Molecular marker of gene associated with resistance to anthracnose of sorghum, primer and application thereof

By developing the SbAr1 gene and its molecular marker SAR993 associated with anthracnose resistance in sorghum, and using PCR technology to rapidly identify anthracnose resistance in sorghum, the problem of low breeding efficiency in existing technologies has been solved, achieving a more efficient breeding process and reduced costs.

CN119955973BActive Publication Date: 2026-02-03SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510158720.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-13
Publication Date
2026-02-03
Estimated Expiration
2045-02-13

AI Technical Summary

Technical Problem

Current technologies lack effective molecular marker-assisted methods for rapid screening and identification of anthracnose resistance genes in sorghum, resulting in low efficiency in sorghum breeding.

Method used

We developed the SbAr1 gene and its molecular marker SAR993 associated with resistance to sorghum anthracnose, and designed corresponding primers SAR993-F and SAR993-R. We then used PCR amplification technology to detect the 371bp or 309bp amplification products in sorghum leaf DNA, which enabled us to quickly distinguish between resistant and susceptible materials.

Benefits of technology

This technology enables rapid identification of sorghum anthracnose resistance during the seedling stage, reduces labor costs, improves breeding efficiency, accelerates the breeding process, and can be widely applied in conventional laboratories.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955973B_ABST
    Figure CN119955973B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of molecular marker assisted breeding, and particularly relates to a molecular marker of a gene significantly associated with high resistance to anthracnose, a primer and application thereof. In order to develop more resistant NLR genes and solve the problems of rapid screening of high resistance to anthracnose and molecular markers closely linked to anthracnose resistance, the present application provides a SbAr1 gene significantly associated with high resistance to anthracnose, and a molecular marker, a primer and application thereof. The molecular marker SAR993 obtained by the present application can be used for detection of high resistance to anthracnose, so as to rapidly distinguish varieties or lines resistant to anthracnose and susceptible to anthracnose at the seedling stage. The detection is convenient and rapid, the result is stable, and the present application has the characteristics of accurate and rapid screening of single plants resistant or susceptible to anthracnose, greatly reduces the labor cost, shortens the breeding period, accelerates the breeding process of high varieties, and improves the breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology, specifically relating to a molecular marker, primers, and application of a gene that is significantly associated with anthracnose resistance in sorghum. Background Technology

[0002] Sorghum (Sorghum bicolor (L.) Moench, 2n=2x=20) is the world's fifth largest cereal crop after maize, rice, wheat, and barley. It is drought- and alkali-tolerant and widely cultivated globally for brewing, silage, food, and energy processing. Sorghum anthracnose is a prevalent disease in sorghum-producing areas worldwide and one of the main foliar diseases in southwestern China's sorghum-producing regions. Anthracnose occurs throughout the entire growth period of sorghum, damaging leaves, panicle necks, rachis, branches, and stems. This leads to nutrient loss, internal metabolic disorders, and impairs photosynthesis in leaves, nutrient transport in stems, and grain nutrient storage, causing severe economic losses to the industry.

[0003] Discovering anthracnose-resistant gene resources in sorghum and breeding resistant varieties are effective and economical ways to enhance the anthracnose resistance of sorghum. The NLR (nucleotide-binding leucine-rich repeat) gene, involved in anthracnose defense in sorghum, encodes a nucleotide-binding domain and a leucine-rich repeat sequence protein, assisting sorghum in resisting anthracnose pathogen invasion. Structural variations in the NLR gene are a significant factor contributing to differences in resistance among sorghum varieties; however, currently, only a handful of broad-spectrum, major-effect anthracnose-resistant NLR genes exist, and related molecular markers are lacking for marker-assisted breeding. Therefore, identifying resistant resources, discovering resistant NLR genes, and developing functional molecular markers are of great practical significance for accurately screening and breeding anthracnose-resistant sorghum varieties. Summary of the Invention

[0004] To develop more resistance NLR (nucleotide-binding domain and leucine-rich repeat) genes and address the issue of molecular markers closely linked to anthracnose resistance in sorghum for rapid screening, this invention provides an SbAr1 gene significantly associated with anthracnose resistance in sorghum, along with its molecular markers, primers, and applications. The anthracnose resistance-related molecular marker SAR993 obtained in this invention can be used to detect anthracnose resistance in sorghum, enabling rapid differentiation between anthracnose-resistant and anthracnose-susceptible varieties or lines at the seedling stage. The detection is convenient, rapid, and provides stable results, accurately and quickly screening anthracnose-resistant and susceptible individual plants. This significantly reduces labor costs, shortens breeding time, accelerates the selection process of sorghum varieties, and improves breeding efficiency.

