Colorimetric-SERS (Surface Enhanced Raman Scattering) nano-enzyme sensor and application thereof in preparation of LPS (Lipopolysaccharide) detection kit

Abstract

The invention discloses a colorimetric-SERS (Surface Enhanced Raman Scattering) nano-enzyme sensor and application thereof in preparation of an LPS (Lipopolysaccharide) detection kit, and belongs to the technical field of inspection and analysis. According to the colorimetric-SERS nano-enzyme sensor disclosed by the invention, a nano-enzyme probe Au (at) AgPt (at) ZIF-8 NPs which has peroxidase activity and SERS enhancement performance and is of a core-shell structure is synthesized, and high-specificity, accurate and sensitive colorimetric and SERS dual-mode detection of bacterial secretion lipopolysaccharide (LPS) is realized on the basis of a nucleic acid amplification strategy of competitive initiation of an aptamer. The method is expected to guide the development of more nano-enzyme probes, and provides a new thought for the fields of biological medicine, disease diagnosis and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of inspection and analysis, and more specifically to a colorimetric-SERS nanozyme sensor and an application thereof in preparing an LPS detection kit. Background Art

[0002] Bacterial endotoxins produced during bacterial metabolism are highly toxic and easily diffused secretions that can induce a series of immune responses in the body. Extremely small amounts can cause adverse reactions such as fever, while excessive amounts can cause symptoms such as asthma and shock, and can even lead to death, posing a serious threat to human life and health. So far, bacterial endotoxins are one of the key quality inspection items for in vivo injections. If the injection contains a certain amount of endotoxins, mild cases may cause discomfort such as fever, and severe cases may endanger life safety. The main chemical component of bacterial endotoxins is lipopolysaccharide (LPS). Therefore, specific, sensitive and reliable analysis and detection of LPS in injections is directly related to the life safety of the user. The horseshoe crab test is currently the gold standard for detecting LPS in China, the United States and many other countries. Although the horseshoe crab test can achieve rapid and sensitive detection of endotoxins and has been used for more than 30 years, the horseshoe crab reagent used in this method is prepared by taking blood from horseshoe crabs. Because the living environment of the horseshoe crab reagent has been destroyed and horseshoe crabs cannot be artificially cultured, the application prospects of this method have been limited to a certain extent in the face of the increasing demand for LPS detection.

[0003] At the same time, it is difficult to extract bacterial intracellular metabolites, there are many types, and most of them are at low concentrations. Traditional analytical detection methods such as animal testing, instrument detection, immunological methods, and gene probe methods all have certain limitations. For example, although animal experimental methods can draw conclusions directly through observation, they have disadvantages such as large individual differences between animals, time-consuming and labor-intensive experiments, and high costs; although the immunoassay based on antigen-antibody specific binding has strong specificity, the antibody preparation process is relatively cumbersome, and the performance of antibodies prepared from different batches may vary, which in turn has a significant impact on the accuracy of the experimental results. Therefore, the development of a simple, rapid, sensitive, accurate and low-cost analytical detection method for bacterial secretions is of great significance for the early diagnosis of diseases and the diagnosis of bacterial infections.

[0004] Surface enhanced Raman scattering (SERS) has been applied to the analysis and detection of markers such as bacteria, cells, proteins, and nucleic acids because it can significantly enhance the detection signal of material molecules and has the characteristics of ultra-sensitivity and fingerprint. Although precious metals such as Au and Ag, which are commonly used to construct SERS substrates, can achieve electromagnetic field enhancement (EM) for signal amplification through plasma resonance, they still have shortcomings such as poor stability and uniformity, low selectivity, weak enhancement effect, and easy oxidation and denaturation, which hinder their development and application. The nanoscale metal organic framework MOF material ZIF-8 can produce chemical enhancement (CM) with molecules, which not only significantly enhances the SERS effect; but also due to the encapsulation of ZIF-8, it can prevent the oxidation and denaturation of precious metals Au and Ag, and has the effect of stabilizing the SERS substrate.

[0005] In addition, MOF is an important material for constructing nanozymes. Nanozymes are artificial enzymes that have both nanomaterial properties and catalytic functions. They can achieve specific catalytic reactions and generate corresponding signals, such as chemical, optical, and electrical signals. So far, there have been a large number of reports showing that many nanomaterials have activities such as catalase and peroxidase-like enzymes, among which the most representative are precious metal materials such as Pd, Pt, and Au.

[0006] However, many current biosensor technologies have limited linear range and detection limit when analyzing and detecting low concentration targets in the body due to the limited response signal of the sensor to the target. Based on this problem, some researchers have introduced nucleic acid signal amplification technology in the process of building biosensors, such as enzyme-free nucleic acid signal amplification technology CHA and HCR, which further improves the detection sensitivity of biosensors.

[0007] Therefore, providing a colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0008] In view of this, the present invention provides a colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit. The Au@AgPt@ZIF-8 nanozyme structure is developed, and based on the nucleic acid signal amplification strategy, colorimetric and SERS dual-mode detection of LPS is performed to achieve rapid, sensitive, accurate and highly specific analysis and detection of LPS, providing a method and idea with application potential for the detection of bacterial secretions.

[0009] The present invention firstly prepares a core-shell structure Au@AgPt@ZIF-8. Due to the presence of Pt and ZIF-8, it has strong peroxidase activity. In an acetate buffer and H2O2 system with a pH of 4.0, Au@AgPt@ZIF-8 can cause tetramethylbenzidine (TMB) to undergo an oxidation reaction. On the one hand, the reaction solution can be changed from colorless to blue, thereby realizing colorimetric analysis and detection. On the other hand, the molecular structure of TMB changes to form oxTMB, which can realize SERS analysis and detection. At the same time, the MOF material ZIF-8 can further enhance the CM on the basis of Au@AgPt EM enhancement to exert a double-enhanced SERS effect, and protect Au@AgPtNPs from oxidative denaturation, which has the effect of stabilizing and enhancing the SERS signal and improving the detection sensitivity.

