Bismuth-based bionic nanomaterial, and preparation method and application thereof
By developing bismuth-based bionic nanomaterial MCM-Apt@BiVO4, the characteristics of covering macrophage membranes and modified nucleic acid aptamers on the BiVO4 core have been solved, and the existing antibiotic treatments are difficult to target and eradicate bacterial pathogens, achieving efficient bacterial inhibition and stable antibacterial effects.
Patent Information
- Application Number
- CN202510174136.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-18
- Publication Date
- 2025-05-13
AI Technical Summary
Existing antibiotic treatments are difficult to effectively target and eradicate bacterial pathogens, and long-term use may lead to drug resistance and side effects.
A bismuth-based bionic nanomaterial MCM-Apt@BiVO4 was developed to form a nanomaterial with putaway structure by coating the macrophage membrane and modified nucleic acid aptamer on the BiVO4 core, and use visible light to catalyze the production of reactive oxygen species to inhibit bacteria.
This nanomaterial shows good pathogen bacterial selectivity and visible light catalyzed reactive oxygen production performance in simulated biofilm microenvironment. It has good stability and selectivity, and is not easily disturbed by complex environments. It is suitable for targeted therapy and antibacterial applications.
Smart Images
Figure CN119971073A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of nanomaterials and biomedicine, and in particular relates to a bismuth-based bionic nanomaterial, a preparation method and application thereof. Background Art
[0002] The frequent occurrence of skin trauma is an important health problem. Without timely medical intervention, skin wounds may lead to chronic skin ulcers and even be life-threatening. Wound healing is a complex and dynamic biological process involving the coordinated action of cells in multiple tissues, including four different and overlapping stages: hemostasis, inflammation, proliferation, and remodeling. In the early stages of wound healing, hemostasis is the primary issue. Bacterial infection (bacteria that fight the host immune system and invade skin tissue) can cause severe tissue damage and worsen wound healing. The first step in the treatment strategy for bacterially infected wounds is to eliminate bacteria in a timely manner or reduce the number of bacteria to a certain range. With the increasing antibiotic resistance, traditional antibiotic treatment is losing its effectiveness, so it is necessary to develop innovative treatment strategies to effectively target and eradicate bacterial pathogens while promoting wound healing.
[0003] The development of nanotechnology has provided a research direction for this purpose. The development of nanomaterials that specifically target and eradicate bacteria can minimize damage to healthy tissues. Although broad-spectrum antibacterial materials generally have significant antibacterial activity against a variety of bacterial infections, their effects are short-lived and long-term use may disrupt the delicate balance of microbial flora at the site of infection, leading to unexpected adverse consequences such as drug resistance and side effects. Therefore, in order to solve the problems caused by nonspecific bactericidal effects, it is of great significance to construct a selective targeted bactericidal material. Summary of the invention
[0004] In view of the problem that drugs in the prior art cannot effectively target and eradicate bacterial pathogens, the present invention provides a bismuth-based bionic nanomaterial.
[0005] The technical solution of the present invention is as follows:
[0006] The present invention provides a bismuth-based bionic nanomaterial for visible light catalytic production of active oxygen and antibacterial properties. The nanomaterial is a bismuth-based bionic nanomaterial MCM-Apt@BiVO4 with a core-shell structure, which is formed by using BiVO4 as a core and a macrophage membrane connected with a nucleic acid aptamer as a shell.
[0007] The present invention provides a method for preparing the above-mentioned bismuth-based bionic nanomaterial MCM-Apt@BiVO4, comprising the following steps:
[0008] The macrophage membrane vesicles were mixed with DSPE-PEG2000-MAL solution, shaken and cultured to obtain a modified macrophage membrane vesicle solution; the macrophage membrane vesicle solution was diluted, the diluted macrophage membrane vesicle solution was taken, and then BiVO4 solution was added and ultrasonically treated to obtain MCt@BiVO4; the modified nucleic acid aptamer solution was mixed with MCt@BiVO4, incubated to obtain the bismuth-based bionic nanomaterial MCM-Apt@BiVO4.
[0009] In the above-mentioned preparation method of MCM-Apt@BiVO4, each component is selected from the following parts:
[0010] 0.5-1.5 parts of macrophage membrane vesicles, 5-15 parts of DSPE-PEG2000-MAL solution, 0.1-1 parts of diluted macrophage membrane vesicle solution, 0.5-2 parts of BiVO4 solution, 1-10 parts of modified nucleic acid aptamer solution, and 0.5-3 parts of MCt@BiVO4;
[0011] When the component is a solid component, the portion number represents grams; when the component is a liquid component, the portion number represents milliliters; in actual applications, the portion number can be enlarged or reduced in proportion to the portion number.