[0005] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows:

[0006] In a first aspect, the present invention provides a molecular marker SAR993 for the SbAr1 gene associated with resistance to sorghum anthracnose, the nucleotide sequence of which is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0007] SEQ ID NO.1:

[0008] TAGAATCACACAAGGTGGTATAAATATTATAGTGCTATTGTGTCACTTGAAATATCTGGATGTCAGGACTTACT G GTCAACAATCTATTCACTTCCGAGTGACATTGGAAAACTGCATGGCTTGCAAATTTTGAACATAGGGTATACTTATATTACAACTCTGCCAACACAAATCACTAAACTTGAAGATCTCCGTGCCATTCGCTGTGATAGGAATTTCCCTAACTACTTGGATCCAGATGAACCAGTGCATTGTTTGTTTGCCACA TTGCGCCTGCCAATCCTATTAGCTGATTCAAA AAGCCGTGACAGAGCAATTGGTGATCTACA CATGGGCTGCTCTAGTGGTTGGTCCAGAACTAGCAGAAATG

[0009] SEQ ID NO.2:

[0010] TAGAATCACACAAGGTGGTATAAATATTATAGTGCTATTGTGTCACTTGAAATATCTGGATGTCAGGACTTACTAGTCAACAATCTATTCACTTCCGAGTGACATTGGAAAACTGCATGGCTTGCAAATTTTGAACATGGGGTACACTTATATT ACAACTCTGCCAACACAAATCACTAAACTTGAAGATCTCCGTGTCATTCGCTGTGATAGGAATGTCCCTAACTACTTGGATCCAGATGAACCAGTGCATTGTTTGTTTGCCACACATGGGCTGCTCTAGTGGTTGGTCCAGAACTAGCAGAAATG

[0011] The SbAr1 gene, which is associated with resistance to sorghum anthracnose, has the nucleotide sequence shown in SEQ ID No. 5.

[0012] SEQ ID No. 5:

[0013]

[0014] Secondly, the present invention provides primers for detecting the molecular marker SAR993, comprising a forward primer SAR993-F with a nucleotide sequence as shown in SEQ ID No. 3 and a reverse primer SAR993-R with a nucleotide sequence as shown in SEQ ID No. 4.

[0015] SEQ ID NO.3:

[0016] SAR993-F: 5'-TAGAATCACACAAGGTGG-3'

[0017] SEQ ID NO.4:

[0018] SAR993-R: 5'-CATTTCTGCTAGTTCTGGAC-3'

[0019] Thirdly, the present invention provides the use of the above-mentioned molecular marker SAR993 or primers of molecular marker SAR993 in at least one of the following:

[0020] (1) Application in identifying anthracnose resistance traits in sorghum;

[0021] (2) Application in screening anthracnose-resistant sorghum varieties;

[0022] (3) Application in sorghum-assisted breeding;

[0023] (4) Application in the preparation of products for detecting anthracnose resistance in sorghum.

[0024] Among the above applications is a method for identifying resistance to sorghum anthracnose, which involves using the two primers mentioned above to perform PCR amplification on sorghum leaf DNA to obtain amplification products. If the amplification product is a single band of a 371bp nucleotide fragment, the sorghum material being tested exhibits resistance to sorghum anthracnose; if the amplification product is a single band of 309bp, the sorghum material being tested exhibits susceptibility to sorghum anthracnose; and if both 371bp and 309bp bands are amplified simultaneously, the sorghum material being tested is a heterozygote.

[0025] Among the applications of the above-mentioned products for preparing and detecting resistance to sorghum anthracnose, the products include reagent kits, reagents, or chips.

[0026] Preferably, the kit further includes PCR reaction system reagents.