[0010] At the same time, in order to separate the target from the impurities, AuMNP nanomaterials modified with 4-mercaptobenzonitrile (4-MBN) were also synthesized. -1 ) is in the silent zone of general Raman reporter molecules, so it is used as an internal standard molecule to improve the accuracy of the detection results. Au MNPs also have magnetic enrichment and SERS enhancement effects, which can further improve the sensitivity of detection. Therefore, Au@AgPt@ZIF-8 and Au MNPs are used in LPS detection at the same time to achieve accurate, sensitive and highly specific colorimetric-SERS dual-mode detection.

[0011] Finally, based on LBA (LPS-specific aptamer), the trigger chain S sequence and hairpin probe H1 and H2 sequences were designed, and H2 and H1 were modified on the surface of Au@AgPt@ZIF-8 and Au MNPs, respectively. The LPS signal was converted into a nucleic acid signal through the aptamer competition strategy, and then the nucleic acid signal was amplified by the CHA (catalyzed hairpin assembly reaction) strategy, finally forming the Au MNPs-H1-H2-Au@AgPt@ZIF-8 composite structure. The principle is: when LPS is not present, LBA combines with the S chain to form double-stranded DNA (dsDNA), and the CHA reaction cannot be initiated; when LPS is present, due to the stronger binding affinity between LPS and LBA, the S chain in LBA-S is competed to form an LPS-LBA complex, and the released S chain can bind to the specific recognition sequence on H1 through the principle of base complementary pairing and open the hairpin structure of the H1 chain to form an H1-S double chain. Afterwards, H2 and the H1 chain on H1-S have specific recognition sites to form a more stable double-stranded H1-H2, and the S chain is released from H1. The released S chain can then combine with other H1s to enter the next CHA cycle, thereby forming more H1-H2 double chains, which plays a role in signal amplification. The Au MNP modified with H1 has enrichment and SERS enhancement effects, and the modified 4-MBN can act as an IS molecule to improve the accuracy of SERS detection. The Au@AgPt@ZIF-8 modified with H2 has a peroxidase-like effect, SERS enhancement effect, and has a certain stabilizing effect on the core structure Au@AgPt NPs. Finally, by establishing a linear relationship between the absorption characteristic peak of ox-TMB and the concentration of LPS, the colorimetric detection of LPS is achieved; at the same time, the ratio of the characteristic peaks of oxTMB and 4-MBN (I 1337 / I 2225 ) and the LPS concentration, achieving accurate, sensitive, and highly specific colorimetric and SERS dual-mode detection of LPS.

[0012] In order to achieve the above object, the present invention adopts the following technical solution: A colorimetric-SERS nanozyme sensor containing H2-Au@AgPt@ZIF-8, H1-Au MNPs and LBA-S.

[0013] Further, the preparation method of the H2-Au@AgPt@ZIF-8 is as follows: 1) Preparation of Au@AgPt@ZIF-8 (1) Add 50 mL of 1 mM HAuCl4 solution to a 100 mL round-bottom flask and heat under reflux in an oil bath at 120 °C until boiling. After boiling for 5-10 min, quickly add 5 mL of 38.8 mM sodium citrate and continue heating for 15-20 min to obtain a deep red 10 nm Au NPs colloidal solution. After cooling to room temperature, store at 4 °C away from light for later use.

[0014] (2) In a 25 mL round-bottom flask, add 11.5 mL of ultrapure water, 1 mL of 10 nm Au NPs, and 12 mL of 10 mM hexadecyltrimethylammonium chloride, respectively. Stir at room temperature for 20 min, then add 300 μL of 100 mM ascorbic acid solution and 500 μL of 200 mM NaOH solution, respectively. Continue stirring for 20 min. At 25-35 °C, quickly add 1 mL of 10 mM AgNO3 solution, and add 0.5 mL of 10 mM H2PtCl6 dropwise every 20-30 s. After the addition is complete, continue the reaction for 60 min to finally obtain dark brown Au@AgPt NPs, which are stored at 4 °C for later use.

[0015] (3) In a 20 mL glass test tube, add 2 mL of 10 mM hexadecyltrimethylammonium bromide and 1 mL of 1.32 M 2-methylimidazole, respectively, and mix by ultrasonication for 60 min. Then, add 10 mL of 0.5 M Zn(NO3)2 and 1 mL of Au@AgPtNPs, respectively, and react by ultrasonication at 70 °C for 20 min. Then, place the mixture in a 30 °C water bath for 2-3 h to obtain a gray-black product, Au@AgPt@ZIF-8, which is washed three times by centrifugation with ultrapure water and stored at 4 °C for later use.

[0016] 2) Modification of H2 chain on Au@AgPt@ZIF-8 (1) Add 100 μL of 80 μg / mL streptavidin to 1 mL of Au@AgPt@ZIF-8 and incubate with stirring at 4 °C for 18-24 h. Centrifuge and redisperse the resulting SA-Au@AgPt@ZIF-8 in 1 mL of PBS (pH = 7.4) for later use.

[0017] (2) Denature Bio-H2 at 95 °C for 10 min and anneal at 40 °C for 1 h to obtain denatured and annealed Bio-H2.

[0018] (3) Mix 100 μL SA-Au@AgPt@ZIF-8 and 5 μL 100 μM denatured annealed Bio-H2, incubate slowly with shaking at room temperature for 1.5 h, and finally centrifuge and wash the product to obtain H2-Au@AgPt@ZIF-8, which is then redispersed in 1 mL PBS (pH = 7.4) for later use.

[0019] The Bio-H2 is 5'-TTTTTTTTTTAAAGTCAAAGTCCTATCTCGTCTCCTGACTTTGACTTTACAGGAGAC-3'; SEQ ID NO.2; 5' end modified Bio.

