Application of PARP1 in preparation of broad-spectrum RNA virus inhibitor

Abstract

The invention discloses an application of PARP1 in preparation of a broad-spectrum RNA virus inhibitor. The host factor PARP1 is found to play an important role in the replication process of cytoplasm viruses such as coronavirus, flavivirus and enterovirus as a negative regulatory factor for the first time, and the PARP1 is found to inhibit cytoplasm RNA virus replication by regulating the combination of RNA virus and polymerase RdRp. The research aims to reveal broad-spectrum antiviral activity and mechanism of PARP1, promote understanding of interaction between virus and host, and provide a new strategy for developing host protein as an antiviral drug target.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the application of PARP1 in the preparation of broad-spectrum RNA virus inhibitors. Background Art

[0002] New viruses continue to emerge throughout human history, posing a serious threat to global public health security and causing huge economic losses. Currently, climate change and globalization have created more favorable conditions for the spread of viruses, and the world is facing attacks from various highly pathogenic viruses. In the future, outbreaks of new viruses may become more frequent, and research on a single virus, a single viral target, and a single host target may not be able to effectively respond to the emergence of unknown viruses. Therefore, the development of effective broad-spectrum antiviral drugs to combat new and re-emerging viruses that may break out in the future is a top priority in the current field of virus research, and it is also an issue of general concern in academia and industry.

[0003] Currently, most approved antiviral drugs target viral proteins and inhibit specific steps in the viral infection cycle. This type of virus-targeted drug that directly acts on the virus usually has a narrow coverage range and a long R&D cycle, and is not scalable. In comparison, host-targeted drugs usually have the advantages of broad-spectrum antiviral activity and low drug resistance. In addition, broad-spectrum host-targeted drugs can be immediately applied to the clinic without having to spend time developing specific treatments, and have forward-looking functions. Therefore, the study of broad-spectrum antiviral mechanisms targeting the host will be a key research direction in the field of virology.

[0004] The host protein PARP1 (Poly [ADP-ribose] polymerase 1) is called poly ADP ribose polymerase 1, also known as ADPRT1 (ADP-ribosyltransferase 1), which is an ADP-ribosyltransferase. It plays an important role in biological processes such as DNA damage repair, transcription, DNA replication, chromatin remodeling, energy metabolism and apoptosis. In recent years, the regulatory function of PARP1 in viral infection has also been gradually analyzed. Its regulated viruses include retroviruses, herpes viruses, hepatitis B virus, influenza virus, etc. For example, PARP1 binds to the hepatitis B virus (HBV) core promoter and enhances viral gene transcription and HBV replication. During herpes virus infection, PARP1 inhibits viral reactivation by binding to the EBV promoter BZLF1. In human immunodeficiency virus 1 (HIV-1) infection, PARP1 can promote the transcription of HIV-1 and promote the integration of the viral genome into the host chromosome. PARP-1 activity also increases long terminal repeat (LTR)-mediated viral gene transcription. During human T-lymphotropic virus 1 (HTLV-1) infection, PARP1 can activate the transcription of Tax binding elements. During influenza A virus infection, PARP1 interacts with viral hemagglutinin to degrade type I interferon receptor (IFNAR), thereby enhancing viral genome replication. Summarizing the above research results, it can be found that PARP1 regulates DNA viruses or retroviruses mainly by binding to the promoter of the viral genome, thereby regulating the transcription and replication of the virus. However, the research on PARP1's regulation of cytoplasmic RNA viruses, especially coronaviruses, needs to be further explored.

[0005] Viral RNA replication is an important part of the viral life cycle. The RNA-dependent polymerase (RdRp) is the core component of RNA virus transcription and replication. It is considered an important antiviral drug target and has been widely studied. However, there are still few studies on host-targeted drugs for RNA virus RdRp. In-depth research on RdRp-related host proteins will help discover broad-spectrum host targets for antiviral drugs. Summary of the invention

[0006] The purpose of the present invention is to provide the application of PARP1 in preparing a broad-spectrum RNA virus inhibitor.

[0007] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides the use of PARP1 in the preparation of a broad-spectrum RNA virus inhibitor.

[0008] The reference sequence number of PARP1 from human is NM_001618.4 in NCBI.

[0009] In a second aspect, the present invention provides the use of PARP1 in the preparation of products (such as drugs, vaccines, health products and / or foods) for treating diseases caused by RNA virus-infected cells and / or preventing diseases caused by RNA virus-infected cells.

[0010] The virus described in the present invention is a cytoplasmic RNA virus, including viruses of the genera coronavirus, flavivirus, and enterovirus, including but not limited to coronavirus (such as SARS-CoV-2, HCoV-OC43, etc.), Zika virus, and enterovirus EV71.

[0011] Furthermore, the broad-spectrum RNA virus inhibitor, or the product for treating diseases caused by RNA virus-infected cells and / or preventing diseases caused by RNA virus-infected cells is a substance that increases the expression level of PARP1.

[0012] The substances for improving the expression level of PARP1 described in the present invention include substances for enhancing the expression of PARP1 gene in cells, substances for improving the activity of PARP1 in cells, and substances for improving the content of PARP1 in cells.

[0013] The substance that increases the expression level of PARP1 can be selected from any one or more combinations of the following 1)-3): 1) Expression vector expressing PARP1; 2) Drugs or other biological agents that increase PARP1 expression levels; 3) Chemical modifiers that increase PARP1 gene expression.

[0014] Furthermore, the expression vector includes a eukaryotic expression vector and a prokaryotic expression vector.

[0015] Furthermore, the drug or other biological agent for increasing the expression level of PARP1 includes one or more combinations of PARP1 agonists.

