A molecular marker related to acetoin content in pig muscle and its application

Abstract

The present invention belongs to the technical field of determination or testing methods for enzymes, nucleic acids or microorganisms, and is a molecular marker related to the acetoin content in pig muscle and its application. The technical problem to be solved by the present invention is to provide a molecular marker related to the acetoin content in pig muscle. To solve this technical problem, the present invention provides a molecular marker obtained by genome-wide association study (GWAS), namely a SNP site, which is a SNP in the pig genome, the 270th nucleotide of SEQ ID NO: 1, and its nucleotide type is A or G. The SNP can be used to detect or assist in the detection of acetoin content, detect or assist in the detection of SNP polymorphism or genotype or pig breeding. By detecting the genotype of the pig to be tested at the SNP site, early selection of the acetoin content in pig muscle can be achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of enzyme, nucleic acid or microbial determination or testing methods, and particularly relates to a molecular marker related to acetoin content in pig muscle and an application thereof. Background Art

[0002] Meat is a food with high nutritional value. With rising living standards, people's expectations for meat quality are becoming increasingly high. Meat quality is evaluated on many factors, including its sensory qualities and nutritional value. Among these, the flavor compounds in meat directly determine its odor, taste, and overall eating quality, making them a key indicator influencing consumer choice. The primary source of pork flavor is volatile compounds. Naturally occurring volatile compounds in pork, such as ketones, aldehydes, and alcohols, form the basis of pork's original flavor and impart its distinctive aroma.

[0003] The acetoin content in pork affects its flavor, primarily by inhibiting fat oxidation. It plays a crucial role in maintaining the natural flavor of pork, especially its aroma during storage, and preventing rancidity and off-flavors. Insufficient acetoin in meat significantly accelerates fat oxidation, and the resulting off-flavor substances overwhelm the meat's original aroma. The oxidation reaction also destroys certain unsaturated fatty acids in the meat, resulting in a reduction in umami molecules. Currently, molecular marker-assisted breeding technology is widely used in the development of new livestock and poultry varieties, and genome-wide association analysis can be used to identify molecular markers closely associated with target traits. Using molecular markers for early selection of target traits can significantly reduce breeding costs and accelerate genetic progress. However, there are currently no molecular markers associated with acetoin content in pork. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a molecular marker related to the acetoin content in pig muscle. The technical problem to be solved is not limited to the technical subject matter described above, and those skilled in the art can clearly understand other technical subjects not mentioned herein through the following description.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The present invention provides any of the following applications of a substance for detecting polymorphism or genotype of a SNP site in a pig genome:

[0007] A1) Use of a substance for detecting the polymorphism or genotype of a SNP site in the pig genome in detecting or assisting in the detection of acetoin content;

[0008] A2) Use of a substance for detecting the polymorphism or genotype of a SNP site in the pig genome in detecting or assisting in detecting the polymorphism or genotype of a SNP;

[0009] A3) Application of materials for detecting polymorphism or genotype of SNP sites in pig genome in pig breeding;

[0010] A4) Use of a substance for detecting the polymorphism or genotype of a SNP site in the porcine genome in the preparation of a product for detecting or assisting in the detection of acetoin content;

[0011] A5) Use of a substance for detecting the polymorphism or genotype of a SNP site in the porcine genome in the preparation of a product for detecting or assisting in the detection of the polymorphism or genotype of a SNP;

[0012] A6) Use of materials for detecting polymorphism or genotype of SNP sites in the pig genome in the preparation of pig breeding products;

[0013] The SNP site is a SNP in the pig genome, which is the 270th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G.

[0014] The SNP is also located at nucleotide position 29962358 on chromosome 6 of the pig genome (Sscrofa11.1, GCF_000003025.6) (corresponding to nucleotide position 270 of the nucleotide sequence SEQ ID NO: 1).