[0020] Further, the preparation method of the H1-Au MNPs is as follows: 1) Preparation of Au MNPs (1) 100 mL of ethylene glycol and 1.43 g of FeCl3×6H2O were added to a 250 mL round-bottom flask and mixed by ultrasound. Then, 0.2 g of polyethylene glycol and 0.4 g of anhydrous sodium acetate were added. The mixture was vigorously stirred overnight to mix. After being fully mixed, the mixture was transferred to a Teflon-lined stainless steel autoclave and reacted at 180-200 °C for 10 hours. After the reaction was complete, the product was magnetically separated and washed with ultrapure water and anhydrous ethanol for three times respectively. Finally, the product was naturally air-dried at room temperature to obtain Fe3O4 NPs, which were sealed and stored for later use.

[0021] (2) In a 250 mL round-bottom flask, add 180 mL of ultrapure water, 5 mL of 5 mM HAuCl4, and 10 mL of 5 mM sodium citrate, respectively. Stir vigorously for 5 min to mix thoroughly. Finally, add 5 mL of 0.1 M NaBH4 and stir vigorously for 2-4 hours to finally obtain a brown-red 4 nm Au NPs colloidal solution.

[0022] (3) Add 0.3 g of polyethyleneimine to 50 mL of ultrapure water and mix by ultrasonication for 10-15 min to obtain PEI solution. Then, weigh 10 mg of Fe3O4 NPs and add them to the PEI solution. Ultrasonication reaction is carried out for 20 min, and then the mixture is washed with ultrapure water for three times to obtain Fe3O4-PEI.

[0023] (4) Weigh 10 mg of Fe3O4-PEI and add it to an excess of 4 nm Au NPs solution. React under ultrasonic conditions for 2 h, then perform magnetic separation and wash with ultrapure water and anhydrous ethanol three times each to obtain Fe3O4@Au NPs.

[0024] (5) 10 mL 10-3 M of 4-MBN was added to 1 mL of 5 mg / mL Fe3O4@Au NPs, and the resulting mixture was incubated in a -20 °C refrigerator for 30 min, naturally cooled to room temperature, and diluted to 10 ml with anhydrous ethanol to obtain 4-MBN-Fe3O4@Au NPs.

[0025] (6) Mix 10 mg 4-MBN-Fe3O4@Au NPs, 100 mL ultrapure water, and 300 μL 0.1 M HAuCl4. Then, add 1 mL 300 mg / mL NH2OH×HCl under intense ultrasonic conditions at 30°C and react for 10-15 min. Add 500 mg polyvinyl pyrrolidone and continue the reaction for 35 min. After the reaction, wash with ultrapure water three times and finally dilute to 5 mg / mL with anhydrous ethanol to obtain Au MNPs, which were stored at 4°C in the dark.

[0026] 2) Modification of H1 chain on Au MNPs (1) Denature SH-H1 at 95 °C for 10 min and anneal at 40 °C for 1 h to obtain denatured and annealed SH-H1.

[0027] (2) Mix 100 μL Au MNPs and 5 μL 100 μM denatured annealed SH-H1, incubate at 30 °C and 200 rpm for 10 h, then add 100 μL 1% BSA and continue incubating for 3 h. Finally, wash with ultrapure water and disperse the product in 1 mL PBS solution to obtain H1-Au MNPs.

[0028] The SH-H1 is 5'-TTTTTTTTTTATCTCGTCTCCTGTAAAGTCAAAGTCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.1; 5' end modified SH.

[0029] Further, the preparation method of the LBA-S is as follows: The LBA sequence and the S chain sequence were mixed in a ratio of 1:1, denatured at 95 °C for 10 min, and annealed at 40 °C for 1 h to form an LBA-S double chain.

[0030] The S chain sequence: 5'-AGTGTCCGCCTATCTCGTCTCCTG-3'; SEQ ID NO.3.

[0031] The LBA sequence: 5'-CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO. 4.

[0032] Furthermore, the colorimetric-SERS nanozyme sensor is used in the preparation of an LPS detection kit.

[0033] The present invention is based on nucleic acid signal amplification, the design and preparation of Au@AgPt@ZIF-8 nanozyme, and constructs a colorimetric-SERS dual-mode sensing strategy for accurate, sensitive, and highly specific detection of LPS.

[0034] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a colorimetric-SERS nanozyme sensor and its application in the preparation of an LPS detection kit, which has the following beneficial effects: (1) Au@AgPt@ZIF-8 NPs have peroxidase activity and high SERS enhancement performance, and Au MNPs have the dual functions of magnetic separation and SERS enhancement. The present invention applies both of them to the construction of biosensors, which can achieve accurate, sensitive and highly specific colorimetric and SERS dual-mode detection of the target analyte LPS.

[0035] (2) The present invention adopts CHA nucleic acid signal amplification technology, and further realizes ultrasensitive and cascade anti-interference detection of LPS based on the colorimetric-SERS dual-mode sensing of Au@AgPt@ZIF-8, Au MNPs and LPS-specific aptamer (LBA). BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0037] Figure 1 TEM images (the inset is a single nanomaterial) and (D) UV-visible spectra of (A) Au NPs, (B) Au@AgPt NPs, and (C) Au@AgPt@ZIF-8 of the present invention.

[0038] Figure 2 (A) Zeta potential and (B) particle size distribution of Au NPs, Au@AgPt NPs, and Au@AgPt of the present invention.

[0039] Figure 3 TEM images and characterizations of the synthesis process of Au MNPs of the present invention: (A) Fe3O4 NPs; (B) Fe3O4@AuNPs; (C) Au MNPs; (D) XRD spectra of Fe3O4 NPs, Fe3O4@Au NPs and Au MNPs; (E) corresponding hysteresis curves, the inset shows the magnetic enrichment properties of Au MNPs.

[0040] Figure 4 (A) Zeta potential and (B) particle size distribution of Fe3O4 NPs, Fe3O4@PEI, Fe3O4@Au NPs, and Au MNPs of the present invention.