[0027] Fourthly, this invention provides a method for identifying resistance to sorghum anthracnose, which involves using the two primers mentioned above to perform PCR amplification on sorghum leaf DNA to obtain amplification products; if the amplification product is a single band of a 371bp nucleotide fragment, the sorghum material to be tested exhibits resistance to sorghum anthracnose; if the amplification product is a single band of 309bp, the sorghum material to be tested exhibits susceptibility to sorghum anthracnose; if both 371bp and 309bp bands are amplified simultaneously, the sorghum material to be tested is a heterozygote.

[0028] In the above method, the amplification reaction system is as follows: 1 μL DNA template, 0.5 μL each of upstream and downstream primers (10 μM / μL), 2 μL 10×Easy Taq Buffer, 0.5 μL dNTPs, 0.5 μL Easy Taq Enzyme, and 15 μL ddH2O.

[0029] In the above method, the amplification reaction program is as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, repeated 34 times, final extension at 72℃ for 5 min, and storage at 4℃.

[0030] Beneficial Effects: This invention, through GWAS analysis of anthracnose resistance in sorghum populations, identified the gene SbAr1, which is significantly associated with anthracnose resistance in sorghum. By comparing the SbAr1 gene coding sequences of resistant and susceptible sorghum varieties, molecular markers and primer pairs for the SbAr1 gene, significantly associated with anthracnose resistance in sorghum, were designed. Using these molecular markers and primer pairs, anthracnose-resistant and anthracnose-susceptible sorghum materials can be rapidly identified and screened during sorghum breeding, enabling marker-assisted selection, improving breeding efficiency, and accelerating the breeding process.

[0031] Furthermore, the molecular markers disclosed in this invention can rapidly distinguish between anthracnose-resistant and anthracnose-susceptible sorghum varieties or lines even at the seedling stage, greatly reducing labor costs. The molecular markers of this invention only require PCR amplification and gel electrophoresis detection, without the need for specialized SNP genotyping instruments or sequencing, which facilitates their widespread adoption in most laboratories and sorghum breeding units. Attached Figure Description

[0032] Figure 1 Manhattan plot of genome-wide association analysis (GWAS) of anthracnose resistance in sorghum resource population in Example 1;

[0033] Figure 2 The left image shows the anthracnose resistance identification of sorghum materials BTx623 and GJH1 in Example 1, and the right image shows the transcriptome analysis of three NLR genes after 0h and 24h of spraying sorghum anthracnose spore suspension on BTx623 and GJH1.

[0034] Figure 3 This is a comparison diagram of SbAr1 BTx623 and SbAr1 GJH1 proteins in Example 2;

[0035] Figure 4 This is a schematic diagram of the SbAr1 structure and molecular markers in Example 2;

[0036] Figure 5 The image shows a polyacrylamide gel electrophoresis diagram (left) of the application of molecular markers for anthracnose in 20 sorghum samples in Example 3; and an anthracnose resistance identification diagram (right). Detailed Implementation

[0037] To make the technical problems, solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with the embodiments. Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art.

[0038] Unless otherwise defined herein, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art. The terms “comprising,” “including,” “having,” “containing,” or “involving,” and their other variations herein, are inclusive or open-ended and do not exclude other unlisted elements or method steps. One of one’s skill in the art will understand that the foregoing term “comprising” covers the meaning of “consisting of.”

[0039] In this invention, the terms "a," "an," "at least one," and "one or more" are used interchangeably. When a lower and upper limit of a numerical range is disclosed, any numerical value falling within that range and any included range are specifically disclosed. In particular, each range of values ​​disclosed herein (in the form of "about a to b," or equivalently, "approximately a to b," or equivalently, "about ab") should be understood to represent each numerical value and range encompassed within a wider range.

[0040] Unless otherwise stated, the genome-wide association study (GWAS) described in this invention is a method for identifying associations between genetic regions (genomes) and traits / diseases. This method identifies variant sites that are significantly associated with specific phenotypes or diseases by detecting hundreds or tens of millions of genetic variations in the genomes of various organisms.

[0041] Unless otherwise stated, the NLR gene (nucleotide binding site receptor rich in leucine repeat sequences) described in this invention is the largest family of disease resistance genes in plants.

