A system for targeted quantitative detection of breast cancer cells in blood and its preparation method and application

Abstract

The application belongs to the technical field of biological detection, and specifically discloses a system for targeted quantitative detection of breast cancer cells in blood as well as a preparation method and application thereof. The system comprises a magnetic nanoparticle composite material, Ag nanoparticles, a first modified nucleic acid chain, a second modified nucleic acid chain, a hydrogen peroxide solution, a phosphate buffered saline solution, a urease solution, a urea solution and a phenol red solution. The magnetic nanoparticle composite material comprises magnetic Fe3O4 nanoparticles and polydopamine that is self-polymerized and grown on the surface of the Fe3O4 nanoparticles. The nucleotide sequence of the first modified nucleic acid chain is used for modifying the magnetic nanoparticle composite material. The nucleotide sequence of the second modified nucleic acid chain is used for modifying the Ag nanoparticles. The application has the advantages of high sensitivity, low detection limit, low cost and simple operation, realizes sensitive detection of breast cancer cells in blood, solves the problem of complex matrix interference, and has a good application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, in particular to a system for targeted quantitative detection of breast cancer cells in blood, a preparation method and application thereof. BACKGROUND

[0002] Cancer has been a topic of widespread concern for a long time. Breast cancer has attracted widespread attention because it is the leading cause of death in women. Because breast cancer cannot be accurately diagnosed at an early stage, it can develop without being detected. Therefore, early diagnosis and timely treatment of cancer play a key role in improving patient survival rates.

[0003] Circulating tumor cells (CTC) are tumor cells that circulate in peripheral blood after being shed from the primary tumor. CTC is considered a new and reliable tumor biomarker for early cancer diagnosis and can be detected in the peripheral blood of patients with metastatic and primary tumors. However, due to the low concentration of CTC in human blood, it is not easy to detect, and accurate quantitative detection and analysis of CTC is a very challenging task for researchers. Therefore, a method for rapidly capturing and highly sensitive detection of CTC in real human blood samples is increasingly important in cancer detection, and high-sensitivity detection at ultra-low levels of CTC is beneficial for early breast cancer diagnosis and treatment evaluation. SUMMARY

[0004] In view of the above-mentioned deficiencies existing at present, the present application provides a system for targeted quantitative detection of breast cancer cells in blood, a preparation method and application thereof. The present application has the advantages of high sensitivity, low detection limit, low cost and simple operation, and realizes sensitive detection of breast cancer cells in blood. Compared with the published detection method of breast cancer cells, the present method has a controllable detection range and a lower detection limit, and solves the problem of complex matrix interference, and has a good application prospect.

[0005] In order to achieve the above-mentioned purpose, the present application provides a system for targeted quantitative detection of breast cancer cells in blood, which comprises a magnetic nanoparticle composite material, Ag nanoparticles, a first modified nucleic acid chain, a second modified nucleic acid chain, a hydrogen peroxide solution, a phosphate buffered saline solution, a urease solution, a urea solution and a phenol red solution; wherein

[0006] The magnetic nanoparticle composite material comprises magnetic Fe3O4 nanoparticles and polydopamine self-polymerized and grown on the surface of the Fe3O4 nanoparticles.

[0007] The nucleotide sequence of the first modified nucleic acid chain is shown in SEQ ID NO: 1, and is used for modifying the magnetic nanoparticle composite material.

[0008] It should be noted that the first modified nucleic acid chain is connected with the magnetic nanoparticle composite material through the metal strong coordination between the polydopamine on the surface of the Fe3O4 nanoparticle and the first modified nucleic acid chain.

[0009] The nucleotide sequence of the second modified nucleic acid chain is shown as SEQ ID NO: 2, and is used for modifying the Ag nanoparticle.

[0010] According to one aspect of the present application, the 3' end of the second modified nucleic acid chain is modified with a thiol group, and the Ag nanoparticle is connected with the second modified nucleic acid chain through an Ag-S bond.

[0011] According to one aspect of the present application, the particle size of the Ag nanoparticle is 75-300 nm.

[0012] It should be noted that the size of the magnetic nanoparticle composite material has little effect on the signal output.

[0013] In a specific embodiment, the particle size of the magnetic nanoparticle composite material is 150 nm, and the thickness of the polydopamine is 17 nm.

[0014] According to one aspect of the present application, the concentration of the hydrogen peroxide solution is 10-30 mM, the pH value of the phosphate buffered saline solution is 7.4, the concentration of the urease solution is 10 nM, the concentration of the urea solution is 100 mM, and the concentration of the phenol red solution is 100 μM.