[0012] In a specific embodiment, each component is selected from the following parts:
[0013] 1 part of macrophage membrane vesicles, 10 parts of DSPE-PEG2000-MAL solution, 0.5 parts of diluted macrophage membrane vesicle solution, 1 part of BiVO4 solution, 5 parts of modified nucleic acid aptamer solution, and 1 part of MCt@BiVO4;
[0014] When the component is a solid component, the portion number represents grams; when the component is a liquid component, the portion number represents milliliters; in actual applications, the portion number can be enlarged or reduced in proportion to the portion number.
[0015] In the above-mentioned preparation method of MCM-Apt@BiVO4, the macrophage membrane vesicles are prepared by the following method: the macrophage membrane is subjected to ultrasonic treatment to obtain the macrophage membrane vesicles.
[0016] In the above-mentioned preparation method of MCM-Apt@BiVO4, the DSPE-PEG2000-MAL solution is a methanol solution of DSPE-PEG2000-MAL, and its concentration is selected from 10 to 20 mg / mL; preferably 15 mg / mL.
[0017] In the above-mentioned preparation method of MCM-Apt@BiVO4, the shaking culture condition is selected from: shaking culture at 30-40°C for 1-3 hours; preferably: shaking culture at 37°C for 2 hours.
[0018] In the above-mentioned preparation method of MCM-Apt@BiVO4, the dilution factor of the macrophage membrane vesicle solution is selected from 2 to 5 times, preferably 4 times.
[0019] In the above-mentioned preparation method of MCM-Apt@BiVO4, the conditions of the ultrasonic treatment are selected from: 20 to 60 W / cm 2 Ultrasound for 1 to 10 minutes at 40W / cm 2 Ultrasonication was performed for 5 min at 200 MHz and 500 MHz.
[0020] In the above-mentioned preparation method of MCM-Apt@BiVO4, the concentration of the BiVO4 solution is selected from 50 to 150 μg / mL, preferably 100 μg / mL.
[0021] In the above-mentioned preparation method of MCM-Apt@BiVO4, the BiVO4 is prepared by the following method:
[0022] Bi(NO3)3·5H2O and EDTA were dissolved in a nitric acid solution, and then NH4VO3 was added to carry out a hydrothermal reaction. After the reaction was completed, the product was cooled, washed, and dried to obtain BiVO4 nanoparticles.
[0023] In the above-mentioned preparation method of BiVO4, each component is selected from the following parts:
[0024] Bi(NO3)3·5H2O 0.5-2 parts, EDTA 0.1-2 parts, nitric acid solution 20-200 parts, NH4VO3 0.1-2 parts;
[0025] When the component is a solid component, the portion number represents grams; when the component is a liquid component, the portion number represents milliliters; in actual applications, the portion number can be enlarged or reduced in proportion to the portion number.
[0026] In the above-mentioned method for preparing BiVO4, the concentration of the nitric acid solution is selected from 1 to 5M, preferably 2M.
[0027] In the above-mentioned preparation method of BiVO4, the conditions of the hydrothermal reaction are selected from: reacting at 90-100°C for 6-7h; preferably: reacting at 90°C for 6h.
[0028] In the above-mentioned preparation method of MCM-Apt@BiVO4, the modified nucleic acid aptamer solution is prepared by the following method:
[0029] The aptamer solution was incubated with tri(2-carboxyethyl)phosphine (TCEP) solution on ice for 30 min to cleave the disulfide bonds and obtain a modified aptamer solution.
[0030] In the above method for preparing the modified nucleic acid aptamer solution, the concentration of the nucleic acid aptamer solution is selected from 50 to 200 nM, preferably 100 nM; the concentration of the tris(2-carboxyethyl)phosphine (TCEP) solution is selected from 0.5 to 2M, preferably 1M.
[0031] In the method for preparing the modified nucleic acid aptamer solution, the volume ratio of the nucleic acid aptamer solution to the tri(2-carboxyethyl)phosphine (TCEP) solution is selected from (1-2):1; preferably 1:1.
[0032] In the above-mentioned method for preparing the modified nucleic acid aptamer solution, the nucleic acid aptamer refers to a nucleic acid sequence that can specifically bind to bacteria; the bacteria include but are not limited to Staphylococcus aureus, Listeria, and Pseudomonas aeruginosa.
[0033] In the above-mentioned preparation method of MCM-Apt@BiVO4, the incubation conditions are selected from: incubation at 4-6°C for 8-12 hours; preferably: incubation at 4°C for 10 hours.
[0034] The present invention provides the use of the above-mentioned bismuth-based bionic nanomaterial in the preparation of drugs for visible light catalytic production of active oxygen and / or antibacterial.