[0015] Those skilled in the art know that SEQ ID NO: 1 is composed of the SNP site (nucleotide 270 of SEQ ID NO: 1) and the nucleotide sequence in its vicinity. The amount of nucleotide sequence near the SNP site should not be used as a limiting factor for the scope of protection of the present invention. It can be 25 bp, 50 bp, 70 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp before and after the SNP site, or any other arbitrary value. Its function is to assist in locating the position of the SNP on chromosome 6 of the porcine genome.

[0016] The front and back mentioned herein should be defined in the direction recognized by those skilled in the art, such as the 5'-3' direction.

[0017] The present invention also provides a method for detecting or assisting in detecting the acetoin content, comprising the following steps: detecting the genotype of the aforementioned SNP site in the pig to be tested, and detecting or assisting in detecting the acetoin content based on the genotype.

[0018] In the above-mentioned method for detecting or assisting in detecting the acetoin content, the relative acetoin content of the pig to be tested whose SNP genotype is GG is significantly higher than that of the pig to be tested whose genotypes are GA and AA, and the relative acetoin content of the pig to be tested whose genotype is GA is significantly higher than that of the pig to be tested whose genotype is AA; the GG is the homozygous type of the SNP site being G, the GA is the heterozygous type of the SNP site being G and A, and the AA is the homozygous type of the SNP site being A.

[0019] In the above application or method, the detection or auxiliary detection of acetoin content can specifically be the detection of acetoin content in the longissimus dorsi muscle of pigs.

[0020] In the above method, a portion of the pig genome containing the aforementioned SNP can be amplified by PCR. For example, a PCR product containing SEQ ID NO: 1 is sequenced to detect the type of deoxyribonucleotide at position 270 of SEQ ID NO: 1 to detect the genotype of the SNP site in the pig genome to be tested.

[0021] The present invention also provides a method for pig breeding, which includes detecting the genotype of the aforementioned SNP site in the genome of the pig to be tested, and selecting the pig to be tested whose genotype of the SNP site is GG as a parent for breeding, wherein GG is the homozygous type of the SNP site being G.

[0022] The present invention also provides a product, which contains the aforementioned substance, and is any one of the following:

[0023] B1) Products used for preparing for or assisting in the detection of acetoin content;

[0024] B2) Products used to detect or assist in detecting SNP polymorphisms or genotypes;

[0025] B3) Products for pig breeding.

[0026] In the above products, the substance is any of the following:

[0027] C1) the substance is a primer composition for amplifying a pig genomic DNA fragment including the SNP site;

[0028] C2) the substance is a PCR reagent containing the primer combination described in C1);

[0029] C3) The substance is a kit containing the primer composition described in C1) or the PCR reagent described in C2).

[0030] The kit may further include conventional reagents for PCR amplification. The kit may further include conventional reagents for sequencing.

[0031] In the above product, the primer composition is any one of F1)-F3):

[0032] F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence listing and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence listing;

[0033] F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 24 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 388 to 411 of SEQ ID NO: 1 in the sequence listing;

[0034] F3), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 2 by substituting and / or deleting and / or adding one or more nucleotides, and a single-stranded DNA having the same function as SEQ ID NO: 3 by substituting and / or deleting and / or adding one or more nucleotides.

[0035] The present invention also provides application of the above product in pig breeding.

[0036] The present invention also provides a DNA molecule, wherein one chain of the DNA molecule is SEQ ID NO: 1.

[0037] The present invention also provides an application, any of the following applications of the aforementioned DNA molecule:

[0038] N1) Use of the aforementioned DNA molecules in detecting or assisting in the detection of acetoin content;

[0039] N2) Use of the aforementioned DNA molecules in detecting or assisting in detecting SNP polymorphisms or genotypes;

[0040] N3) Application of the aforementioned DNA molecules in pig breeding;

[0041] N4) Use of the aforementioned DNA molecules in the preparation of products for detecting or assisting in the detection of acetoin content;

[0042] N5) Use of the aforementioned DNA molecules in the preparation of products for detecting or assisting in the detection of SNP polymorphisms or genotypes;

[0043] N6) Use of the aforementioned DNA molecule in the preparation of pig breeding products.