[0015] It should be noted that the pH value of the phosphate buffered saline solution is 7.4 in order to capture the cancer cells under physiological conditions, and the morphology of the cancer cells should be normal, so the pH value is a fixed and universally applicable value.

[0016] Based on the same inventive concept, the present application also provides a preparation method of the above-mentioned system, comprising the following steps:

[0017] S1, preparation of a magnetic nanoparticle composite material:

[0018] Based on the hydrothermal method, magnetic Fe3O4 nanoparticles are synthesized, and a polydopamine layer is grown on the surface of the magnetic Fe3O4 nanoparticles by self-polymerization;

[0019] S2, preparation of Ag nanoparticles:

[0020] Silver nano seeds are prepared by a sodium citrate reduction method; the silver nano seeds, ascorbic acid, silver nitrate and ammonia are mixed and reacted to prepare 75-300 nm uniform quasi-spherical Ag nanoparticles.

[0021] According to one aspect of the present application, the preparation method of the magnetic nanoparticle composite material comprises the following steps:

[0022] A1, iron chloride hexahydrate and sodium acetate trihydrate are added into a solvent and stirred to be uniformly mixed to obtain a mixture; sodium acetate is added into the mixture and mixed uniformly, and then transferred into a polytetrafluoroethylene-lined autoclave and the temperature is increased to 200 DEG C for reaction for 12 h, and then washed to obtain Fe3O4 magnetic nanoparticles;

[0023] A2, the Fe3O4 magnetic nanoparticles are added into a Tris-HCl buffer solution with a dopamine hydrochloride solution for reaction for 8 h, and then washed and freeze-dried to obtain a magnetic nanoparticle composite material, i.e. Fe3O4@PDA nanoparticles; wherein the pH value of the Tris-HCl buffer solution is 8.5.

[0024] Based on the same inventive concept, the present application also provides the above-mentioned system for targeted and quantitative detection of breast cancer cells in blood or the application of the system for targeted and quantitative detection of breast cancer cells in blood prepared by the above-mentioned preparation method in non-disease diagnosis and treatment purposes.

[0025] According to one aspect of the present application, the preparation method comprises the following steps:

[0026] T1, the first modified nucleic acid chain is modified on the surface of the magnetic nanoparticle composite material to obtain N1-Fe3O4@PDA nanoparticles; and the second modified nucleic acid chain is modified on the surface of the Ag nanoparticles to obtain S1-Ag NPs complex;

[0027] T2, the N1-Fe3O4@PDA is added into the sample to be tested and incubated to form a cancer cell-magnetic nanoparticle coupling product;

[0028] T3, the cancer cell-magnetic nanoparticle coupling product is transferred into the phosphate buffered saline solution by magnetic separation, and then the S1-Ag NPs is added and incubated to form a magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure;

[0029] T4, the magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure is added into the hydrogen peroxide solution and reacted, and then the supernatant is taken and added into the urease solution for incubation, and then the urea solution and the phenol red solution are added and incubated, and the ultraviolet absorption signal of the solution after incubation is recorded.

[0030] According to one aspect of the present application, the process of modifying the first modified nucleic acid chain on the surface of the magnetic nanoparticle composite material is specifically as follows:

[0031] The magnetic nanoparticle composite material and the first modified nucleic acid chain were added to a substance containing Ca. 2+ The reaction was incubated in HEPES buffer solution for 2 h, and then washed multiple times with HEPES buffer solution by magnetic separation to obtain Ni-Fe3O4@PDA nanoparticles.

[0032] The process of modifying the surface of the Ag nanoparticles with the second modified nucleic acid chain is specifically as follows:

[0033] The thiol-modified second nucleic acid chain was incubated with TCEP, then mixed with Ag nanoparticles and incubated to obtain a mixture; citrate buffer and phosphate buffer were added to the mixture and mixed, and then centrifuged to obtain the S1-Ag NPs complex.

[0034] According to one aspect of the present invention, in step T2, the incubation conditions for adding Ni-Fe3O4@PDA are 37°C for 120 min; in step T3, the incubation conditions for adding Si-Ag NPs are 37°C for 15 min; in step T4, the reaction time for adding hydrogen peroxide solution is 10 min, and the incubation conditions for adding urease solution are 37°C for 15 min.