[0016] Furthermore, the chemical modification can be selected from one or a combination of ribose modification, base modification, phosphate backbone modification, etc.

[0017] The cells described in the present invention are mammalian (such as human, monkey, mouse, etc.) cells.

[0018] In a third aspect, the present invention provides a method for treating and / or preventing viruses such as coronavirus, Zika virus, enterovirus EV71, etc., comprising administering to a recipient animal a substance that enhances the expression of the PARP1 gene in cells to treat and / or prevent these types of RNA viruses.

[0019] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: This paper first discovered that the host factor PARP1 plays an important role as a negative regulatory factor in the replication of cytoplasmic viruses such as flavivirus, enterovirus, and coronavirus, and found that PARP1 inhibits the replication of cytoplasmic RNA viruses by regulating the binding of RNA viruses to polymerase RdRp. This study aims to reveal the broad-spectrum antiviral activity and mechanism of PARP1, promote the understanding of the interaction between viruses and hosts, and provide new strategies for the development of antiviral drugs targeting host proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is an analysis of the anti-coronavirus HCoV-OC43 activity of PARP1 in Example 1 of the present invention.

[0021] Figure 2 This is an analysis of the anti-SARS-CoV-2 activity of PARP1 in Example 1 of the present invention.

[0022] Figure 3 This is an analysis of the activity of PARP1 against EV71 of the genus Enterovirus of the family Parvoviridae in Example 1 of the present invention.

[0023] Figure 4 This is an analysis of the anti-Zika virus activity of PARP1 in Example 1 of the present invention.

[0024] Figure 5 This is the effect of PARP1 on viral RdRp activity in Example 2 of the present invention.

[0025] Figure 6 This is the mechanism by which PARP1 regulates viral RdRp activity in Example 3 of the present invention. DETAILED DESCRIPTION

[0026] The present invention aims to provide a scheme for broadly inhibiting RNA viruses infecting cells in the host cytoplasm.

[0027] The present invention adopts the following technical solution: The present invention provides use of a substance for increasing PARP1 gene expression in cells in the preparation of RNA virus (coronavirus, enterovirus EV71, Zika virus, etc.) inhibitors or virus replication inhibitors.

[0028] The present invention also provides the use of a substance that increases the expression of the PARP1 gene in cells in the preparation of products (such as drugs, vaccines, health products and / or foods) for treating diseases caused by cells infected by viruses such as coronavirus, Zika virus, enterovirus EV71, etc. and / or preventing diseases caused by cells infected by RNA viruses.

[0029] The present invention also provides the use of a substance for increasing the PARP1 content in cells in the preparation of virus inhibitors such as coronavirus, Zika virus, enterovirus EV71, or virus replication inhibitors of these types.

[0030] The present invention also provides the use of substances that increase the PARP1 content in cells in the preparation of products (such as drugs, vaccines, health products and / or foods) for treating diseases caused by cells infected by viruses such as coronavirus, Zika virus, enterovirus EV71, etc. and / or preventing diseases caused by cells infected by these types of viruses.

[0031] The present invention also provides the use of PARP1 in preparing products (such as reagents) for inhibiting the replication of viruses such as coronavirus, Zika virus, and enterovirus EV71.

[0032] The present invention also provides a method for inhibiting viruses such as coronavirus, Zika virus, enterovirus EV71 and the like from infecting animals, comprising administering a substance that enhances the expression of PARP1 gene in cells to a recipient animal to inhibit these types of viruses from infecting animals.

[0033] The present invention also provides a method for treating and / or preventing viruses such as coronavirus, Zika virus, enterovirus EV71, etc., comprising administering a substance that enhances the expression of PARP1 gene in cells to a recipient animal to treat and / or prevent these types of RNA viruses.

[0034] In the above application, the RNA virus is coronavirus (SARS-CoV-2, HCoV-OC43), Zika virus, enterovirus EV71. The product for treating diseases caused by RNA virus-infected cells and / or preventing diseases caused by virus-infected cells can be a broad-spectrum anti-cytoplasmic RNA virus drug.

[0035] In the above application, the substance for increasing the expression of PARP1 gene in cells, the substance for increasing the expression of PARP1 in cells and the substance for increasing the content of PARP1 in cells can all be substances for increasing the expression of PARP1 gene by exogenous overexpression technology or CRISPR technology, such as any one of the following biological materials 1)-3): 1) Expression vector for PARP1, 2) Drugs or other biological agents that increase PARP1 expression, 3) Chemical modifiers that increase PARP1 gene expression.

[0036] In the above applications, the expression vector includes a eukaryotic expression vector and a prokaryotic expression vector.

[0037] The chemical modification may include one or a combination of several selected from ribose modification, base modification and phosphate backbone modification.

[0038] In the above application, the drug or other biological agent for increasing the expression level of PARP1 may include one or more combinations of PARP1 agonists.

[0039] In the above applications, the cells may be mammalian cells, such as human, monkey, mouse, etc.

[0040] In the above application, the product may contain the substance that increases the expression of PARP1 gene in cells, the substance that increases the expression level of PARP1 in cells and / or the substance that increases the content of PARP1 in cells.