[0042] This invention, through GWAS analysis, identified a 148kb region associated with anthracnose resistance in sorghum. This region contains three NLR genes related to immune defense against sorghum pathogens. Transcriptome analysis confirmed that only the SbAr1 gene (Sobic.005G047700) within this region showed high expression levels in both anthracnose-resistant (BTx623) and anthracnose-susceptible (GJH1) varieties. By comparing the SbAr1 gene coding sequences of resistant and susceptible varieties, sequence differences were found in the coding region. In the susceptible variety, a G-to-A base mutation in the SbAr1 coding region caused premature termination of protein coding, resulting in the loss of the LRR domain for recognizing pathogen invasion in the NLR protein. By comparing the SbAr1 gene sequences of resistant and susceptible varieties, a 62bp deletion mutation was found 194bp downstream of the termination mutation in the susceptible material, which was closely linked to the termination mutation.

[0043] Based on this, in one embodiment of the present invention, a molecular marker closely linked to anthracnose resistance in sorghum is provided. In anthracnose-resistant sorghum varieties, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1. In anthracnose-susceptible sorghum varieties, the nucleotide sequence of the molecular marker contains a G / A mutation, closely linked to a 62 bp deletion mutation 194 bp downstream, the nucleotide sequence of which is shown in SEQ ID No. 2, resulting in DNA amplification polymorphism. The base mutation site of the functional molecular marker is located in the coding region of the sorghum SbAr1 gene, 2156 bp downstream of the start codon ATG. This molecular marker can be genotyped in conventional laboratories and can be widely applied to breeding units.

[0044] In another embodiment of the present invention, a specific primer was designed using the above molecular marker to identify anthrax resistance traits, comprising a forward primer SAR993-F with a nucleotide sequence as shown in SEQ ID No. 3 and a reverse primer SAR993-R with a nucleotide sequence as shown in SEQ ID No. 4.

[0045] Furthermore, in one specific embodiment of the present invention, a method for identifying or detecting anthracnose resistance in sorghum using the aforementioned molecular markers and primers is provided. This method involves using the two primers to perform PCR amplification on sorghum leaf DNA to obtain amplification products. If the amplification product is a single band of a 371 bp nucleotide fragment, the sorghum material being tested exhibits anthracnose resistance; if the amplification product is a single band of 309 bp, the sorghum material being tested exhibits anthracnose susceptibility; and if both 371 bp and 309 bp bands are amplified simultaneously, the sorghum material being tested is a heterozygote.

[0046] The following specific embodiments will be provided to explain the solution of the present invention. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0047] Example 1: Determination of SbAr1, a gene associated with anthracnose resistance in sorghum.

[0048] 350 sorghum resource materials (Table 1, all commercially available) were cultivated in a greenhouse. They were cultured at 28℃ for 16 hours during the day and 22℃ for 8 hours at night. Anthrax strains were inoculated into the fourth leaf of the sorghum plant via a puncture inoculation method. Healthy sorghum plants with their fourth leaf were selected, and 6cm long leaves were cut from the leaf tip towards the vein. Two equally sized wounds were made at equal intervals along the vein, and spore suspension (5×10⁻⁶) was dripped onto the wounds. 5 Anthrax resistance was assessed by incubating spores / mL at 6-BA (1 mg / L) for 7 days, followed by measurement of lesion size. Genome-wide association studies (GWAS) were performed on SNPs detected by resequencing data and population anthrax resistance. Figure 1 As shown, a 148kb region on chromosome 5 was detected that was significantly associated with anthrax resistance. This region contains three nucleotide-binding and leucine-rich repeat receptor (NLR) genes, namely Sobic.005G047700, Sobic.005G047800, and Sobic.005G048400.

[0049] Transcriptome data analysis of the resistant material BTx623 and the susceptible material GJH1 revealed that among the three NLR genes in the region significantly associated with anthracnose resistance, only Sobic.005G047700 showed a high expression level. Furthermore, regardless of whether it was the resistant material BTx623 or the susceptible material GJH1, spraying with anthracnose spore suspension (5×10⁻⁶)... 5 Expression levels of spores / mL increased significantly after 24 hours, such as Figure 2 As shown in the figure. Therefore, Sobic.005G047700 was identified as the anthracnose resistance-associated gene in sorghum and named SbAr1. Its nucleotide sequence is shown in SEQ ID No. 5, and its CDS coding sequence is shown in SEQ ID No. 6.