[0035] The detection principle of this invention:

[0036] This method employs a "one-to-many" strategy combining cancer cells and enzyme inhibition to achieve dual signal amplification detection of breast cancer cells in the blood. Specifically, for example... Figure 1 As shown in Figure B, firstly, in the presence of target cancer cells (CTCs), N1-Fe3O4@PDA nanoparticles and S1-Ag nanoparticles formed a sandwich structure with breast cancer cells. As the size of the silver nanoparticles increased, the Ag nanoparticles oxidized by H2O2... + The quantity also increases accordingly. Trace amounts of silver ions can completely inhibit urease activity. These ions, oxidized by H₂O₂, release Ag. +The signal unit is regarded as a signal unit acting on urease, thereby inhibiting the activity of urease. The decomposition of urea catalyzed by urease can release a large amount of ammonia, so that the pH of the solution rises, and the double signal amplification detection is realized through the combination of the cancer cell and the enzyme inhibition strategy. When the target breast cancer cells are present, silver nanoparticles with specific nucleic acid sequences can be combined with breast cancer cells captured by magnetic nanoparticles to form a sandwich structure, and after magnetic enrichment and separation, the magnetic nanoparticle-breast cancer cell-silver nanoparticle coupling complex is transferred to the hydrogen peroxide solution for reaction, and the supernatant is taken by magnetic separation, and urease is added for incubation. The Ag nanoparticles captured on the surface of the breast cancer cells are decomposed into millions of silver ions by the hydrogen peroxide solution, which act on the urease and inhibit its activity. In the solution containing urea, the pH indicator phenol red (pH = 5.8) shows yellow, and characteristic absorption peaks appear at 430 nm and 558 nm, and as the concentration of Ag ions increases, the activity of urease is greatly inhibited, resulting in inhibition of the decomposition of urea, and the pH of the solution changes little, and the absorption peak of phenol red at 430 nm becomes higher, and the absorption peak at 558 nm becomes lower (the ultraviolet absorption peak ratio depends on the concentration of breast cancer cells). On the contrary, in the absence of breast cancer cells, the urea in the solution is hydrolyzed to ammonia under the catalysis of urease, resulting in an increase in the pH of the solution. At the same time, as the alkalinity of the solution continuously increases, the color of the solution changes from yellow to pink, and the characteristic absorption peak at 558 nm becomes higher and higher, while the absorption peak at 430 nm almost disappears.

[0037] In addition, a single cancer cell can be captured by multiple silver nanoparticles at the same time, so that more silver ions can be released by hydrogen peroxide etching, thereby more greatly inhibiting the activity of urease than the silver ions released by a single Ag nanoparticle, further improving the signal amplification effect. By controlling the synthesis of silver nanoparticles with different particle sizes, the number of silver ions released can be controlled, thereby improving the sensitivity of the sensor. Compared with conventional colorimetric biosensors, the use of phenol red (the sensitivity of phenol red to pH change is extremely high, and its dissociation constant (pKa) is 7.5, and the molar absorption coefficient (ε = 5.64 x 10 4 M -1 cm -1 , 558 nm) can indicate the change of the pH of the solution in the range of 6.5-8.5. The sensitive change of the biosensor as an indicator can be easily analyzed by the naked eye and an absorption spectrometer, thereby realizing the qualitative and quantitative detection of breast cancer cells.

[0038] The beneficial effects of the present application are:

[0039] (1) The present application realizes the sandwich structure of magnetic nanoparticles-cancer cells-silver nanoparticles by modifying the magnetic nanoparticles and silver nanoparticles with nucleic acid and using breast cancer cells as intermediate carriers. The size of the silver nanoparticles can be controlled, so that one cancer cell can be captured by multiple silver nanoparticles, and the signal is amplified. Under the action of hydrogen peroxide solution, the silver nanoparticles are oxidized into millions of silver ions, which greatly inhibits the activity of urease and further amplifies the signal. Moreover, the signal change of the pH of ammonia produced by the decomposition of urea catalyzed by urease is converted into the change of the ultraviolet absorption peak of phenol red and the color change that can be observed by the naked eye, which ensures that the reaction system does not contact the color developing system after magnetic separation and enrichment, avoiding the interference and influence of the actual complex serum or blood sample on the system. In the experiment, serum and blood are used as actual samples to explore the anti-interference ability of the method. By adding standard to establish a standard curve in a complex system, it is verified that the method has good detection performance in a complex matrix.