[0044] The present invention also protects the use of any of the above methods in breeding.

[0045] The present invention also protects the use of the specific primer in breeding.

[0046] The present invention also protects the use of the kit in breeding.

[0047] In this article, any of the above breeding is pig breeding.

[0048] Herein, the purpose of the breeding is to select individuals with high acetoin content in the longissimus dorsi muscle. The individuals with high acetoin content in the longissimus dorsi muscle are individuals with the SNP genotype of GG.

[0049] Herein, the purpose of the breeding is to select a population with a high acetoin content in the longissimus dorsi muscle.

[0050] Herein, the purpose of the breeding is to select varieties with high acetoin content in the longissimus dorsi muscle.

[0051] Herein, the purpose of the breeding is to eliminate individuals whose genotypes of the SNP site are AA genotype and GA genotype.

[0052] In the breeding, individuals with the GG genotype are retained.

[0053] Any of the above-mentioned pigs refers to all pig breeds.

[0054] The beneficial effects of the present invention are as follows: the SNP molecular marker of the present invention is associated with the acetoin content trait of the longissimus dorsi muscle of pigs, and is a new molecular marker. By determining the genotype of the SNP site of the pig to be tested, early selection for the acetoin content trait of the longissimus dorsi muscle of pigs can be performed, which can save production costs, improve meat quality and flavor, and accelerate genetic progress, better serve pig breeding, and has great economic application value and scientific research value. DETAILED DESCRIPTION

[0055] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0056] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0057] In the following examples, GraphPad Prism 8 statistical software was used to process the data. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. P < 0.05 (*) indicated a significant difference.

[0058] Example 1: Determination of the correlation between specific SNP and acetoin content in the longissimus dorsi muscle

[0059] Experimental animals: Landrace pigs, Large White pigs, and Sanyuan pigs were all sourced from COFCO Jiajiankang (Chifeng) Co., Ltd.

[0060] 1. Determination of acetoin content in the longissimus dorsi muscle

[0061] The pigs were fed under the same feeding conditions for 180 days, and 521 pigs in good health were randomly selected. 10 g of longissimus dorsi muscle samples were collected and frozen in liquid nitrogen.

[0062] Sample pretreatment: Evenly sample the sample, accurately weigh 3.0 g into a headspace vial, add 10 μL of internal standard 2-methyl-3-heptanone solution (10 μg / mL of 2-methyl-3-heptanone), tighten the cap, and prepare for measurement. Prepare the internal standard 2-methyl-3-heptanone solution by weighing 1 mg of 2-methyl-3-heptanone (Cat. No. 103128-5g; CAS No. 13019-20-0), adding methanol to a volume of 100 mL, and sonicating for 30 minutes to ensure complete dissolution.

[0063] Instruments and equipment: automatic sampler, gas chromatography, mass spectrometry, olfactometer, headspace solid phase microextraction needle, gas chromatography column (VF-WAX ms, 60 m × 0.25 mm id × 0.25 µm).

[0064] The relative content of acetoin Ca = (Sa / Sis)×(Cis×Vis / m)×1000.

[0065] In the above formula:

[0066] Ca is the relative content of the volatile compound acetoin in the sample, expressed in micrograms per kilogram (μg / kg);

[0067] Sa is the peak area of ​​acetoin, a volatile compound in the sample;

[0068] Sis is the peak area of ​​the internal standard 2-methyl-3-heptanone in the sample;

[0069] Cis is the concentration of the internal standard 2-methyl-3-heptanone, expressed in micrograms per milliliter (μg / mL);

[0070] Vis is the volume of the internal standard 2-methyl-3-heptanone, in milliliters (mL);

[0071] m is the sample mass in grams (g);

[0072] 1000: coefficient for converting μg / g to μg / kg;

[0073] The retention time of acetoin was 19.691±0.1 min.