[0050] SEQ ID No. 6: CDS coding sequence of the SbAr1 gene

[0051]

[0052] Example 2: Development of Molecular Markers

[0053] By comparing the SbAr1 gene coding sequences of the resistant variety BTx623 and the susceptible variety GJH1, such as Figure 3 As shown, sequence differences were found in the coding region between resistant and susceptible varieties. In susceptible varieties, a base mutation from G to A in the SbAr1 coding region caused premature termination of protein coding, resulting in the loss of the leucine-rich repeat (LRR) domain in the NLR protein that recognizes pathogen invasion.

[0054] By comparing the SbAr1 gene sequences of the resistant variety BTx623 and the susceptible variety GJH1, a 62bp deletion mutation was found 194bp downstream of the stop mutation G / A, which is closely linked to the stop mutation. Figure 4 As shown in SEQ ID NO. 1. Therefore, a molecular marker SAR993 with a size of 371 bp was developed, spanning termination and deletion mutations, and its nucleotide sequence is shown in SEQ ID NO. 1.

[0055] Example 3: A method for rapid identification of anthracnose resistance in sorghum using the molecular marker SAR993

[0056] (1) Method for extracting genomic DNA from sorghum leaves

[0057] DNA was extracted from sorghum leaves using the CTAB method. The specific procedure was as follows: First, 0.1 g of healthy sorghum leaves were placed in a 2 mL centrifuge tube, flash-frozen in liquid nitrogen, and then ground into powder. 600 μL of 2% CTAB extraction buffer (20 g / L CTAB (hexadecyltrimethylammonium bromide), 1.4 mmol / L NaCl, 20 mmol / L EDTA, 100 mmol / L Tris-HCl (pH = 8.0)) was added, and the mixture was incubated at 65℃ for 1 hour, with shaking to mix every 10 minutes. Then, 600 μL of chloroform:isoamyl alcohol extraction buffer (V...) was added. 氯仿 :V 异戊醇 After mixing the DNA in a 24:1 solution, let it stand for 10 minutes, then centrifuge and transfer 400 μL of the supernatant to a 1.5 mL centrifuge tube. Add an equal volume of ice-cold ethanol and gently mix with the supernatant. Refrigerate at -20°C for 1 hour, then centrifuge again. Discard the supernatant, retaining the DNA precipitate at the bottom of the tube. Wash twice with 75% ethanol. After the DNA has dried, dissolve it in 50 μL of ddH₂O. Determine the DNA concentration and store at -20°C for later use.

[0058] (2) Amplification of sorghum DNA by molecular marker primer SAR993

[0059] The molecular marker primer pair was: forward primer SEQ ID NO.3 and reverse primer SEQ ID NO.4; the reaction system was: 1 μL DNA template, 0.5 μL each of forward and reverse primers (10 μM / μL), 2 μL 10×Easy Taq Buffer, 0.5 μL dNTPs, 0.5 μL Easy Taq Enzyme, and 15 μL ddH2O; the reaction program was: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles, 72℃ final extension for 5 min, and storage at 4℃.

[0060] (3) Polyacrylamide gel electrophoresis detection

[0061] PCR products were detected by electrophoresis using a 2% polyacrylamide gel. 7 μL of PCR product was deposited in each well. The electrophoresis voltage was 220 V, the current was 120 mA, and the time was 30 min.

[0062] (4) Genotyping statistics

[0063] The electrophoresis results were photographed under a UV lamp. If the electrophoretic band contained only a 371bp DNA fragment, it indicated that the leaves of the material were resistant to anthracnose and were marked as R, with the sequence SEQ ID NO.1. If the electrophoretic band contained only a 309bp DNA fragment, it indicated that the leaves of the material were susceptible to anthracnose and were marked as S, with the sequence SEQ ID NO.2.

[0064] (5) Feasibility verification

[0065] To verify the feasibility and accuracy of this marker, 20 sorghum materials were identified using this method. All samples are preserved in the State Key Laboratory of Sichuan Agricultural University. The degree of correspondence between individual plants is relatively high (Table 2 and...). Figure 5 The first lane is for DNA Marker 2000Plus, the second lane is for the disease-resistant material BTx623, the third lane is for the disease-susceptible material GJH1, and the fourth to thirteenth lanes are for single-plant materials.

[0066] It should be noted that the specific features, structures, materials, or characteristics described in this specification may be combined in any suitable manner in one or more embodiments. Furthermore, those skilled in the art can combine and integrate the different embodiments described in this specification and the features of those embodiments without contradiction.