[0040] (2) The present application has the advantages of high sensitivity, low detection limit, low cost and simple operation, and realizes the sensitive detection of breast cancer cells in blood. Compared with the published detection method of breast cancer cells, the present application has a controllable detection range and a lower detection limit, and solves the problem of complex matrix interference, and has a good application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 Figure 1 is a schematic diagram of the principle of the system for targeted quantitative detection of breast cancer cells in blood of the present application; wherein A is a schematic diagram of nucleic acid functionalization modification of Fe3O4@PDA and Ag nanoparticles; B is a schematic diagram of the detection principle of targeted quantitative detection of breast cancer cells in blood;

[0042] Figure 2 Figure 2 is a high-resolution transmission electron microscopy image of Fe3O4 and Fe3O4@PDA prepared in Example 2 of the present application; wherein A is a transmission electron microscopy image of Fe3O4; B is a transmission electron microscopy image of Fe3O4@PDA; C is a C element mapping image of Fe3O4@PDA; D is a Fe element mapping image of Fe3O4@PDA; E is a N element mapping image of Fe3O4@PDA; F is an O element mapping image of Fe3O4@PDA;

[0043] Figure 3SEM images and particle size analysis charts of silver nanoparticles with different particle sizes prepared in Example 2 of the present application; wherein, A is silver nanoparticles with a particle size of 75 nm; B is silver nanoparticles with a particle size of 100 nm; C is silver nanoparticles with a particle size of 150 nm; D is silver nanoparticles with a particle size of 200 nm; E is silver nanoparticles with a particle size of 300 nm; F is a chart showing the relationship between the amount of silver nano-seeds added and the particle size of silver nanoparticles;

[0044] Figure 4 UV-visible absorption spectrum and potential verification chart of the first modified nucleic acid chain in Example 1, Fe3O4@PDA nanopowder in Example 2 and nucleic acid functionalized modified Fe3O4@PDA in Example 3 of the present application; wherein, A is an UV-visible absorption spectrum; B is a potential verification chart;

[0045] Figure 5 UV-visible absorption spectrum and potential verification chart of the second modified nucleic acid chain in Example 1, Ag nanoparticles in Example 2 and nucleic acid functionalized modified Ag nanoparticles in Example 3 of the present application; wherein, A is an UV-visible absorption spectrum; B is a potential verification chart;

[0046] Figure 6 Sensitivity analysis of MCF-7 detection by UV-visible absorption spectroscopy for breast cancer cells with different concentrations in Example 3 of the present application; wherein, A is an UV-visible absorption spectrum of breast cancer cells with different concentrations; B is a UV absorption peak ratio curve of breast cancer cells with different concentrations; C, is a UV absorption peak ratio curve of logarithmic breast cancer cells with different concentrations. DETAILED DESCRIPTION

[0047] In order to make the present application easier to understand, the present application will be further described below in combination with specific examples. It should be understood that these examples are only used to illustrate the present application and are not used to limit the scope of the present application. Obviously, the described examples are only a part of the examples of the present application, but not all the examples. Based on the examples in the present application, all other examples obtained by those skilled in the art without making creative efforts fall within the scope of protection of the present application. Unless otherwise defined, the professional terms used below are consistent with the meanings understood by those skilled in the art; unless otherwise specified, the raw materials and reagents involved in the present application can be purchased from the market or prepared by known methods. Unless otherwise specified, the reagents and instruments used in the examples are selected according to the conventional selection in the art. The experimental methods not specified in the examples are realized according to the conventional conditions, such as the conditions described in the literature, books or the methods recommended by the manufacturer.

[0048] Example 1, a system for targeted quantitative detection of breast cancer cells in blood:

[0049] A system for targeted quantitative detection of breast cancer cells in blood, comprising a magnetic nanoparticle composite material, Ag nanoparticles, a first modified nucleic acid chain, a second modified nucleic acid chain, a hydrogen peroxide solution, a phosphate buffered saline solution, a urease solution, a urea solution, and a phenol red solution; wherein,

[0050] The magnetic nanoparticle composite material comprises magnetic Fe3O4 nanoparticles and a polydopamine layer self-polymerized and grown on the surface of the Fe3O4 nanoparticles;

[0051] The nucleotide sequence of the first modified nucleic acid chain (N1) is shown in SEQ ID NO: 1, specifically GCAGTTGATCCTTTGGATACCCTGG, which is used to modify the magnetic nanoparticle composite material;

[0052] The nucleotide sequence of the second modified nucleic acid chain (S1) is shown in SEQ ID NO: 2, specifically TATTCCAAATATCTTCTAAAAAAAAAAAAAAA, which is used to modify the Ag nanoparticles.