[0074]

[0075]

[0076] 2. Detection of SNP Molecular Markers

[0077] 1. Blood sample collection: Collect blood from the pig fin vein using a sodium heparin anticoagulant blood collection tube and store at -20°C for later use.

[0078] 2. Whole blood genomic DNA extraction: The specific operation method refers to the instructions of the blood genomic DNA extraction kit (Tiangen, DP319).

[0079] 3. Genotyping: Genomic DNA from each pig was collected and whole-genome resequencing was performed using the Illumina HiSeq X-Ten sequencing platform. The sequencing depth for each individual was approximately 5×. The specific method was based on the standard operating procedures provided by Illumina. After quality control, the off-machine data were then aligned and genotyped using the bioinformatics software packages BWA and GATK.

[0080] 3. Genome-wide association analysis of acetoin in the longissimus dorsi muscle

[0081] A genome-wide association analysis between acetoin and genotype in the longissimus dorsi muscle was performed using a compressed mixed linear model using EMMAX software. A single nucleotide polymorphism (SNP) significantly associated with the acetoin trait was identified, located at nucleotide position 29,962,358 on chromosome 6. This SNP was therefore designated "Chr6: 29,962,358 SNP," referring to nucleotide position 29,962,358 on chromosome 6 of the porcine genome (Sscrofa11.1, GCF_000003025.6) (corresponding to nucleotide position 270 of SEQ ID NO:1). The nucleotide sequence of this SNP is G / A. For simplicity, this SNP will be referred to as the specific SNP.

[0082] A pair of primers was designed based on the specific SNP, consisting of F and R. The target sequence of F and R in the pig genomic DNA was 411 bp, and the specific SNP was located at the 270th nucleotide of the target sequence.

[0083] F (SEQ ID NO:2): 5'-TTCCTCCAGGCTTGAGCAGAATAT-3';

[0084] R (SEQ ID NO:3): 5'-TACCCACAGAGACGCCTGCACTCC-3'.

[0085] It can be seen from this that the genotype of the pig to be tested can be defined according to the following rules:

[0086] GG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R contains only a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 270th nucleotide of SEQ ID NO: 1 is G, and does not contain a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 270th nucleotide of SEQ ID NO: 1 is A, then the aforementioned SNP genotype of the pig to be tested is GG.

[0087] AA genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R does not contain a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 270th nucleotide of SEQ ID NO: 1 is G, and only contains a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 270th nucleotide of SEQ ID NO: 1 is A, then the aforementioned SNP genotype of the pig to be tested is AA.

[0088] AG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R contains both a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 270th nucleotide of SEQ ID NO: 1 is A, and a DNA fragment whose nucleotide sequence is SEQ ID NO: 1 and the 270th nucleotide of SEQ ID NO: 1 is G, then the aforementioned SNP genotype of the pig to be tested is AG.

[0089] Example 2: Application of a specific SNP in genetic improvement of the acetoin content trait in the longissimus dorsi muscle of pigs

[0090] Experimental animals: 476 Landrace pigs, Large White pigs, and Sanyuan pigs, sourced from COFCO Jiajiankang (Chifeng) Co., Ltd.

[0091] 1. Detection based on specific SNP genotype

[0092] 1. Blood sample collection

[0093] The wing vein blood of the experimental animals was collected using a sodium heparin anticoagulant blood collection tube and stored at -20℃ for later use.

[0094] 2. Extraction of genomic DNA

[0095] Take the venous blood obtained in step 1 and extract genomic DNA.

[0096] 3. Genotype detection

[0097] Using the genomic DNA obtained in step 2 as a template, PCR amplification was performed using a primer pair consisting of F and R, and the PCR amplification product was then sequenced.

[0098] The results showed that a PCR amplification product of 411 bp was obtained from all 476 experimental animals.

[0099] According to the genotype definition rules in Example 1, 476 experimental animals were divided into three genotypes: AA genotype (30 experimental animals), GA genotype (192 experimental animals), and GG genotype (254 experimental animals).