[0041] Figure 5 Verification of the detection strategy of the present invention; (A) UV absorption spectra of solutions of different components a, b, c, and d; (B) SERS spectra of solutions of different components a, b, c, and d; a: H1-Au MNPs; b: H1-Au MNPs+H2-Au@AgPt@ZIF-8; c: H1-Au MNPs+H2-Au@AgPt@ZIF-8+S-LBA; d: H1-Au MNP+H2-Au@AgPt@ZIF-8+S-LBA+LPS.

[0042] Figure 6 To investigate the reproducibility of SERS detection results in this paper: (A) 3D Raman spectra collected from 30 randomly selected detection sites in the same 10 ng / mL LPS detection product and (B) 2D SERS spectra and (C) the corresponding 1337 cm -1 The Raman intensity distribution and (D)I 1337 / I 2225 The distribution of ratios.

[0043] Figure 7 This is an investigation on the specificity of LPS detection in the present invention; MIX=LPS+NaCl+Na2CO3+NaH2PO4+NaHSO3+Glucose+K2HPO4+cysteine+AA+EDTA-2Na.

[0044] Figure 8 To establish the linear curve of colorimetric detection: (A) UV-Vis spectra of different concentrations of LPS (10 3 -0ng / ml is 10 3 , 10 2 , 10 1 , 1, 10 -1 , 10 -2 , 10-3 , 10 -4 , 10 -5 , 0ng / ml); and its (B) linear relationship between the absorbance at 650nm and LPS concentration.

[0045] Fig. 9 Establishment of the linear curve for SERS detection: (A) SERS spectra of different LPS concentrations (B) The corresponding linear relationship between I1337 / I2225 and LPS concentration.

[0046] Fig.10 The linear curves of the Pierce™ Chromogenic Endotoxin Quantitation Kit were established: (A) 0.1-1 EU / mL (B) 0.01-0.1 EU / mL and (C) 10 -4 The linear relationship between the absorbance at 405 nm and LPS concentration was observed in the concentration range of -1.0 EU / mL.

[0047] Fig.11 The absorption peak intensity of different concentrations of LPS in glucose injection: a: Pierce™ chromogenic endotoxin quantification kit (405 nm); b: TMB colorimetric method of the present invention (650 nm), (the upper part of the illustration is the color development result of the kit, and the lower part is the color development result of the TMB colorimetric method of the present invention). DETAILED DESCRIPTION

[0048] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0049] Example 1 Preparation and characterization of Au@AgPt@ZIF-8 Add 50 mL of HAuCl4 solution (1 mM) into a 100 mL round-bottom flask and heat to reflux in an oil bath at 120 °C until boiling. After boiling for 5-10 min, quickly add 5 mL of sodium citrate (38.8 mM) and continue heating the reaction for 15-20 min to obtain a deep red 10 nm Au NPs colloidal solution. After cooling to room temperature, store it at 4 °C away from light for later use. Then, 11.5 mL of ultrapure water, 1 mL of 10 nm Au NPs, and 12 mL of 10 mM CTAC (hexadecyltrimethylammonium chloride) were added to a 25 mL round-bottom flask, respectively, and stirred at room temperature for 20 min. Then, 300 μL of 100 mM AA (ascorbic acid) solution and 500 μL of NaOH solution (200 mM) were added respectively, and stirring continued for 20 min. At 25-35 °C, 1 mL of AgNO3 solution (10 mM) was quickly added, and 0.5 mL of H2PtCl6 (10 mM) was added dropwise every 20-30s. After the addition was completed, the reaction was continued for 60 min to finally obtain black-brown Au@AgPt NPs, which were stored at 4 °C for later use. Finally, 2 mL of CTAB (hexadecyltrimethylammonium bromide) (10 mM) and 1 mL of 2-methylimidazole (1.32 M) were added to a 20 mL glass test tube and ultrasonically mixed for 60 min. Then, 10 mL of 0.5 M Zn(NO3)2 and 1 mL of Au@AgPt NPs were added and ultrasonically mixed at 70 °C for 20 min to obtain Au@AgPt NPs wrapped in ZIF-8 nanomaterials. Finally, the product was placed in a 30 °C water bath for 2-3 h to obtain the gray-black product Au@AgPt@ZIF-8, which was washed three times with ultrapure water by centrifugation and stored at 4 °C for later use.

[0050] TEM images of the prepared Au NPs, Au@AgPt NPs and Au@AgPt@ZIF-8 were analyzed ( Figure 1 ) shows that Au NPs with a size of about 10 nm were first synthesized, see Figure 1 (A); then Au@AgPt NPs with a size of about 40 nm were synthesized by a one-pot method, see Figure 1 In (B), the morphology is popcorn-like, followed by wrapping ZIF-8, and finally forming a cubic core-shell structure Au@AgPt@ZIF-8, see Figure 1 (C) in the figure has a size of about 150 nm. According to the UV absorption spectrum, see Figure 1In (D), Au NPs in Au@AgPt@ZIF-8 show a significant characteristic absorption peak at 520 nm, but when Au@AgPt NPs are further synthesized, the characteristic absorption peak disappears. This is because Pt produces a damping effect that causes the absorption peak of Au NPs to disappear, which also explains the deposition of Pt. Finally, after synthesizing Au@AgPt@ZIF-8, since Au@AgPt NPs are encapsulated in ZIF-8 and ZIF-8 has no obvious absorption peak, Au@AgPt@ZIF-8 has no obvious absorption peak.

[0051] Figure 2 (A) in the figure tests the Zeta potential of the nanoparticles formed during the preparation of Au@AgPt@ZIF-8. Au NPs are negatively charged. After the synthesis of Au@AgPt NPs, the negative charge is converted to a positive charge due to the presence of the surfactant CTAC. Similarly, Au@AgPt@ZIF-8 also presents a positive charge due to the presence of CTAB. Figure 2 (B) in the figure is the particle size of the nanoparticles. The sizes of Au NPs, Au@AgPt NPs and Au@AgPt@ZIF-8 are about 10 nm, 40 nm and 150 nm, respectively, which is consistent with the TEM results.