[0053] The 3' end of the second modified nucleic acid chain is modified with a thiol group, specifically TATTCCAAATATCTTCTAAAAAAAAAAAAAAA-SH, and the Ag nanoparticles are connected to the second modified nucleic acid chain through an Ag-S bond; the 3' end of the second modified nucleic acid chain is modified with a thiol group, and the Ag nanoparticles are connected to the second modified nucleic acid chain through an Ag-S bond;

[0054] The particle size of the magnetic nanoparticle composite material is 150 nm, and the thickness of the polydopamine layer is 17 nm; the particle size of the Ag nanoparticles is 75-300 nm;

[0055] The concentration of the hydrogen peroxide solution is 20 mM, the pH value of the phosphate buffered saline solution is 7.4, the concentration of the urease solution is 10 nM, the concentration of the urea solution is 100 mM, and the concentration of the phenol red solution is 100 μM.

[0056] Example 2, a preparation method of a system for targeted quantitative detection of breast cancer cells in blood:

[0057] A preparation method of a system for targeted quantitative detection of breast cancer cells in blood (Example 1), comprising the following steps

[0058] (1) A preparation method of a magnetic nanoparticle composite material, comprising the following steps:

[0059] Fe3O4 magnetic nanoparticles were synthesized by a co-precipitation method. In brief, 0.65 g of iron chloride hexahydrate and 0.4 g of sodium acetate trihydrate were added into 40 mL of ethylene glycol under mechanical stirring for one hour. Then, 2.4 g of sodium acetate was added into the mixture and mixed for another 30 minutes. Later, the resulting solution was transferred into a polytetrafluoroethylene-lined autoclave. The temperature was raised to 200 °C and maintained for 12 hours. Then, the synthesized Fe3O4 magnetic nanoparticles were washed with ethanol and ultrapure water for three times, respectively. Subsequently, the Fe3O4 magnetic nanoparticles were added into 40 mL of Tris-HCl buffer solution (pH = 8.5) with 2 mg / mL of dopamine hydrochloride solution to react for 8 hours to form Fe3O4@PDA nanoparticles Figure 1 A). Finally, the synthesized Fe3O4@PDA nanoparticles were washed with ultrapure water for three times and then freeze-dried for 8 hours to obtain Fe3O4@PDA black powder, which was ready for use.

[0060] (2) A method for preparing silver nanoparticles, comprising the following steps:

[0061] Silver nanoseeds were prepared by a sodium citrate reduction method; different amounts of silver nanoseeds (concentration of 4.8 x 10 11 / mL, volume of 300 μL, 125 μL, 40 μL, 20 μL, and 8 μL, respectively), ascorbic acid, silver nitrate, and ammonia were mixed to prepare uniform quasi-spherical silver nanoparticles with a size of 75-300 nm (75 nm, 100 nm, 150 nm, 200 nm, and 300 nm, respectively).

[0062] The Fe3O4 and Fe3O4@PDA prepared in step (1) above were subjected to microscopic morphology analysis, as shown in Figure 2 A. It can be seen from Figure 2 A that the particle size of the Fe3O4 prepared in step (1) above is about 150 nm; from Figure 2 B that the particle size of the Fe3O4@PDA obtained after the PDA layer grows on the surface of Fe3O4 increases to about 170 nm; from Figure 2 C-F that the elements of Fe, C, N, and O are uniformly distributed on the Fe3O4@PDA. In summary, the functional Fe3O4@PDA nanoparticles are successfully prepared in step (1) above.

[0063] The silver nanoparticles with different particle sizes prepared in step (2) above were subjected to scanning electron microscope analysis, and the results are shown in Figure 3 . It can be seen from Figure 3 that silver nanoparticles with different particle sizes can be prepared in step (2) above, and the particle size of the silver nanoparticles increases as the amount of silver nanoseeds decreases.

[0064] Example 3, Application of the system for targeted quantitative detection of breast cancer cells in blood for non-disease diagnosis and treatment purposes:

[0065] Application of the system for targeted quantitative detection of breast cancer cells in blood (Example 1) for non-disease diagnosis and treatment purposes, comprising the following steps:

[0066] (1) The steps of nucleic acid functionalization modification of Fe3O4@PDA are as follows: 0.5 mg of Fe3O4@PDA (prepared by the preparation method of Example 2) and 30 μL of 100 μM of N1 are added to a 10 mM HEPES buffer solution (pH = 7.6) containing 2 mM Ca2+, and the reaction is incubated for 2 hours. Then, the synthesized N1-Fe3O4@PDA composite material (A) is washed with HEPES buffer solution by magnetic separation method for several times. 2+ Figure 1 A). Finally, the N1-Fe3O4@PDA composite material is dispersed in 1 mL of a stock buffer solution (20 mM Tris-HCl, pH = 7.4, containing 0.1% Tween 20 and 0.1% BSA) and stored at 4°C.