[0100] 2. Determination of acetoin content in the longissimus dorsi muscle

[0101] 2-Methyl-3-heptanone: purchased from Sigma-Aldrich, product number 103128-5g.

[0102] Preparation method of 10 ug / mL 2-methyl-3-heptanone solution: weigh 1 mg of 2-methyl-3-heptanone, add methanol to make up to 100 mL, and sonicate for 30 min to ensure complete dissolution.

[0103] The animals were fed under the same feeding conditions until 180 days. 476 pigs in good health were randomly selected, and 10 g of longissimus dorsi muscle samples were collected and frozen in liquid nitrogen.

[0104] Pre-treatment of samples: uniformly sample the sample, accurately weigh 3.0 g and place it into a headspace vial, add 10 uL of the prepared 10ug / mL internal standard 2-methyl-3-heptanone solution, tighten the cap and wait for testing.

[0105] Instruments and equipment: automatic sampler, gas chromatography, mass spectrometry, olfactometer, headspace solid phase microextraction needle, gas chromatography column (VF-WAX ms, 60 m × 0.25 mm id × 0.25 µm).

[0106] The conditions for solid-phase microextraction and gas chromatography-mass spectrometry are shown in Tables 1 and 2. The results in Table 3 show that the relative acetoin content of the three genotypes was significantly different (P < 0.001). The relative acetoin content of pigs with the GG genotype was higher than that of pigs with the GA genotype (P < 0.001) and AA genotype (P < 0.001). The relative acetoin content of pigs with the GA genotype was higher than that of pigs with the AA genotype.

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120] SEQ ID NO:1

[0121] 5'-TTCCTCCAGGCTTGAGCAGAATATGGTGGCAAAGGGTGACATTCTCATGCCGGGGGCGCCGAAGGGGCTTGGGGGATGTAGCGAGGAGCAGAATCCAGGGCTTCTTTCAGCAGCTTTCTGCTTCTCCCCTCCCCTCTCTTCCTTCCCCTCCTCTCCCCTCCTCCATCCTTTTAAATACCAAGCATCTCCTCATCTCCAAGTCCCTTTGGTCTTCACAGTTCGTGGAGCCGGTAATGTCTTCTATTTTGCAGATAAGAACATAGTGGTTCRCGTTTTAGGGAAGTGGCCGAGCTGGGATCTGAACCCAGGCTGAGTTGAGCCTCTGACTCCATCTTTGGGCCTCTCCCATCTAGTCAGAGTCTCGGTGGGGTGTATTCGGGCAGGACAGGAGTGCAGGCGTCTCTGTGGGTA-3'.

[0122] R is A or G.

[0123] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 270th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G. The application is any of the following: A1) Use of the substance in detecting or assisting in the detection of acetoin content; A2) Use of the substance in pig breeding; A3) Use of the substance in the preparation of a product for detecting or assisting in the detection of acetoin content; A4) Use of the substance in preparing products for pig breeding.

2. The use according to claim 1, characterized in that The substance is any of the following: C1) a primer combination for amplifying a pig genomic DNA fragment including the SNP site; C2) a PCR reagent containing the primer combination described in C1); C3) A kit containing the primer composition described in C1) or the PCR reagent described in C2).

3. The use according to claim 2, characterized in that The primer composition is F1) or F2): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence listing and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence listing; F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 24 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 388 to 411 of SEQ ID NO: 1 in the sequence listing.

4. A method for detecting or assisting in detecting the content of acetoin, characterized in that: The method comprises the following steps: detecting the genotype of the SNP site in claim 1 in the pig to be tested, and detecting or assisting in detecting the acetoin content according to the genotype.

5. A method for pig breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the genome of the pig to be tested, and selecting the pig to be tested whose genotype of the SNP site is GG as a parent for breeding.

6. Use of a product containing a substance for detecting polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 270th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G; the application is the application of the product in pig breeding.

Images