[0041] The present invention firstly uses the proteomics method to identify the interacting proteins of RNA-dependent RNA polymerase (RdRp), a key enzyme required for the replication of the new coronavirus, using chromatography-mass spectrometry tandem technology, and for the first time proposes that PARP1 exhibits broad-spectrum inhibitory activity against a variety of RNA viruses. Using exogenous overexpression technology to increase PARP1 gene expression can significantly inhibit the replication of coronaviruses (SARS-CoV-2, HCoV-OC43), Zika virus, and enterovirus EV71, and using siRNA to downregulate endogenous PARP1 in cells can significantly increase viral replication. Using the RdRp-Gluc reporter analysis system, it was found that when the PARP1 plasmid was overexpressed, the expression levels of Gluc positive and negative strands in the CoV-RdRp-Gluc system were significantly reduced as the PARP1 expression level increased compared with the control group, indicating that PARP1 can reduce the activity of SARS-CoV-2 RdRp. When siRNA was used to downregulate the endogenous expression level of PARP1 in cells, the expression levels of Gluc positive and negative strand mRNA in the CoV-RdRp-Gluc system were significantly upregulated compared with the NC control group, further indicating that PARP1 can downregulate the activity of SARS-CoV-RdRp. These results indicate that PARP1 negatively regulates SARS-CoV-2 virus RdRp and inhibits its activity, which may be the reason why PARP1 restricts the replication of coronavirus.

[0042] In order to further clarify the specific mechanism by which PARP1 inhibits the activity of viral RdRp, we used the RdRp-Gluc reporter analysis system and RIP (RNA Binding Protein Immunoprecipitation Assay) technology and found that overexpression of PARP1 can inhibit the binding of the cytoplasmic virus (coronavirus, Zika virus) genome with its polymerase RdRp, while knocking down the expression level of PARP1 in host cells can significantly promote the binding of the cytoplasmic virus (coronavirus, Zika virus) genome with its polymerase RdRp, suggesting that PARP1 can widely regulate the binding of RNA viruses and polymerase RdRp, thereby inhibiting the replication of cytoplasmic RNA viruses.

[0043] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0044] The cell culture medium used in the following examples was DMEM medium containing 10% FBS. ZIKV (strain FSS13025) was kindly provided by Professor Mark Wainberg of McGill University, Canada. Enterovirus 71 (EV71) strain was the enterovirus 71 epidemic strain in Fuyang, China in 2008 (EV71-FY), isolated from fecal specimens of children with central nervous system diseases. HCoV-OC43 (VR-1558) was purchased from ATCC.

[0045] Example 1 Broad-spectrum antiviral activity of PARP1 1. PARP1 inhibits the replication of coronavirus HCoV-OC43 The recombinant human coronavirus HCoV-OC43 with Renilla luciferase (RLuc) reporter gene was used as a research model, and the luciferase activity was detected to indicate the translation level of HCoV-OC43 viral RNA. In BHK21 cells, Myc-PARP1 was overexpressed (0, 50, 100 ng / well) ( Figure 1 A) or knocking down the expression level of endogenous PARP1 in cells using siRNA ( Figure 1 B) to detect its effect on the replication of recombinant HCoV-OC43 virus. The experimental results showed that compared with the control group, the luciferase activity in the PARP1 transfected cells was significantly reduced ( Figure 1 A). When the intracellular content of endogenous PARP1 was downregulated, the luciferase activity in the cells increased significantly ( Figure 1 B).

[0046] RLuc activity detection method: 250 μg of substrate Coelenterazine (Cat. No. 40904ES03, YEASEN) lyophilized powder was dissolved in 600 μL of anhydrous ethanol to prepare a substrate mother solution with a concentration of 1.022 mM, which was stored at -20°C; before measurement, the mother solution was diluted in PBS at a ratio of 1:60 to prepare a substrate working solution. The working solution was allowed to stand at room temperature for 30 minutes to stabilize. Since the substrate was unstable when exposed to light, it needed to be protected from light throughout the process. Luciferase Cell Culture Lysis 5×Reagent (Cat. No. E1531, Promega) was prepared into 1× cell lysis buffer with distilled water. 100 μL of lysis buffer was added to each well of the 6-well plate cells, and lysis was performed at room temperature for 30 minutes. 10 μL of cell lysis buffer supernatant was taken into a white opaque 96-well plate. The substrate working solution incubated in the dark was added to each well at a volume of 60 μL per well using the microplate reader CentroXS3 LB 960 automatic sampler. The signal was continuously collected for 0.5 seconds, and the measurement results were expressed in absolute light units. Four parallel groups were set up in the experiment, with the empty vector expression group or the control RNA transfection group as the reference, and statistical analysis was performed. The experimental data were expressed as x ± s, and the graphs and statistical analyses were performed using GraphPad Prism 8. Figure 1 A and B in Chinese.

[0047] siRNA knockdown PARP1 operation method: According to the instructions of Lipofectamine RNAiMAX transfection reagent (Invitrogen), siRNA reverse transfection was performed in a six-well plate to make the final siRNA concentration 10 nM. Finally, a density of 3×10 5 The 293T cell suspension of 100 μg / mL was mixed and cultured in an incubator at 37°C and 5% CO2. The knockdown sequence used was: NC (control): UUCUCCGAACGUGUCACGU (SEQ ID NO: 1); siPARP1-#1:CCUGGUGGACAUCGUUAAA (SEQ ID NO:2); siPARP1-#2:AAGCCUCCGCUCCUGAACAAU (SEQ ID NO:3).