[0067] (2) The steps of nucleic acid functionalization modification of Ag nanoparticles are as follows: First, in order to break the possible disulfide bond, the thiolated S1 is incubated with 2 mM of tris(2-carboxyethyl)phosphine hydrochloride (abbreviated as TCEP) for 1 hour. Then, 20 μL of 100 μM of S1 is incubated with Ag nanoparticles (Ag nanoparticles of 75 nm, 100 nm, 150 nm, 200 nm, and 300 nm are prepared by the preparation method of Example 2) for 30 minutes. Subsequently, 5 μL of 500 mM of citric acid buffer solution (pH = 3.0) is added to the mixture, and mixed for 5 minutes. Then, 5 μL of citric acid buffer solution is added again and mixed for 30 minutes. After that, 100 μL of 0.2 M of phosphate buffer solution (pH = 7.4) is added to the mixture to make the solution close to neutral. After 5 minutes, the mixture is centrifuged at 5000 rpm for 5 minutes to remove the unbound S1. Finally, the S1-Ag nanoparticle composite (A) is dispersed in 500 μL of a stock buffer solution (20 mM Tris-HCl, pH = 7.4, 0.14 M NaCl and 0.1% BSA), and stored at 4°C. Figure 1

[0068] ​​(3) In the blood sample containing different concentrations (0 cells / mL, 10 cells / mL, 50 cells / mL, 100 cells / mL, 500 cells / mL, 1000 cells / mL, 5000 cells / mL, 10000 cells / mL, 50000 cells / mL) of breast cancer cells (MCF-7), 16 μL of N1-Fe3O4@PDA was added and incubated at 37°C for 120 min to form a cancer cell-magnetic nanoparticle coupling product. The cancer cell-magnetic nanoparticle coupling product was transferred to a phosphate buffered saline solution (pH = 7.4) by magnetic separation, and then 20 μL of S1-Ag NPs was added and incubated (37°C for 15 min) to form a magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure Figure 1 B).

[0069] (4) Then, 20 mM hydrogen peroxide solution was added to the magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure for etching for 10 min, which released a large amount of silver ions. Then, the supernatant was taken and incubated with 10 nM urease for 15 min (37°C), and then 100 μL of a mixed solution of 100 mM urea and 100 μM phenol red was added. Finally, the ultraviolet absorption signal of the phenol red solution was recorded.

[0070] The first modified nucleic acid chain (N1) involved in the above step (1), Fe3O4@PDA nanoparticles, and nucleic acid functionalized modified Fe3O4@PDA were analyzed by ultraviolet absorption spectrum and Zeta potential analysis, and the results are shown in Figure 4 As can be seen from Figure 4 , the Fe3O4@PDA modified with the first modified nucleic acid chain has a characteristic ultraviolet absorption peak of the first modified nucleic acid chain, and the potential change also well explains this phenomenon. This result indicates the successful modification of the first modified nucleic acid chain on the Fe3O4@PDA.

[0071] The second modified nucleic acid chain (S1) involved in the above step (2), Ag nanoparticles, and nucleic acid functionalized modified Ag nanoparticles were analyzed by ultraviolet absorption spectrum and Zeta potential analysis, and the results are shown in Figure 5 As can be seen from Figure 5 , the silver nanoparticles modified with the second modified nucleic acid chain have a characteristic ultraviolet absorption peak of the second modified nucleic acid chain, and the potential change also well explains this phenomenon. This result indicates the successful modification of the second modified nucleic acid chain on the silver nanoparticles.