[0035] The present invention provides application of the bismuth-based bionic nanomaterial in preparing a drug with targeted therapeutic effect.
[0036] The beneficial effects of the present invention are:
[0037] The present invention uses bismuth nitrate pentahydrate, EDTA and ammonium vanadate to react to generate BiVO4 core, and obtains coating material by extrusion method with ultrasonically broken macrophage membrane vesicles and core, and then connects aptamer DNA to the surface of macrophage membrane by combining sulfhydryl and amino groups to form bismuth-based bionic nanomaterials. The prepared bismuth-based bionic nanomaterials have excellent visible light catalytic production of reactive oxygen and antibacterial properties. In the simulated biofilm microenvironment, bismuth-based bionic nanomaterials show good pathogen bacteria selectivity and visible light catalytic production of reactive oxygen, have good stability, selectivity, and are not easily disturbed by complex environments. They have broad application prospects in biomedical fields such as targeted therapy, visible light catalytic precise antibacterial, drug delivery, and bacterial eradication. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Figure 1 TEM images of BiVO4 (A) and MCM-Apt@BiVO4 (B);
[0039] Figure 2 is the ESR spectrum of active oxygen generation; where (A) is ·O 2- , (B) is ·OH;
[0040] Figure 3 For in vitro antibacterial test;
[0041] Figure 4 In vivo antibacterial test. DETAILED DESCRIPTION
[0042] In the present invention, the macrophage membrane (MCM) was purchased from Sigma Biotech Co., Ltd.
[0043] Other materials used in the present invention, if not otherwise stated, can be obtained through commercial channels. Other terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention is further described in detail below in conjunction with specific examples and with reference to data. The following examples are only for illustrating the present invention, and are not intended to limit the scope of the present invention in any way.
[0044] Example 1
[0045] The steps for preparing bismuth-based bionic nanomaterial MCM-Apt@BiVO4 are as follows:
[0046] (1) Preparation of BiVO4 nanoparticles
[0047] 0.56 g of bismuth nitrate pentahydrate [Bi(NO3)3·5H2O] and 0.21 g of EDTA were dissolved in 100 mL of HNO3 solution (2 M) and stirred vigorously at room temperature. Subsequently, 0.43 g of NH4VO3 was added to the mixture and stirred continuously for 30 min to form a uniform solution. The resulting solution was then transferred to a stainless steel autoclave lined with polytetrafluoroethylene and subjected to a hydrothermal reaction at 90 °C for 6 h. After the autoclave was naturally cooled to room temperature, the product was collected, washed with distilled water and anhydrous ethanol, and dried at 60 °C for use to obtain BiVO4 nanoparticles.
[0048] (2) Preparation of MCM-Apt@BiVO4
[0049] The macrophage membrane (MCM) was ultrasonically treated (40 W / cm 2) for 5 min to obtain macrophage membrane vesicle fragments. 10 mL of DSPE-PEG2000-MAL methanol solution (15 mg / mL) was mixed with 1 mL of macrophage membrane vesicle fragments, and then shaken and cultured at 37°C for 2 h to obtain modified macrophage membrane vesicles. The modified vesicles were then diluted 4 times with water, and 0.5 mL of the diluted vesicle solution was added to 1 mL of BiVO4 aqueous solution (100 μg / mL). The mixture was ultrasonicated (40 W / cm 2 ) for 5 min to obtain MCt@BiVO4. 5 mL of nucleic acid aptamer solution (100 nM) was incubated with 5 mL of tri(2-carboxyethyl)phosphine (TCEP) solution (1 M) on ice for 30 min to cleave the disulfide bonds and obtain a modified nucleic acid aptamer solution. 5 mL of the modified nucleic acid aptamer solution was mixed with 1 mL of MCt@BiVO4 and incubated at 4 °C for 10 h to obtain MCM-Apt@BiVO4.
[0050] The above aptamer sequence is as follows:
[0051] 5'-GCAATGGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCC ACAGCTACGTCAAAAGTGCACGCTACTTTGCTAACATTGC-SH-3'
[0052] The morphologies of BiVO4 and MCM-Apt@BiVO4 were characterized by transmission electron microscopy (TEM). Figure 1 As shown, BiVO4 is a uniform lamellar structure with an average size of 200-300nm. After being wrapped by macrophage membrane, it forms round nanoparticles with an average diameter of 300-350nm. This change is attributed to the macrophage membrane coating on the surface. The thickness of the macrophage membrane layer is about 10nm.