[0052] Example 2 Preparation and characterization of Au MNPs 100 mL of ethylene glycol and 1.43 g of FeCl3×6H2O were added to a 250 mL round-bottom flask and mixed by ultrasound. Then, 0.2 g of polyethylene glycol and 0.4 g of anhydrous sodium acetate were added. The mixture was vigorously stirred overnight to mix. After sufficient mixing, the mixture was transferred to a Teflon-lined stainless steel autoclave and reacted at 180-200 °C for 10 hours. After the reaction was complete, the product was magnetically separated by a magnet and washed with ultrapure water and anhydrous ethanol for 3 times respectively to remove unreacted reactants. Finally, the product was naturally air-dried at room temperature to obtain Fe3O4 magnetic nanoparticles (Fe3O4 NPs), which were sealed and stored for later use. Secondly, 180 mL ultrapure water, 5 mL HAuCl4 (5 mM) and 10 mL sodium citrate (5 mM) were added to a 250 mL round-bottom flask, stirred vigorously for 5 min to mix thoroughly, and finally 5 mL of freshly prepared NaBH4 (sodium borohydride) (0.1 M) was added, stirred vigorously for 2-4 hours to finally obtain a brown-red 4 nm Au NPs colloidal solution. Then 0.3 g PEI (polyethyleneimine) was added to 50 mL ultrapure water and ultrasonically mixed for 10-15 min to obtain a PEI solution. After that, 10 mg Fe3O4 NPs was weighed and added to the above PEI solution, ultrasonically reacted for 20 min, and then washed with ultrapure water 3 times to remove excess PEI to obtain PEI-modified Fe3O4 nanoparticles (Fe3O4-PEI). Then, 10 mg of Fe3O4-PEI was weighed and added to an excess of 4 nm Au NPs solution, and reacted under ultrasonic conditions for 2 h. Then, a magnet was used for magnetic separation, and the excess Au NPs were washed three times with ultrapure water and anhydrous ethanol, respectively, to remove the excess Au NPs. Finally, Fe3O4 magnetic nanoparticles with Au NPs surface modified (Fe3O4@Au NPs) were obtained. -3M) was added to 1 mL of 5 mg / mL Fe3O4@Au NPs, and the resulting mixture was placed in a -20℃ refrigerator for incubation for 30 min, cooled naturally to room temperature, and diluted to 10 ml with anhydrous ethanol to obtain 4-MBN-modified Fe3O4@Au NPs (4-MBN-Fe3O4@Au NPs). Finally, 10 mg 4-MBN-Fe3O4@Au NPs, 100 mL ultrapure water and 300 μL HAuCl4 (0.1 M) were mixed, and then 1 mL NH2OH×HCl (300 mg / mL) was added under intense ultrasonic conditions at 30℃, and the reaction was continued for 10-15 min. Finally, 500 mg PVP (polyvinyl pyrrolidone) was added and the reaction was continued for another 35 min. After the reaction was completed, it was washed with ultrapure water 3 times, and finally diluted to 5 mg / mL with anhydrous ethanol to obtain Au MNPs, which were stored at 4℃ in the dark.

[0053] like Figure 3 The TEM image (A) shows that the average particle size of the prepared Fe3O4 NPs is about 300 nm, and the morphology is relatively uniform. After the surface of Fe3O4 NPs is modified with Au NPs, the surface of Fe3O4 NPs becomes rough, indicating that Au NPs are successfully modified, see Figure 3 (B) in the figure. After the Au shell is grown, the Fe3O4 NPs are covered with a layer of Au shell with a thickness of about 20 nm. The final size of the prepared Au MNPs is about 400 nm. Figure 3 (C) in. Figure 3 As shown in (D) in the figure, the crystal structure of AuMNPs was characterized by XRD technology. The experimental results show that the diffraction peaks of Fe3O4 appear at 62.7, 57.0, 53.4, 43.2, 35.6 and 30.1, which correspond to the (224), (303), (220), (211), (112) and (024) crystal planes of orthorhombic Fe3O4, respectively. After modifying Au NPs and growing Au shells, diffraction peaks of 77.3, 64.4, 43.9 and 38.0 appear, corresponding to the (311), (220), (200) and (111) cubic structure Au crystal planes, respectively. VSM magnetic detection was also carried out on Fe3O4 NPs, Fe3O4-Au NPs and AuMNPs, as shown in the figure. Figure 3 As shown in (E), the magnetism of the three decreases in sequence, and the magnetic saturation values ​​of Fe3O4 NPs, Fe3O4@Au NPs and Au MNPs are 83.5, 75.2 emu / g and 44.3 emu / g, respectively. Therefore, the synthesized AuMNPs show good magnetic enrichment performance and can meet the requirements of target capture and enrichment in the detection experiment.

[0054] Figure 4 (A) in the figure is the Zeta potential detection of the nanoparticles formed in the process of synthesizing Au MNPs. Fe3O4 NPs are weakly positively charged and close to neutral charge. When PEI is modified on the surface of Fe3O4 NPs, since PEI has ammonium ions, Fe3O4@PEI is positively charged as a whole. After that, after modification with Au NPs, since Au NPs are negatively charged, the positive charge in Fe3O4@PEI is neutralized, causing Fe3O4@Au NPs to be weakly positively charged. Finally, since Fe3O4 is completely wrapped by a layer of Au, AuMNPs are negatively charged as a whole. Figure 4 (B) in the figure is the particle size of the nanoparticles. The sizes of Fe3O4, Fe3O4@PEI, Fe3O4@Au NPs and Au MNPs are about 300 nm, 310 nm, 340 nm and 450 nm, respectively. The size gradually increases, which is basically consistent with the SEM results.