[0048] After 24 hours, the cells were infected with recombinant human coronavirus HCoV-OC43 with a reporter gene at MOI=0.001. After 48 hours, the cells were rinsed once with 1 mL pre-cooled PBS, and 100 μL RIPA (50 mM Tris-HCl (pH7.4), 150 mM NaCl, 1% NP-40, 0.1% SDS, Roche protease inhibitor mixture) was added after washing. The cells were scraped off with a cell scraper and collected in a 1.5 mL EP tube. Add 25 μL 5×SDS protein loading buffer and vortex oscillation to lyse, and the total cell protein sample was obtained by metal bath at 100°C for about 15 min. The protein samples were directly subjected to conventional immunoblotting (Western Blot) detection or stored at -20°C or -80°C. In this embodiment, Western Blot was used to detect the expression of viral PARP1 protein. Western Blot process: 10% SDS-PAGE separation of protein samples. After PVDF membrane transfer at 200 mA constant flow for 110 min, the membrane was blocked with 5% skim milk at room temperature for 1 h. The membrane was incubated with primary and secondary antibodies, and finally developed with ECL. The antibody concentrations used were β-actin (1:2000, Cell Signaling Technology), PARP1 (1:1000, Cell Signaling Technology), Myc-Tag (1:1000, Cell Signaling Technology), goat anti-mouse (1:5000, Zhongshan Golden Bridge) and goat anti-rabbit (1:5000, Zhongshan Golden Bridge).

[0049] In addition, we used the HCoV-OC43 (VR-1558) strain purchased from ATCC as a research model and detected the RNA level of the viral genome in cells by relative quantitative RT-qPCR. In BHK21 cells, the PARP1 plasmid with an N-terminal Myc tag was overexpressed ( Figure 1 C) or knocking down endogenous PARP1 expression using siRNA ( Figure 1 D), infected with HCoV-OC43 virus (MOI=0.001) 24 hours later, and samples were collected and tested 48 hours later. The experimental results showed that the level of viral RNA in the cells of the PARP1 plasmid transfection group was significantly decreased compared with the control group ( Figure 1 C); The level of viral RNA in cells of the PARP1 siRNA transfection group was significantly higher than that of the control siRNA transfection group ( Figure 1 D). These results indicate that PARP1 can inhibit the viral RNA replication level of coronavirus HCoV-OC43.

[0050] In this example, Western Blot was used to detect the expression of viral PARP1 protein, and the method was as described above, wherein the antibody α-Tubulin (1:5000) was purchased from Sigma.

[0051] The RT-qPCR technical process is as follows: According to the TRIZOL instructions of Vazyme, total RNA of cells was extracted. Evo M-MLV one-step RT-PCR reagent (Acori Bio) was used to reverse transcribe RNA into cDNA and then perform cDNA amplification reaction.

[0052] Reaction system: 2×One Step RT-qPCR Buffer (SYBR) 10µl, forward primer (10µM) 0.8µl, reverse primer (10µM) 0.8µl, template cDNA 1µl, RNase-free water 7.4µl. Reaction conditions were 50℃, 5min, 95℃10sec, followed by 40 cycles, each cycle was 95℃, 5sec, 60℃, 30sec; 72℃, 30 sec; melting curve was 60℃-95℃, continuous. The housekeeping gene Actin was used as the internal reference, and 2 -ΔΔCt The method was used to perform relative quantification of the RNA level of the gene to be tested. The experiment was repeated three times, and all experimental data were processed and statistically analyzed using independent sample t-test using prism8.0 statistical software.

[0053] Among them, the primers for OC43-N gene are: F: 5'-AGCAACCAGGCTGATGTCAATACC-3' (SEQ ID NO:4) R: 5'-AGCAGACCTTCCTGAGCCTTCAAT-3' (SEQ ID NO: 5); Actin-F: 5'-AGAAATCTGGCACCACACC-3' (SEQ ID NO: 6) Actin-R: 5'-AGAGGCGTACAGGGATAGCA-3' (SEQ ID NO: 7).

[0054] PARP1 inhibits the replication of coronavirus HCoV-OC43 Figure 1, A indicates that the pXJ40-myc-PARP1 plasmid was overexpressed in the BHK21 cell line at 0, 50, and 100 ng / well, respectively, and the cell wells with less than 100 ng were filled with empty vector plasmid. After 24 h, the cells were infected with recombinant HCoV-OC43 carrying the luciferase reporter gene RLuc (MOI = 0.001). After 48 h of culture, the cell culture supernatant was discarded, the cell pellet was lysed with cell lysis buffer, 10 μl of the lysis supernatant was taken, and the natural coelenterazine substrate was added in the dark to detect the RLuc fluorescence intensity, and the PARP1 protein expression level was detected by western blotting. B indicates the effect of siRNA-mediated PARP1 gene silencing on the recombinant virus HCoV-OC43 Rluc protein level. The PARP1 siRNA sequence was transfected into the BHK21 cell line at a final concentration of 10 nM, and the operation was as described above after 24 hours of culture. C indicates that BHK21 cells were inoculated in a 6-well plate, and each well was transfected with 0, 100 ng, and 200 ng of pXJ40-myc-PARP1 plasmid, respectively. The empty vector plasmid was used to fill the wells with less than 200 ng. After 24 hours, HCoV-OC43 diluted with fresh culture medium was used to infect BHK21 (MOI = 0.001), incubated for 48 hours, and the expression level of HCoV-OC43 N gene was amplified and detected by RT-qPCR, and the expression level of PARP1 protein was detected by protein immunoblotting. D indicates that BHK21 was inoculated in a 6-well plate and transfected with PARP1 siRNA with a final concentration of 10 nM at the same time, and cultured for 24 hours. The rest of the operations were the same as (C). The experiment was repeated at least 3 times in parallel, and the data are expressed as mean ± standard deviation. t Test and analyze, Indicates significant difference.