[0072] The silver nanoparticles with a particle size of 200 nm were nucleic acid functionalized and detected as described above, and the UV absorption signals of the phenol red solution were recorded to produce the UV-visible absorption spectrum and the UV absorption peak ratio curve of the breast cancer cells with different concentrations, the results of which are shown in FIG. 8A. Figure 6 As shown in FIG. 8B, Figure 6 A, no silver nanoparticles were captured in the absence of target breast cancer cells. After etching with the hydrogen peroxide solution, the urease activity was not inhibited. After adding the phenol red indicator and urea, the urease catalyzed the decomposition of urea to produce a large amount of ammonia, causing the solution pH to rise, the solution color to change from yellow to pink, and the characteristic absorption peak at 558 nm to become higher (originally a small peak), while the absorption peak at 430 nm almost disappeared. However, in the presence of target breast cancer cells, the breast cancer cells became intermediate carriers, connecting the magnetic nanoparticles and silver nanoparticles to form a sandwich structure. Under the action of the hydrogen peroxide solution, a large amount of silver ions were produced, which greatly inhibited the activity of the urease when mixed with the urease. After adding the urea and phenol red mixed solution, the silver ions inhibited the activity of the urease, thereby inhibiting the hydrolysis of urea, and the solution pH did not change significantly. The color remained yellow, and as the concentration of breast cancer cells increased, the concentration of Ag ions increased, greatly inhibiting the activity of the urease, leading to inhibition of the decomposition of urea, and the solution pH did not change significantly. The absorption peak of the phenol red at 430 nm became higher, and the absorption peak at 558 nm became lower and lower, indicating that the UV absorption peak ratio depended on the concentration of breast cancer cells. In summary, the dynamic changes in the UV absorption peaks of the phenol red at 558 nm and 430 nm can indicate the changes in the ammonia produced by the decomposition of urea in the solution, thereby indicating the changes in the activity of the urease, and thereby indicating the changes in the concentration of breast cancer cells captured by the silver nanoparticles.

[0073] It should be noted that, Figure 6 The peaks at 430 nm in FIG. 8A correspond to the concentrations of breast cancer cells from bottom to top as 0 cells / mL, 10 cells / mL, 50 cells / mL, 100 cells / mL, 500 cells / mL, 1000 cells / mL, 5000 cells / mL, 10000 cells / mL, and 50000 cells / mL, Figure 6 The peaks at 558 nm in FIG. 8A are the opposite.

[0074] As shown in FIG. 8B, Figure 6 B-C, the concentration of MCF-7 (breast cancer cells) and the ratio of the UV absorption peaks at 430 nm and 558 nm showed a non-linear positive correlation. The detection limit of MCF-7 was 2 cells / mL, and the dynamic range was 10 cells / mL to 10 4 cells / mL. The standard calibration curve is shown in FIG. 8C.4 cells / mL, which is related to the logarithm of the concentration of MCF-7, R 2 = 0.990. That is, the detection limit of 200 nm silver nanoparticles for MCF-7 is 2 cells / mL.

[0075] The same detection was performed on the above-mentioned silver nanoparticles of other particle sizes (75 nm, 100 nm, 150 nm, 300 nm), and the results were as follows: the detection limit of 75 nm silver nanoparticles for MCF-7 was 89 cells / mL, the detection limit of 100 nm silver nanoparticles for MCF-7 was 48 cells / mL, the detection limit of 150 nm silver nanoparticles for MCF-7 was 15 cells / mL, and the detection limit of 300 nm silver nanoparticles for MCF-7 was 13 cells / mL.

[0076] The above merely describes the specific embodiments of the present application, but the protection scope of the present application is not limited thereto, and any person skilled in the art can easily think of the changes or replacements within the technical scope disclosed by the present application, which should be covered by the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. A system for targeted quantitative detection of breast cancer cells in blood, characterized in that, The components include magnetic nanoparticle composite materials, Ag nanoparticles, a first modified nucleic acid chain, a second modified nucleic acid chain, hydrogen peroxide solution, phosphate buffer solution, urease solution, urea solution, and phenol red solution; among which, The magnetic nanoparticle composite material includes magnetic Fe3O4 nanoparticles and a polydopamine layer that is self-polymerized and grown on the surface of the Fe3O4 nanoparticles. The nucleotide sequence of the first modified nucleic acid chain is shown in SEQ ID NO: 1, and is used to modify the magnetic nanoparticle composite material; The nucleotide sequence of the second modified nucleic acid chain is shown in SEQ ID NO: 2, and is used to modify the Ag nanoparticles.

2. The system for targeted quantitative detection of breast cancer cells in blood according to claim 1, characterized in that, The 3' end of the second modified nucleic acid chain is modified with a thiol group, and the Ag nanoparticles are connected to the second modified nucleic acid chain through Ag-S bonds.

3. The system for targeted quantitative detection of breast cancer cells in blood according to claim 1, characterized in that, The magnetic nanoparticle composite material has a particle size of 150 nm, the polydopamine has a thickness of 17 nm, and the Ag nanoparticles have a particle size of 75~300 nm.

