[0061] 4) Take the endothelial cell (HREC) cryopreservation tube from the liquid nitrogen tank and place it in a 37°C constant temperature water bath to quickly thaw.

[0062] 5) Transfer the suspension to a centrifuge tube and centrifuge at 300g for 3-5 min, and aspirate the supernatant.

[0063] 6) Resuspend the cells and transfer them to a clean culture dish and incubate in a CO2 incubator. After the cells adhere, replace the liquid every two days.

[0064] 7) Observe under a microscope, and when the cell clones grow and the cell density reaches more than 90%, perform subculture. After 2-3 passages, the cells can be used for experiments.

[0065] 2. Subculture of endothelial cells (HREC)

[0066] 1) Wash the cells twice with 1×PBS.

[0067] 2) Add 0.05% trypsin to digest the cells, incubate in an incubator for 1 minute, then gently shake the culture dish. Under a microscope, the cell clones are seen to be loose.

[0068] 3) Add culture medium to stop digestion. Spread the cells into a new culture dish at a ratio of 1:3. Shake the cell suspension well and then put the culture dish back into a 37℃ CO2 incubator for culture.

[0069] 3. siRNA transfection

[0070] 1) When the cells reach 80% confluence, the siRNA targeting SERPIND1 (siSERPIND1 in Table 1) or the control siRNA (siCTRL in Table 1) is mixed with the transfection reagent Escort. TM IV (Sigma, catalog number L3287) was prepared according to the proportions in Table 4 below for siRNA-Escort. TM IV mixture. TM Mix IV and siRNA and gently mix, avoiding shaking, and let stand at room temperature for at least 5 minutes. Add the mixture dropwise to the cell culture dish, gently shaking the dish to mix, in order to knock out SERPIND1 expression.

[0071] Table 4

[0072] Dish siRNA (μL) Opti-MEM (μL) Escort TM IV (μL)] 24-well plate 0.75 50 1.5 12-well plate 1.5 100 3 6-well plate 3 200 7.5 6 cm 7.5 400 15

[0073] 2) Collect cell samples 48 h after siRNA transfection and perform qPCR or Western blot to verify the knockdown efficiency. Perform endothelial cell function assays 48-72 h after transfection.

[0074] 4. Cell viability detection

[0075] HREC cells were seeded at 8000 cells per well in 96-well plates. After adhesion, siSERPIND1 was transfected for 24 hours (see section 3. siRNA transfection for details). The medium was then replaced with 100 μL of CCK8-ECM (ECM:CCK8 = 9:1) medium and cultured for another 4 hours. Absorbance was measured at 450 nm using a BioTek EL×800 absorbance microplate reader.

[0076] 5. Cell counting to detect cell proliferation

[0077] The proliferation of HREC was detected by cell counting at 24h, 48h, 72h after knocking down SERPIND1 in HREC cells. The cells were trypsinized, centrifuged to remove trypsin, resuspended with medium, 20μL of cell suspension was taken for trypan blue staining for 3min, the stained cells were dropped into an automatic cell counting plate for cell counting to count the number of living cells.

[0078] 5. Endothelial cell migration test

[0079] 1) HREC treated with siRNA for 24h was inoculated in a 24-well plate.

[0080] 2) Scratch the cells horizontally with a 200ul gun tip perpendicular to the cells, at least three wells per group.

[0081] 3) Wash the cells with ECM for 3 times, and take photos under a microscope at 0h.

[0082] 4) Place the cells in an incubator, and take photos again after 12h.

[0083] 6. Endothelial cell tube formation test

[0084] 1) Precool the 96-well plate, 200ul gun tip and matrigel in a four-degree refrigerator one day in advance.

[0085] 2) Add 50ul matrigel to the precooled 96-well plate, and incubate in an incubator for 30min.

[0086] 3) HREC treated with siRNA for 48h was inoculated in the above well plate, and the cells were placed in an incubator, and photographed after 6h.

[0087] 7. Cell adhesion experiment

[0088] 1) HREC treated with siRNA for 48h (8.0×10 4 cells / well) was inoculated in a 24-well plate.

[0089] 2) Add 1ug / mL LPS for 4h, and wash with PBS for 3 times.

[0090] 3) Treat THP-1 (2.5×10 5 cells / well) cells with 2.5uM calcein AM (Beyotime) for 30min.

[0091] 4) Incubate AM-labeled THP-1 cells with HREC for 2h.

[0092] 5) Wash with PBS for 3 times to wash away the unadhered THP-1 cells.

[0093] 6) Fluorescent microscope (Zeiss, Germany) was used to capture the adherent THP-1 cells from 12 randomly selected visual fields and analyzed by ImageJ.

[0094] 8. THP-1 cell transendothelial migration assay

[0095] 1) HRECs (5.0 x 105cells / well) infected with siSERPIND1 for 24h were seeded into each upper chamber and cultured to allow the cells to adhere as a monolayer. 4

[0096] 2) Adherent THP-1 cells were treated with 2.5 mM calcein AM for 30 min. The medium was removed by centrifugation and the THP-1 cells were resuspended in 1640 medium containing 1% FBS and the resuspended THP-1 cells (5 x 105cells / well) were added to the upper chamber. 5

[0097] 3) 1640 medium containing 10% FBS and 50 ng / mL CCL2 was added to the lower chamber.