[0055] 2. PARP1 inhibits the replication of coronavirus SARS-CoV-2 To further clarify whether PARP1 has a regulatory effect on the replication of pan-coronavirus genomic RNA, we overexpressed PARP1 plasmids with an N-terminal Myc tag (0, 100, and 400 ng / well) in HeLa cells (Hela / hACE2) and HEK293T cells (293T / hACE2) that stably expressed the receptor hACE2, and infected them with SARS-CoV-2 virus (MOI=0.05) 24 hours later. After 24 hours of infection, the levels of SARS-CoV-2 genomic RNA in cells before and after PARP1 transfection were detected by relative quantitative RT-qPCR.

[0056] Specifically, viral RNA was isolated from the supernatant using the Direct-zol RNA mini Prep kit (Zymo Research), and its concentration was determined using TaqMan FastVirus 1-step Master Mix (Applied Biosystems). The primer pair used to detect viral RNA was directed against the SARS-CoV-2 nucleocapsid gene. The primer sequences for the SARS-CoV-2 nucleocapsid gene were: F: 5'-AACACAAGCTTTCGGCAGAC-3' (SEQ ID NO: 8) and R: 5'-AGCTGTGTAGGTCAACCACG-3' (SEQ ID NO: 9). The probe sequence was: 5'-CAGCGCTTCAGCGTTCTTCGGAATGTCGC-3' (SEQ ID NO: 10).

[0057] The experimental results showed that in both cell lines, the level of viral RNA in the PARP1 transfected group was significantly decreased compared with the control group ( Figure 2 , A and B), indicating that transient expression of PARP1 can significantly inhibit SARS-CoV-2 infection.

[0058] Figure 2 A in the figure indicates that in a 6-well plate, 100 ng / well and 400 ng / well pXJ40-myc-PARP1 plasmids were used to transfect the Hela-ACE2 cell line, and B indicates the HEK293T-ACE2 cell line. After 24 hours of culture, SARS-CoV-2 (MOI = 0.05) was infected, and the expression level of SARS-CoV-2 N gene was detected by qRT-PCR after 24 hours of incubation, and the expression level of PARP1 protein was detected by protein immunoblotting. The experiment was repeated 3 times in parallel, and the data were expressed as mean ± standard deviation, and analyzed by t test. indicates significant difference; ns indicates no statistical significance.

[0059] 3. PARP1 inhibits the replication of EV71 of the enterovirus genus of the Parvoviridae family To expand the antiviral spectrum of PARP1, we explored the antiviral activity of PARP1 against EV71 of the genus Enterovirus in the family Parvoviridae. Vero cells overexpressing PARP1 were infected with EV71 virus and the level of EV71 viral RNA in cells was detected by RT-qPCR. PARP1 could inhibit the infection of EV71 virus by about 75% ( Figure 3 A) The above studies suggest that PARP1 has antiviral activity in enterovirus group.

[0060] Specifically, in Vero cells, a PARP1 plasmid with a Myc tag at the N-terminus was overexpressed, and EV71 virus was infected (MOI = 0.0001) 24 hours later. Samples were collected and tested 24 hours later. In this example, RT-qPCR technology was used to detect the nucleic acid replication level of the virus EV71 and the knockdown of the PARP1 gene, and the method was as described above. The primers for the EV71 virus protein VP1 gene used in this example are: F: 5'-CGCCACTAACCCCTCAGTTT-3' (SEQ ID NO:11), R:5'-AGTCTGGTTACGCATCGGG-3' (SEQ ID NO:12); The other gene detection primers used are: PARP1-F: 5'-GTGGTCGGGACTGTCTCTAAG-3' (SEQ ID NO: 13) PARP1-R: 5'-TCTCCAGTAGCAACCTGAAAAGT-3' (SEQ ID NO: 14); Actin-F: 5'-AGAAATCTGGCACCACACC-3' (SEQ ID NO: 6) Actin-R: 5'-AGAGGCGTACAGGGATAGCA-3' (SEQ ID NO: 7).

[0061] The experimental results showed that compared with the control group, PARP1 was highly expressed in the PARP1 plasmid transfection group ( Figure 3 B), the level of viral RNA in cells decreased significantly ( Figure 3 A) These results indicate that PARP1 can inhibit the viral RNA replication level of EV71.

[0062] Figure 3 A in the middle indicates that in a 6-well plate, 100 ng / well and 500 ng / well pXJ40-myc-PARP1 plasmids were transfected into Vero cells. After 24 hours, EV71 virus was infected (MOI = 0.0001). After 24 hours of incubation, RT-qPCR was used to detect the expression level of EV71 virus VP1 gene. B indicates that in a 6-well plate, 100 ng / well and 500 ng / well pXJ40-myc-PARP1 plasmids were transfected into Vero cells. After 24 hours, EV71 virus was infected (MOI = 0.0001). After 24 hours of incubation, RT-qPCR was used to detect the expression level of PARP1 gene. The experiment was repeated 3 times in parallel. The data are expressed as mean ± standard deviation and analyzed by t test. Indicates significant difference.

[0063] 4. PARP1 inhibits the replication of the flavivirus ZIKV To further expand the antiviral spectrum of PARP1, we explored the antiviral activity of PARP1 against the flavivirus ZIKV. We used ZIKV to infect Vero cells overexpressing PARP1 and detected the intracellular ZIKA virus RNA level and the PARP1 gene knockdown level by RT-qPCR.

[0064] Specifically, in Vero cells, a PARP1 plasmid with a Myc tag at the N-terminus was overexpressed, and ZIKA virus was infected (MOI = 0.1) 24 hours later. Samples were collected and tested 48 hours later. In this example, RT-qPCR technology was used to detect the nucleic acid replication level of ZIKA virus and the knockdown of PARP1 gene, and the method was as described above. The primers for the ZIKA virus protein NS2 gene used in this example are: F: 5'-TTCCACGCACTGATAACATC-3' (SEQ ID NO:17) R:5'-ACAAGTAGCAAGGCCTGCTC-3' (SEQ ID NO:18); The other detection primer sequences are the same as above.