[0055] Example 3 Detection of bacterial endotoxins using CHA-based colorimetric-SERS dual-modal sensor 1) Modification of H1 chain on Au MNPs Based on the formation mechanism of Au-S bond, thiolated DNA chain (SH-H1) (5'- TTTTTTTTTTATCTCGTCTCCTGTAAAGTCAAAGTCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.1; SH modified at the 5' end) was modified on the surface of Au MNPs. First, SH-H1 was denatured (95 ℃, 10 min) and annealed (40 ℃, 1 h). Then, 100 μL Au MNPs and 5 μL denatured and annealed SH-H1 (100 μM) were mixed and incubated at 30 ℃ and 200 rpm for 10 h to react and form Au-S bond. Then, 100 μL BSA (1%) was added and incubated for another 3 h to prevent nonspecific adsorption. Finally, the excess impurities were removed by washing with ultrapure water, and the product was dispersed in 1 mL PBS solution to obtain H1-modified Au MNPs (H1-Au MNPs).

[0056] 2) Modification of H2 chain on Au@AgPt@ZIF-8 Based on the specific connection of biotin (Bio-) and streptavidin (SA-), the biotin-modified H2 chain (Bio-H2) (5'-TTTTTTTTTTAAAGTCAAAGTCCTATCTCGTCTCCTGACTTTGACTTTACAGGAGAC-3'; SEQ ID NO.2; 5'-end modified Bio) was modified to the surface of Au@AgPt@ZIF-8. First, 100 μL SA (80 μg / mL) was added to 1 mL Au@AgPt@ZIF-8, and then stirred and incubated at 4 °C for 18-24 h. After that, the excess SA was removed by centrifugation, and the obtained SA-Au@AgPt@ZIF-8 was redispersed in 1 mL PBS (pH=7.4) for use. Bio-H2 was denatured (95°C, 10 min) and annealed (40°C, 1 h), then 100 μL SA-Au@AgPt@ZIF-8 and 5 μL denatured and annealed Bio-H2 (100 μM) were mixed and incubated at room temperature with slow shaking for 1.5 h. Finally, the product was centrifuged and washed to obtain H2-modified Au@AgPt@ZIF-8 (H2-Au@AgPt@ZIF-8), which was then redispersed in 1 mL PBS (pH=7.4) for later use.

[0057] The test results showed that ( Figure 5 ), where a represents 300mM 12µL H1-Au MNPs, b represents H1-Au MNPs+H2-Au@AgPt@ZIF-8 (both concentrations are 300mM, 6µL each), c represents H1-Au MNPs+H2-Au@AgPt@ZIF-8+S-LBA (both concentrations are 300mM, 4µL each), and d represents H1-Au MNPs+H2-Au@AgPt@ZIF-8+S-LBA+LPS (both concentrations are 300mM, 3µL each). Figure 5As shown in (A), only when H1-Au MNPs, H2-Au@AgPt@ZIF-8, LBA-S (LBA and S chains were mixed in a 1:1 ratio and denatured (95 °C, 10 min) and annealed (40 °C, 1 h) to form an LBA-S double chain; S sequence: 5'-AGTGTCCGCCTATCTCGTCTCCTG-3'; SEQ ID NO.3; LBA sequence: 5'-CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.4), and LPS were present at the same time, an obvious TMB color reaction could occur, and the solution turned from colorless to obvious blue. In the control groups a, b, and c, since the blocking agent BSA cannot completely shield the catalytic performance of Au MNPs on TMB, there is a weak TMB catalysis, showing a slight light blue color, but this color change is within the range allowed by the experimental error. Figure 5 As shown in (B), only when H1-Au MNP, H2-Au@AgPt@ZIF-8, LBA-S, and LPS are present at the same time, will a significant oxTMB SERS signal appear, while the control group has a very weak oxTMB SERS signal, and the signal intensity is within the range allowed by the experimental error. Therefore, this experiment successfully verified the feasibility of the entire strategy.

[0058] Example 4 Study on the reproducibility and specificity of the detection strategy The composite structure formed by the present invention for LPS detection was studied for reproducibility. Figure 6 As shown in (A), 30 detection sites were randomly selected for the same sample, and the corresponding three-dimensional SERS spectrum was finally obtained. The average intensity and relative standard deviation (RSD) of the characteristic peak ratio were calculated. Figure 6 The distribution and intensity of each SERS characteristic peak can be directly observed from the three-dimensional SERS spectrum. The IS molecule 4-mercaptobenzonitrile (4-MBN) has a Raman characteristic peak in the silent region of the Raman peak (2225 cm -1 ), which can avoid the interference of other matrices in the sample; as shown in the figure, when the IS molecular characteristic peak is not added for RSD value calculation, the obtained RSD value is 17.7%, while when the IS molecular characteristic peak is added for calculation, the calculated RSD value drops to 5.2%. After comparison, it is found that the latter detection result shows good reproducibility, which indicates that after adding IS molecules, the reproducibility of SERS detection results is significantly improved.

[0059] In order to evaluate the specificity of the sensor platform, some common additives in injections such as NaCl and AA were selected as interfering substances. First, 5 μL LBA-S (300 mM), 12 μL H1-Au MNP and 5 μL H2-Au@AgPt@ZIF-8 were mixed, and then 0.1 ng / ml solution of the interfering substances was prepared with 0.1 M PBS (pH=7.0), 5 μL was added to the mixed solution, and finally 5 μL LPS (0.01 ng / ml) was added. In addition, 0.1 ng / ml mixed sample solutions of each interfering substance were prepared, and the mixed sample of the interfering substance and LPS were dissolved and diluted with 0.1 M PBS (pH=7.0). The ratio of the concentration of the mixed sample of the interfering substance to the concentration of LPS was 10:1, and the blank control (Blank) was a sample without any interfering substance and LPS. The above solutions were placed at 37 °C for 1.5 h. After the reaction, magnetic separation was performed using a magnet, the supernatant was removed, 100 μL NaAc-Hac (pH = 4.0), 17 μL TMB (12 mM) and 15 μL H2O2 (30%) were added, mixed, and placed at 35 °C for 25 min. Finally, the absorbance of each sample was detected at 650 nm. Figure 7 As shown, compared with the absorbance values ​​of LPS and mixed samples at 650 nm, the absorbance values ​​of each interferent at 650 nm are very weak, indicating that the sensor has good specificity for the analytical detection of LPS.