4. The system for targeted quantitative detection of breast cancer cells in blood according to claim 1, characterized in that, The concentration of the hydrogen peroxide solution is 10-30 mM, the pH of the phosphate buffer solution is 7.4, the concentration of the urease solution is 10 nM, the concentration of the urea solution is 100 mM, and the concentration of the phenol red solution is 100 μM.

5. The method for preparing the system for targeted quantitative detection of breast cancer cells in blood according to claim 1, characterized in that, Includes the following steps: S1. Preparation of magnetic nanoparticle composite materials: Magnetic Fe3O4 nanoparticles were synthesized by hydrothermal method, and then a polydopamine layer was grown on the surface of the magnetic Fe3O4 nanoparticles by self-polymerization. Preparation of S2 and Ag nanoparticles: Silver nanoseeds were prepared by sodium citrate reduction; then, the silver nanoseeds, ascorbic acid, silver nitrate and ammonia were mixed and reacted to prepare uniform quasi-spherical Ag nanoparticles with a diameter of 75-300 nm.

6. The method for preparing the system for targeted quantitative detection of breast cancer cells in blood according to claim 5, characterized in that, The preparation method of the magnetic nanoparticle composite material includes the following steps: A1. Add ferric chloride hexahydrate and sodium acetate trihydrate to the solvent and stir to mix well to obtain a mixture; add sodium acetate to the mixture and mix well, then transfer to a polytetrafluoroethylene-lined autoclave and raise the temperature to 200 °C for 12 h. After washing, Fe3O4 magnetic nanoparticles are obtained. A2. The Fe3O4 magnetic nanoparticles and dopa hydrochloride solution were added to Tris-HCl buffer solution and reacted for 8 h. After washing and freeze-drying, the magnetic nanoparticle composite material, namely Fe3O4@PDA nanoparticles, was obtained. The pH value of the Tris-HCl buffer solution was 8.

5.

7. The application of the targeted quantitative detection system for breast cancer cells in blood according to any one of claims 1 to 4, or the system for targeted quantitative detection of breast cancer cells in blood prepared by the preparation method according to claims 5 to 6, in the preparation of reagents for targeted quantitative detection of breast cancer cells in blood.

8. The application according to claim 7, characterized in that, Includes the following steps: T1. Modify the surface of the magnetic nanoparticle composite material with the first modified nucleic acid chain to obtain N1-Fe3O4@PDA nanoparticles; modify the surface of the Ag nanoparticles with the second modified nucleic acid chain to obtain S1-Ag NPs complex; T2. Add the N1-Fe3O4@PDA to the sample to be tested and incubate to form a cancer cell-magnetic nanoparticle coupling product; T3. The cancer cell-magnetic nanoparticle coupling product is transferred to the phosphate buffer solution by magnetic separation, and then the S1-Ag NPs are added and incubated to form a magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure. T4. After adding the magnetic nanoparticle-cancer cell-silver nanoparticle sandwich structure to the hydrogen peroxide solution and reacting, take the supernatant and add the urease solution for incubation, then add the urea solution and phenol red solution for incubation, and record the ultraviolet absorption signal of the incubated solution.

9. The application according to claim 8, characterized in that, The process of modifying the surface of the magnetic nanoparticle composite material with the first modified nucleic acid chain is as follows: The magnetic nanoparticle composite material and the first modified nucleic acid chain were added to a substance containing Ca. 2+ The reaction was incubated in HEPES buffer solution for 2 h, and then washed multiple times with HEPES buffer solution by magnetic separation to obtain N1-Fe3O4@PDA nanoparticles. The process of modifying the surface of the Ag nanoparticles with the second modified nucleic acid chain is specifically as follows: The thiol-modified second nucleic acid chain was incubated with TCEP, then mixed with Ag nanoparticles and incubated to obtain a mixture; citrate buffer and phosphate buffer were added to the mixture and mixed, and then centrifuged to obtain the S1-Ag NPs complex.

10. The application according to claim 8, characterized in that, In step T2, the incubation conditions for adding N1-Fe3O4@PDA are 37 ℃ for 120 min; in step T3, the incubation conditions for adding S1-Ag NPs are 37 ℃ for 15 min; in step T4, the reaction time for adding hydrogen peroxide solution is 10 min, and the incubation conditions for adding urease solution are 37 ℃ for 15 min.

Images