[0065] The experimental results showed that PARP1 can inhibit the infection of ZIKA virus by about 70% ( Figure 4 A) The above studies suggest that PARP1 has antiviral activity in the genus Flavivirus.

[0066] PARP1 inhibits ZIKA virus replication Figure 4 , A indicates that in a 6-well plate, 100 ng / well and 500 ng / well pXJ40-myc-PARP1 plasmids were transfected into Vero cells. After 24 hours, ZIKA virus was infected (MOI = 0.1). After incubation for 48 hours, the expression level of ZIKA virus NS2 gene was detected by RT-qPCR. B indicates that in a 6-well plate, 100 ng / well and 500 ng / well pXJ40-myc-PARP1 plasmids were transfected into Vero cells. After 24 hours, ZIKA virus was infected (MOI = 0.1). After incubation for 48 hours, the expression level of PARP1 gene was detected by RT-qPCR. The experiment was repeated 3 times in parallel. The data are expressed as mean ± standard deviation and analyzed by t test. Indicates significant difference.

[0067] Example 2 PARP1 regulates the activity of RNA viral polymerase RdRp We used the CoV-RdRp-Gluc reporter assay system to detect the expression levels of GLuc positive and negative strand mRNA in the SARS-CoV-2 RdRp luciferase reporter system by RT-qPCR, indicating RdRp activity. 5 HEK293T cell suspension of 100 μg / mL was inoculated in a 6-well plate at 2 mL per well. When the cells grew to 80%, each well of the HEK293T cell group was co-transfected with 10 ng pCoV-Gluc, 300 ng eukaryotic codon-optimized plasmid pCOVID19-nsp12, 900 ng eukaryotic codon-optimized plasmid pCOVID19-nsp7 and 900 ng eukaryotic codon-optimized plasmid pCOVID19-nsp8 plasmids, and PARP1 plasmids of different masses were transfected at the same time, and the empty vector was used to fill in the plasmid mass of each well. 6 hours after transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum (FBS) and cultured for 48 hours. In addition, we reversely transfected PARP1 with siRNA according to the instructions of Lipofectamine RNAiMAX transfection reagent (Invitrogen), and the experimental method was as described above. After 16 hours, each well of the HEK293T cell group was co-transfected with 10ng pCoV-Gluc, 300ng eukaryotic codon-optimized plasmid pCOVID19-nsp12, 900ng eukaryotic codon-optimized plasmid pCOVID19-nsp7 and 900ng eukaryotic codon-optimized plasmid pCOVID19-nsp8 plasmid. Six hours after transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum (FBS) and cultured for another 48 hours. The above cells and all operations were performed in duplicate, one for RNA sample extraction and the other for Western Blot samples.

[0068] For RNA sample extraction, after removing the culture medium, 1 mL of Trizol reagent was added to each well. After extracting mRNA from Trizol, the whole genome cDNA was obtained by reverse transcription, and then qPCR was performed to detect the expression of Gluc mRNA. Actin was used as the internal reference gene in this experiment. Three parallel groups were set up for the experiment, and statistical analysis was performed. , ns means no meaning, and the empty vector group is used as a reference. The experimental data are expressed as x ± s, and GraphPad Prism 8.0 is used for plotting and statistical analysis. The primer sequences used for reverse transcription in this example are: positive strand-Gluc-RT 5′-TGGATCTTGCTGGCGAATGT-3′ (SEQ ID NO: 19); negative strand-Gluc-RT 5′-ACTGTCGTTGACAGGACACG-3′ (SEQ ID NO: 20), and the primer sequences used for qPCR detection are GLuc-F: 5′-CCGAAAGGTAAGATGGGCGT -3′ (SEQ ID NO: 19), GLuc-R5′-CTTTCTAGCGTTGGCCTCCA -3′ (SEQID NO: 20).

[0069] The experimental results showed that when the PARP1 plasmid was overexpressed, the expression levels of Gluc positive and negative strand mRNA in the CoV-RdRp-Gluc system were significantly reduced as the PARP1 expression level increased compared with the control group ( Figure 5 , AC), indicating that PARP1 can reduce the activity of SARS-CoV-2 RdRp. When the endogenous expression level of PARP1 in cells was downregulated, the expression levels of Gluc positive and negative strand mRNA in the CoV-RdRp-Gluc system were significantly upregulated by about 4 to 8 times compared with the NC control group ( Figure 5 , DF), further indicating that PARP1 can downregulate SARS-CoV-2 RdRp activity. These results indicate that PARP1 negatively regulates SARS-CoV-2 virus RdRp and inhibits its activity, which may be the reason why PARP1 restricts coronavirus replication.

[0070] For Western Blot sample collection, after removing the culture medium, rinse the cells once with 1 mL pre-cooled PBS, add 160 μL RIPA (50 mM Tris-HCl (pH7.4), 150 mM NaCl, 1% NP-40, 0.1% SDS, Roche protease inhibitor mixture) after washing, scrape the cells with a cell scraper, and collect them in a 1.5 mL EP tube. Add 40 μL 5×SDS protein loading buffer, vortex and oscillate for lysis, and obtain the total cell protein sample at 100°C in a metal bath for about 15 min. The protein sample is directly subjected to conventional immunoblotting detection or stored at -20°C or -80°C. In this embodiment, Western Blot was used to detect the expression of PARP1 protein and RdRp. The Western Blot process is the same as above. The antibodies used were β-actin (1:1000, CST), PARP1 (1:1000, CST), Flag (1:5000, Sigma), goat anti-mouse (1:5000, Zhongshan Golden Bridge), and goat anti-rabbit (1:5000, Zhongshan Golden Bridge).