[0060] Example 5 Sensitivity Study The standard curve of the colorimetric detection of the present invention was established. First, 5 μL LBA-S (300 mM), 12 μL H1-Au MNPs and 5 μL H2-Au@AgPt@ZIF-8 were mixed, and then 5 μL of endotoxin test water prepared with the Pierce™ chromogenic endotoxin quantification kit was added to prepare a series of different concentrations (0, 10 -5 , 10 -4 , 10 -3 , 10 -2 , 10 -1 , 1, 10 1 , 10 2 , 10 3ng / ml) of LPS, and the blank control was a sample without LPS added, and then 0.1 M PBS (pH=7.0) was added to make the final volume 30 μL. It was placed at 37°C for reaction for 1.5 h. After the reaction was completed, magnetic separation was performed with a magnet, the supernatant was removed, and 100 μL NaAc-Hac (pH=4.0), 17 μL TMB (12 mM) and 15 μL H2O2 (30%) were added respectively, mixed, and placed at 35°C for reaction for 25 min. Finally, the absorbance value of each sample at 650 nm was detected. The experimental results are shown in Figure 8 As shown in Figure 2, as the concentration of LPS decreases, the absorbance at 650 nm also decreases, and has a good linear correlation with the LPS concentration. The linear range of LPS concentration is 10 -5 -10 3 ng / mL, LOD is 10.0 fg / mL. Then the samples detected by colorimetric method are subjected to SERS detection to establish the corresponding SERS detection standard curve. The experimental results are shown in Fig. 9 As shown in the figure, as the LPS concentration decreases, the SERS characteristic peak of oxTMB (1337 cm -1 ) also decreased, while the SERS characteristic peak of IS molecule 4-MBN (2225cm -1 ) remained basically unchanged, and the LPS concentration showed a wide and good linear relationship with the SERS characteristic peak ratio (I1337 / I2225) of oxTMB and 4-MBN. The linear range of LPS concentration was 10 -5 -10 3 ng / mL, and LOD was 10.0 fg / mL.

[0061] In order to explore the detection sensitivity of the colorimetric-SERS dual-modal sensor constructed by the present invention to LPS, the Pierce™ colorimetric endotoxin quantification kit and the method constructed by the present invention were used to measure LPS in glucose injection samples. First, a series of LPS standard solutions with concentration gradients were prepared using the endotoxin test water and LPS standard provided by the kit. The method of the present invention and the kit detection method were used to perform three parallel colorimetric tests on each sample, and the absorption values ​​at 650 nm and 405 nm were detected respectively to establish the corresponding standard curve, as shown in FIG. Fig.10 As shown in Figure 2, both methods showed a wide linear relationship with LPS concentration. The linear range of LPS concentration in the kit detection method was 10 -2 -1.0EU / mL, see Fig.10 (A) and (B); the linear range of LPS concentration in the method of the present invention is 10 -4 -1.0 EU / mL, see Fig.10 Therefore, the method of the present invention has higher sensitivity than the kit detection method.

[0062] After the glucose injection was diluted ten-fold with 1× PBS (pH=7.4), a series of LPS solutions with different concentrations were prepared using the diluted injection, ranging from 10 -4 -1.0 EU / mL. Fig.11 It can be seen that when different concentrations of LPS in glucose injection were detected by Pierce™ chromogenic endotoxin quantification kit method and the colorimetric method of the present invention, both detection methods showed a certain linear trend, but the sensitivity of the colorimetric method of the present invention was higher than that of the kit colorimetric method.

[0063] The experimental results show that colorimetric and SERS detection are within 10 -5 ~10 3 The linear relationship was found within the concentration range of ng / mL, and the LOD was 10.0 fg / mL. Compared with the Pierce™ chromogenic endotoxin quantification kit on the market, the LOD of the method of the present invention was lower than that of the kit. Therefore, the colorimetric-SERS dual-modal sensor for LPS detection constructed by the present invention can accurately and sensitively analyze and evaluate LPS in injections.

[0064] The present invention synthesized a core-shell structured Au@AgPt@ZIF-8 nanozyme with uniform particle size, peroxidase activity and SERS enhancement performance, and constructed a colorimetric-SERS dual-mode sensing detection platform based on the nucleic acid amplification CHA strategy to achieve highly specific, accurate and sensitive detection of LPS, which is expected to provide new ideas for analytical detection in the fields of biomedicine, disease diagnosis and so on.

[0065] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A colorimetric-SERS nanozyme sensor, characterized in that: Contains H2-Au@AgPt@ZIF-8, H1-Au MNPs and LBA-S.