[0067] Table 1 Sorghum Resource Materials

[0068]

[0069]

[0070]

[0071]

[0072] Table 2 Phenotypic Marker Validation

[0073]

[0074]

Claims

1. Associated with resistance to sorghum anthracnose SbAr1 The application of molecular markers in identifying anthracnose resistance traits in sorghum is characterized by: If the nucleotide sequence of the molecular marker is as shown in SEQ ID No. 1, it is a sorghum variety resistant to anthracnose; if the nucleotide sequence of the molecular marker is as shown in SEQ ID No. 2, it is a sorghum variety susceptible to anthracnose.

2. The application of the molecular marker according to claim 1 in identifying anthracnose resistance traits in sorghum, characterized in that: Two primers are used to amplify sorghum leaf DNA by PCR to obtain amplification products. If the amplification product is a single band of a 371 bp nucleotide fragment, the sorghum material being tested has the trait of resistance to sorghum anthracnose; if the amplification product is a single band of 309 bp, the sorghum material being tested has the trait of sorghum anthracnose; if both 371 bp and 309 bp bands are amplified simultaneously, the sorghum material being tested is a heterozygote. The primers include a forward primer with the nucleotide sequence shown in SEQ ID No. 3 and a reverse primer with the nucleotide sequence shown in SEQ ID No.

4.

3. Associated with resistance to sorghum anthracnose SbAr1 The application of molecular markers for genes in screening anthracnose-resistant sorghum varieties is characterized by: If the nucleotide sequence of the molecular marker is as shown in SEQ ID No. 1, it is a sorghum variety resistant to anthracnose; if the nucleotide sequence of the molecular marker is as shown in SEQ ID No. 2, it is a sorghum variety susceptible to anthracnose.

4. The application of the molecular markers according to claim 3 in screening anthracnose-resistant sorghum varieties, characterized in that: Two primers are used to amplify sorghum leaf DNA by PCR to obtain amplification products. If the amplification product is a single band of a 371 bp nucleotide fragment, the sorghum material being tested has the trait of resistance to sorghum anthracnose; if the amplification product is a single band of 309 bp, the sorghum material being tested has the trait of sorghum anthracnose; if both 371 bp and 309 bp bands are amplified simultaneously, the sorghum material being tested is a heterozygote. The primers include a forward primer with the nucleotide sequence shown in SEQ ID No. 3 and a reverse primer with the nucleotide sequence shown in SEQ ID No.

4.

5. Associated with resistance to sorghum anthracnose SbAr1 The application of molecular markers of genes in the preparation of kits, reagents, or chips for detecting anthracnose resistance in sorghum, characterized by: If the nucleotide sequence of the molecular marker is as shown in SEQ ID No. 1, it is a sorghum variety resistant to anthracnose; if the nucleotide sequence of the molecular marker is as shown in SEQ ID No. 2, it is a sorghum variety susceptible to anthracnose.

6. The application of the molecular marker according to claim 5 in the preparation of kits, reagents, or chips for detecting anthracnose resistance in sorghum, characterized in that: Two primers are used to amplify sorghum leaf DNA by PCR to obtain amplification products. If the amplification product is a single band of a 371 bp nucleotide fragment, the sorghum material being tested has the trait of resistance to sorghum anthracnose; if the amplification product is a single band of 309 bp, the sorghum material being tested has the trait of sorghum anthracnose; if both 371 bp and 309 bp bands are amplified simultaneously, the sorghum material being tested is a heterozygote. The primers include a forward primer with the nucleotide sequence shown in SEQ ID No. 3 and a reverse primer with the nucleotide sequence shown in SEQ ID No.

4.

7. A method for identifying resistance to anthracnose in sorghum, characterized in that: Two primers are used to amplify sorghum leaf DNA by PCR to obtain amplification products. If the amplification product is a single band of a 371 bp nucleotide fragment, the sorghum material being tested has the trait of resistance to sorghum anthracnose; if the amplification product is a single band of 309 bp, the sorghum material being tested has the trait of sorghum anthracnose; if both 371 bp and 309 bp bands are amplified simultaneously, the sorghum material being tested is a heterozygote. The primers include a forward primer with the nucleotide sequence shown in SEQ ID No. 3 and a reverse primer with the nucleotide sequence shown in SEQ ID No. 4.