[0071] PARP1 inhibits SAR2-CoV-2 virus RdRp activity Figure 5 For overexpression experiments (AC), 4 × 10 5 HEK293T cells were inoculated at a density of 10 cells / well. After the cells were completely attached, equal amounts of SARS-CoV-2 RdRp luciferase reporter gene plasmid and gradient-quality pXJ40-myc-PARP1 were co-transfected into the cells. The transfection amount of SARS-CoV-2 RdRp luciferase reporter gene plasmid was 10 ng / well GLuc reporter plasmid, 900 ng / well nsp7, 900 ng / well nsp8 and 300 ng / well nsp12 plasmid, and the maximum transfection amount of PARP1 was 2 μg / well, and 5-fold gradient dilutions were performed in sequence. For siRNA knockdown experiments (DF), 10 nM siRNA was used to silence the PARP1 gene for 24 h, and then the SARS-CoV-2 RdRp reporter gene plasmid was co-transfected, and the transfection amount was as described above. After 48 h of culture, the cells were collected and total cell RNA was extracted. The GLuc sequence representing the viral genome in the cells was reverse transcribed into positive and negative strands of GLuc cDNA using specific primer sequences. The synthesized GLuc gene was then relatively quantified by fluorescent quantitative PCR to characterize the effect of PARP1 protein expression level on the production of SARS-CoV-2RdRp positive and negative strands of RNA. Protein immunoblotting was used to detect the expression level of PARP1 protein and SARS-CoV-2RdRp plasmid. The experiment was repeated three times in parallel, and the data were expressed as mean ± standard deviation. tTest and analyze, indicates significant difference; ns indicates no statistical significance.

[0072] Example 3 PARP1 regulates the binding of RNA virus genome to polymerase RdRp For the novel coronavirus, we used the CoV-RdRp-Gluc reporter assay system to detect the changes in the level of RdRp-bound Gluc mRNA by RT-qPCR to indicate the effect of PARP1 on the binding of RNA virus genome to polymerase RdRp. 6 HEK 293T cells were seeded in a 10 cm dish. When the cells grew to 80%, each well of the HEK 293T cell group was co-transfected with 30 ng pCoV-Gluc, 0.5 ug eukaryotic codon-optimized plasmid pCOVID19-nsp12, 1.5 ug eukaryotic codon-optimized plasmid pCOVID19-nsp7 and 1.5 ug eukaryotic codon-optimized plasmid pCOVID19-nsp8 plasmid. One group was simultaneously transfected with 5 ug of PARP1 plasmid, and the other group was simultaneously transfected with 5 ug of empty vector. Six hours after transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum (FBS) and cultured for another 48 hours. In addition, we reversely transfected PARP1 with siRNA according to the instructions of Lipofectamine RNAiMAX transfection reagent (Invitrogen) to a final concentration of 10 nM. The experimental method was as described above. After 16 hours, each well of the HEK 293T cell group was co-transfected with 30 ng of pCoV-Gluc, 1.5 ug of eukaryotic codon-optimized plasmid pCOVID19-nsp12, 4.5 ug of eukaryotic codon-optimized plasmid pCOVID19-nsp7, and 4.5 ug of eukaryotic codon-optimized plasmid pCOVID19-nsp8. Six hours after transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum (FBS) and cultured for another 48 hours.

[0073] When collecting samples, discard the cell culture supernatant, add an appropriate amount of pre-cooled PBS to gently wash the cells twice, add 1 mL of NP40 lysis buffer containing protease inhibitors to the cell culture dish, use a cell scraper to gently scrape the cells and transfer them to a clean 1.5 mL EP tube, and lyse the cells on ice for 40 min. The specific operation process is: centrifuge at 4°C, 12000 rpm for 15 min, take 100 μL of supernatant in a clean 1.5 mL EP tube, add 500uL TRIZOL to lyse and extract RNA as the input group. Use NP40 lysis buffer to equilibrate Anti-FLAG M2 agarose beads, centrifuge at 4°C, 600 g for 1 min, discard the supernatant, and equilibrate for a total of 3 times. Take an equal amount of protein sample, add 10 μL of equilibrated Anti-FLAG M2 agarose beads to each portion, and combine overnight at 4°C in a vortexer. On the second day, centrifuge at 4°C and 600 g for 1 min, discard the supernatant, add an appropriate amount of pre-cooled NP40 lysis buffer to wash the agarose beads, and wash in a vortexer at 4°C for 10 min, a total of 5 times. Finally, completely discard the supernatant, add 500uL TRIZOL to lyse and extract RNA, as the IP group.

[0074] After extracting mRNA from Trizol, reverse transcription with specific primers was used to obtain Gluc DNA / RNA hybrid chains, and then qPCR was performed to detect the expression of Gluc mRNA. Three parallel groups were set up for the experiment, and statistical analysis was performed. , ns means meaningless, and the empty vector group is used as a reference. The experimental data are expressed as x ± s, and GraphPad Prism 8.0 is used for plotting and statistical analysis. In this example, the specific primer sequences used to indicate the reverse transcription of the novel coronavirus nucleic acid are: positive strand-Gluc-RT 5′-TGGATCTTGCTGGCGAATGT-3′ (SEQ ID NO: 17); negative strand-Gluc-RT 5′-ACTGTCGTTGACAGGACACG-3′ (SEQ ID NO: 18), and the primer sequences used for qPCR detection are GLuc-F: 5′-CCGAAAGGTAAGATGGGCGT-3′ (SEQ ID NO: 19), GLuc-R5′-CTTTCTAGCGTTGGCCTCCA-3′ (SEQ ID NO: 20). In this example, the specific primer sequences used to indicate the reverse transcription of Zika virus nucleic acid are: positive strand-Gluc-RT 5′- GTTGCGGCAGCCACTTCTTG-3′ (SEQ ID NO: 21), negative strand-Gluc-RT 5′-CTGGAGGTGCTCAAAGAGATG-3′ (SEQ ID NO: 22). The primer sequences used for qPCR detection are GLuc-F: 5′-ATCTGCCTGTCCCACATCAA-3′ (SEQ ID NO: 23), GLuc-R: 5′-GTCCACACACAGATCGACCT-3′ (SEQ ID NO: 24).