2. A colorimetric-SERS nanozyme sensor according to claim 1, characterized in that: The preparation method of the H2-Au@AgPt@ZIF-8 is as follows: 1) Preparation of Au@AgPt@ZIF-8 (1) Add 50 mL of 1 mM HAuCl4 solution to a 100 mL round-bottom flask and heat to reflux in an oil bath at 120 °C until boiling. After boiling for 5-10 min, quickly add 5 mL of 38.8 mM sodium citrate and continue heating for 15-20 min to obtain a deep red 10 nm Au NPs colloidal solution. After cooling to room temperature, store at 4 °C away from light for later use. (2) In a 25 mL round-bottom flask, add 11.5 mL of ultrapure water, 1 mL of 10 nm Au NPs, and 12 mL of 10 mM hexadecyltrimethylammonium chloride, respectively, and stir at room temperature for 20 min. Then, add 300 μL of 100 mM ascorbic acid solution and 500 μL of 200 mM NaOH solution, respectively, and continue stirring for 20 min. At 25-35 °C, quickly add 1 mL of 10 mM AgNO3 solution, and add 0.5 mL of 10 mM H2PtCl6 dropwise every 20-30 seconds. After the addition is completed, continue the reaction for 60 minutes to finally obtain dark brown Au@AgPt NPs, which are stored at 4 °C for later use. (3) Add 2 mL of 10 mM hexadecyltrimethylammonium bromide and 1 mL of 1.32 M2-methylimidazole to a 20 mL glass test tube, mix by ultrasonication for 60 min, then add 10 mL of 0.5 M Zn(NO3)2 and 1 mL of Au@AgPt NPs, mix by ultrasonication at 70 °C for 20 min, and then place in a 30 °C water bath for 2-3 h to obtain a gray-black product, Au@AgPt@ZIF-8, wash by centrifugation with ultrapure water three times, and store at 4 °C for later use; 2) Modification of H2 chain on Au@AgPt@ZIF-8 (1) Add 100 μL of 80 μg / mL streptavidin to 1 mL of Au@AgPt@ZIF-8 and incubate at 4 °C with stirring for 18-24 h. After centrifugation, the obtained SA-Au@AgPt@ZIF-8 was redispersed in 1 mL of PBS with pH = 7.4 for later use; (2) Denature Bio-H2 at 95 °C for 10 min and anneal at 40 °C for 1 h to obtain denatured and annealed Bio-H2; (3) Mix 100 μL SA-Au@AgPt@ZIF-8 and 5 μL 100 μM denatured annealed Bio-H2, incubate slowly with shaking for 1.5 h at room temperature, and finally centrifuge and wash the product to obtain H2-Au@AgPt@ZIF-8, which is then redispersed in 1 mL PBS (pH = 7.4) for later use; The Bio-H2 is 5'-TTTTTTTTTTAAAGTCAAAGTCCTATCTCGTCTCCTGACTTTGACTTTACAGGAGAC-3'; SEQ ID NO.2; 5' end modified Bio.

3. A colorimetric-SERS nanozyme sensor according to claim 1, characterized in that: The preparation method of the H1-Au MNPs is as follows: 1) Preparation of Au MNPs (1) 100 mL of ethylene glycol and 1.43 g of FeCl3×6H2O were added to a 250 mL round-bottom flask and mixed by ultrasound. Then, 0.2 g of polyethylene glycol and 0.4 g of anhydrous sodium acetate were added. The mixture was vigorously stirred overnight and mixed. After being fully mixed, the mixture was transferred to a Teflon-lined stainless steel autoclave and reacted at 180-200 °C for 10 hours. After the reaction was complete, the product was magnetically separated and washed with ultrapure water and anhydrous ethanol for three times respectively. Finally, the product was naturally air-dried at room temperature to obtain Fe3O4 NPs, which were sealed and stored for later use. (2) Add 180 mL of ultrapure water, 5 mL of 5 mM HAuCl4, and 10 mL of 5 mM sodium citrate to a 250 mL round-bottom flask, stir vigorously for 5 min to mix thoroughly, and finally add 5 mL of 0.1 M NaBH4 and stir vigorously for 2-4 hours to finally obtain a brown-red 4 nm Au NPs colloidal solution; (3) Add 0.3 g of polyethyleneimine to 50 mL of ultrapure water and mix by ultrasonic for 10-15 min to obtain PEI solution; then weigh 10 mg of Fe3O4 NPs and add them to the PEI solution, react by ultrasonic for 20 min, and then wash with ultrapure water for 3 times to obtain Fe3O4-PEI; (4) Weigh 10 mg of Fe3O4-PEI and add it to an excess of 4 nm Au NPs solution. React under ultrasonic conditions for 2 h, then perform magnetic separation and wash with ultrapure water and anhydrous ethanol three times respectively to obtain Fe3O4@Au NPs. (5) 10 mL 10 -3 M of 4-MBN was added to 1 mL of 5 mg / mL Fe3O4@Au NPs, and the resulting mixture was placed in a -20 °C refrigerator for incubation for 30 min, cooled naturally to room temperature, and diluted to 10 ml with anhydrous ethanol to obtain 4-MBN-Fe3O4@AuNPs; (6) 10 mg 4-MBN-Fe3O4@Au NPs, 100 mL ultrapure water and 300 μL 0.1 M HAuCl4 were mixed, and then 1 mL 300 mg / mL NH2OH×HCl was added under intense ultrasonic conditions at 30°C for 10-15 min. 500 mg polyvinyl pyrrolidone was added and the reaction was continued for 35 min. After the reaction, the mixture was washed with ultrapure water for 3 times and finally fixed to 5 mg / mL with anhydrous ethanol to obtain Au MNPs, which were stored at 4°C in the dark. 2) Modification of H1 chain on Au MNPs (1) Denature SH-H1 at 95 °C for 10 min and anneal at 40 °C for 1 h to obtain denatured and annealed SH-H1; (2) Mix 100 μL Au MNPs and 5 μL 100 μM denatured annealed SH-H1, incubate at 30 °C and 200 rpm for 10 h, then add 100 μL 1% BSA and continue incubation for 3 h. Finally, wash with ultrapure water and disperse the product in 1 mL PBS solution to obtain H1-Au MNPs. The SH-H1 is 5'-TTTTTTTTTTATCTCGTCTCCTGTAAAGTCAAAGTCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.1; 5' end modified SH.

4. A colorimetric-SERS nanozyme sensor according to claim 1, characterized in that: The preparation method of the LBA-S is as follows: The LBA sequence and the S chain sequence were mixed in a ratio of 1:1, denatured at 95 °C for 10 min, and annealed at 40 °C for 1 h to form an LBA-S double chain; The S chain sequence: 5'-AGTGTCCGCCTATCTCGTCTCCTG-3'; SEQ ID NO.3; The LBA sequence: 5'-CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT-3'; SEQ ID NO.

4.

5. Use of a colorimetric-SERS nanozyme sensor according to claim 1 in the preparation of an LPS detection kit.

Images