[0098] 4) After 12h, the migrated THP-1 cells in the lower chamber were transferred to a new well and treated with 150 ng / mL phorbol 12-myristate 13-acetate (PMA) for 12h to allow the THP-1 cells to adhere. Fluorescent microscope was used to capture 12 randomly selected fields and analyzed by ImageJ.

[0099] 9. Cell RNA extraction, reverse cDNA and qRT-PCR

[0100] 1) Cells were taken at 80% confluency, the medium was discarded and washed once with PBS. The cells were lysed by adding 600 μL Trizol and transferred to a 1.5 mL centrifuge tube.

[0101] 2) 120 μL chloroform was added, shaken vigorously for 20 s, left to stand for 5 min and centrifuged at 4°C for 15 min at 15000 rpm.

[0102] 3) The supernatant was transferred to a new centrifuge tube, without sucking up the middle layer; pre-cooled isopropanol was added to the supernatant at a ratio of 1:1, mixed well, left to stand at -20°C for 20 min and then centrifuged at 4°C for 15 min at 12000 rpm.

[0103] 4) The supernatant was discarded and 500 μL of 75% pre-cooled ethanol was added.

[0104] ​​5) 4℃ centrifugal 5min, discard the supernatant, add 500μL 95% pre-cooled ethanol, 4℃ centrifugal 5min, discard the supernatant, and the centrifugal tube is inverted on a clean absorbent paper, and when the white precipitate at the bottom of the tube becomes transparent, 20μL DEPC H2O is added, and reverse transcription is directly performed or stored at -20℃.

[0105] 6) The total RNA obtained is measured for concentration using a microplate reader, and reverse transcription is performed according to 2μg total RNA per sample, and cDNA is synthesized using a FastKing RT kit with DNase (TIANGEN) kit.

[0106] 7) The synthesized cDNA is used as a template, and gene expression level detection is performed on an ABI QuantStudio6 Flex device (Life Technologies) PCR instrument according to a SYBR Green (ROCHE) kit.

[0107] 8) ACTIN is used as an internal reference gene, and the expression of each gene is calculated by delta-delta Ct method. The primer sequences of each gene are obtained from the Primer bank website.

[0108] 10. Experimental results

[0109] 1) As shown in Figure 2 , we designed siRNA against SERPIND1 to knock down the expression of SERPIND1 in HREC cells. The effect of SERPIND1 on endothelial cell proliferation was detected by CCK8 experiment and cell counting experiment, and the results showed that knockdown of SERPIND1 could significantly inhibit the proliferation of endothelial cells. The effect of SERPIND1 on endothelial cell migration was detected by scratch experiment, and the results showed that knockdown of SERPIND1 could inhibit the migration of endothelial cells; the effect of SERPIND1 on the ability of endothelial cells to form lumen in vitro was detected by endothelial cell tube formation experiment, and the results showed that knockdown of SERPIND1 could inhibit the ability of endothelial cells to form lumen in vitro. These results suggest the effect of SERPIND1 on angiogenesis.

[0110] 2) As shown in Figure 3 , to detect the effect of SERPIND1 on inflammatory response in endothelial cells, we performed leukocyte adhesion and leukocyte transendothelial migration experiments. After HREC with knockdown of SERPIND1 was inoculated in a 24-well plate and treated with LPS for 4h, THP-1 cells labeled with calcein were incubated with HREC for 2h, and then observed under a microscope. It was found that the adhesion ability of HREC cells to immune cells decreased after knockdown of SERPIND1 in endothelial cells Figure 3(A) HREC cells with knocked-down SERPIND1 were seeded in the upper chamber. Under LPS stimulation and low serum concentration culture conditions, THP-1 cells treated with calcein were seeded in the upper chamber, while the lower chamber contained culture medium with normal serum concentration. After 12 hours, PMA was added to the lower chamber to induce THP-1 cell adhesion, and images were taken. The results showed that knocking down SERPIND1 in endothelial cells reduced the transendothelial migration ability of immune cells. Figure 3 (B in the middle).

[0111] 3) such as Figure 4 As shown, to further understand the effect of SERPIND1 on endothelial cell inflammation, we knocked down SERPIND1 in endothelial cells (HRECs) and then examined the expression of numerous inflammation-related molecules. The results showed that knocking down SERPIND1 significantly inhibited the expression of inflammatory factors in endothelial cells, indicating that SERPIND1 has a strong regulatory effect on endothelial cell inflammation. Figure 4 ).

[0112] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of an inhibitor of SERPIND1 in the preparation of a medicament for preventing and / or treating wet age-related macular degeneration, wherein the inhibitor of SERPIND1 is a nucleotide inhibiting the expression of SERPIND1 protein; the nucleotide inhibiting the expression of SERPIND1 protein is shRNA; the shRNA is CCGGCCCAGTAGAAATGACGCACAACTCGAGTTGTGCGTCATTTCTACTGGGTTTTTG.

2. Use according to claim 1, characterized in that, The medicament comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is the inhibitor of SERPIND1 as described in claim 1.

Images