[0075] The results showed that overexpression of PARP1 could inhibit the binding of RNA viral genome to polymerase RdRp, whether it was the new coronavirus or Zika virus ( Figure 6 , AC), using two different PARP1 siRNA sequences to knock down endogenous PARP1 expression, compared with the control group, the experimental group transfected with PARP1 siRNA was able to increase the binding of RNA viral genome to polymerase RdRp ( Figure 6 , DG), these results indicate that PARP1 can widely regulate the binding of viral genome to polymerase RdRp, thereby inhibiting the replication of cytoplasmic RNA viruses.

[0076] Figure 6A and B in the figure indicate that HEK293T cells were seeded in 10 cm dishes, and equal amounts of pXJ40-myc-PARP1 or empty vector were transfected in the cells, and each plasmid of the SARS-CoV-2 RdRp luciferase reporter gene system was co-transfected, where the transfection amount of the SARS-CoV-2 RdRp luciferase reporter gene plasmid was 30 ng / dish GLuc reporter plasmid, 1.5μg Flag-nsp7, Flag-1.5μg nsp8 and 0.5μg Flag-nsp12 plasmid. After 48 hours, the cell lysate was collected and RNA was immunoprecipitated using FLAG-M2 agarose beads. The positive (A) and negative (B) RNA levels of Gluc were quantified by RT-qPCR for the input and immunoprecipitated RNA, and the ratio of immunoprecipitated Gluc RNA to total Gluc RNA represented the level of viral nucleic acid RNA bound to RdRp. C indicates that HEK293T cells were inoculated in a 10 cm dish, and 5 μg of pXJ40-myc-PARP1 or an empty vector was transfected into the cells. At the same time, the RdRp of Zika virus and its luciferase reporter gene plasmid were co-transfected, where the transfection amount of ZIKA RdRp luciferase reporter gene plasmid was 30 ng / dish and Flag-RdRp 5 μg / dish. After 48 hours, the cell lysate was collected and RNA immunoprecipitation was performed using FLAG-M2 agarose beads. The positive-strand RNA level of Gluc was quantified by RT-qPCR for the input and immunoprecipitated RNA, and the ratio of immunoprecipitated Gluc RNA to total Gluc RNA represented the level of viral nucleic acid RNA bound to RdRp. DG indicates the binding level of viral RdRp to viral nucleic acid RNA after knocking down PARP1 expression. In HEK293T cells, the endogenous expression of PARP1 was knocked down using two different siRNA sequences, and then the RdRp plasmids of SARS-CoV-2 and ZIKA viruses were transfected. The above operation was performed by using FLAG-M2 agarose beads, and the positive-strand RNA level of Gluc was quantified by RT-qPCR on the input and immunoprecipitated RNA.

[0077] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Application of PARP1 in the preparation of broad-spectrum RNA virus inhibitors; The reference sequence number of PARP1 from human is NM_001618.4 in NCBI.

2. Application of PARP1 in the preparation of products for treating diseases caused by RNA virus-infected cells and / or preventing diseases caused by RNA virus-infected cells; The products include medicines, vaccines, health products, and foods; The reference sequence number of PARP1 from human is NM_001618.4 in NCBI.

3. The use according to claim 1 or 2, characterized in that: The broad-spectrum RNA virus inhibitor, or the product for treating diseases caused by RNA virus-infected cells and / or preventing diseases caused by RNA virus-infected cells is a substance that increases the expression level of PARP1; The virus is a cytoplasmic RNA virus, including viruses of the coronavirus, flavivirus, and enterovirus genera.

4. The use according to claim 3, characterized in that: The coronavirus genus viruses include SARS-CoV-2 and HCoV-OC43; The Flavivirus genus includes Zika virus; The enterovirus genus virus includes enterovirus EV71 type.

5. The use according to claim 3, characterized in that: The substance that increases the expression level of PARP1 includes a substance that enhances the expression of PARP1 gene in cells, a substance that increases the activity of PARP1 in cells, and a substance that increases the content of PARP1 in cells.

6. The use according to claim 3, characterized in that: The substance that increases the expression level of PARP1 is selected from any one or more combinations of the following 1)-3): 1) Expression vector expressing PARP1; 2) Drugs or other biological agents that increase PARP1 expression levels; 3) Chemical modifiers that increase PARP1 gene expression.

7. The use according to claim 6, characterized in that: The expression vector includes a eukaryotic expression vector and a prokaryotic expression vector.

8. The use according to claim 6, characterized in that: The drugs or other biological agents that increase the expression level of PARP1 include one or more combinations of PARP1 agonists.

9. The use according to claim 6, characterized in that: The chemical modification is selected from one or a combination of ribose modification, base modification, and phosphate backbone modification.

10. The use according to any one of claims 2-3, 5-9, characterized in that: The cells are mammalian cells.

Images