[0053] 1. Visible light catalysis to produce active oxygen
[0054] The generation of hydroxyl radicals (·OH) was evaluated using quenching experiments and electron paramagnetic resonance (EPR) spectroscopy. For the quenching experiments, solutions containing 5mM, 10mM, and 30mM ethanol were introduced into a solution containing 3mM H2O2 and 50μM phenol at pH 4.0. In addition, sodium thiosulfate, furfuryl alcohol, and dimethyl sulfoxide were used to explore other ROS, respectively. For EPR analysis, 200μL of 0.1M 5,5-dimethyl-1-pyrroline N-oxide (DMPO) was added to a solution containing 3mM H2O2 and 50μM phenol at pH 4.0. After degradation, the resulting solution was filtered using a 0.45μm membrane. The filtrate was transferred to a capillary and sealed with vacuum grease. The capillary was then inserted into a quartz tube and firmly placed in the cavity of the EPR instrument for analysis.
[0055] The test results are as follows Figure 2 As shown:
[0056] The ability to generate ROS is crucial for the antibacterial effect of MCM-Apt@BiVO4 nanoparticles, e.g. Figure 2 As shown in Figure 2, under visible light irradiation, the photocatalyst generates electron-hole pairs. The holes (h+) react with water to generate ·OH, while the electrons (e - ) reduces oxygen to form O 2- , ROS plays a vital role in antibacterial activity. The above ESR spectra confirm the generation of ROS. This shows that BiVO4 and MCM-Apt@BiVO4 will produce a large amount of ·O 2- and OH.
[0057] 2. In vitro antibacterial properties
[0058] Staphylococcus aureus, Listeria monocytogenes and Pseudomonas aeruginosa were used as test bacteria to evaluate the antibacterial effect of MCM-Apt@BiVO4 nanomaterials in vitro. The aptamer sequences of different bacteria are shown in Table 1.
[0059] Table 1 Aptamer sequences
[0060]
[0061] MCM-Apt@BiVO4 (100 μg / mL) was added into 1 mL of bacterial solution (2.5 ± 0.3 × 10 5 CFU and 3.5 ± 0.2 × 10 5 CFU), irradiate the cells with a xenon lamp for 1 hour, then dilute the bacterial suspension 1000 times, take 20 μL and evenly spread on the solid culture medium, and incubate overnight. The control group was treated in the dark without light.
[0062] The test results are as follows Figure 3 As shown:
[0063] The groups exposed to visible light showed lower CFU and higher antibacterial activity compared to the group without visible light. After visible light irradiation, the control group, which received little nanoparticle treatment, had a high bacterial colony density, indicating a large proliferation of bacteria without any inhibitory effect. BiVO4 treatment resulted in a significant reduction in the number of colonies, reflecting their antibacterial activity against bacteria. In the MCM-Apt@BiVO4 visible light group, the number of bacteria was significantly reduced, demonstrating that the MCM-coated nanoparticles enhanced bacterial recognition and improved antibacterial activity.
[0064] 3. Antibacterial properties in vivo
[0065] The antibacterial capacity of MCM-Apt@BiVO4 was evaluated in full-thickness Staphylococcus aureus-infected wounds of 4-6 week-old male mice. To create the wounds, the mice were first anesthetized and their backs were shaved. A 1 cm diameter skin punch was used to create a circular full-thickness wound. The wounds were then injected with 20 μL of Staphylococcus aureus suspension (10 5 CFU / mL) infected wound areas. The infected mice were then randomly divided into the following groups: control (PBS) + visible light irradiation, BiVO4 nanoparticles + visible light irradiation, and MCM-Apt@BiVO4 + visible light irradiation. Each wound received the corresponding treatment, and the irradiation exposure time was set to 20min. Standard swab cultures were performed on days 4, 8, and 14 to confirm wound infection, followed by a solid agar plate procedure, and the number of bacterial colonies on the plates was recorded and analyzed.
[0066] The test results are as follows Figure 4 As shown:
[0067] On day 0, all groups showed a large number of bacteria on the corresponding blood agar plates. From day 0 to day 14, the wounds on the mouse skin surface healed slowly and the number of bacteria continued to decrease. In contrast, the BiVO4 and MCM-Apt@BiVO4 groups showed excellent antibacterial ability. On day 14, the number of bacteria decreased by 87.4% and 95.8%, respectively. However, the control group only decreased by 65.2% on day 14, indicating that ROS generated by visible light-induced photodynamics effectively eradicated bacteria and promoted wound healing in vivo.
[0068] In the present invention, BiVO4 can convert H2O into hydroxyl radicals (·OH), effectively compensating for the limited oxygen content. In terms of the non-selective distribution of nanomaterials, macrophage membranes (MCMs) can be used to provide targeting functionality. MCM-coated nanoparticles combine the advantages of biological and synthetic materials to provide a new solution for antimicrobial therapy. Nanoparticles take advantage of the immune escape ability of MCMs, allowing them to circulate in the blood for longer periods of time without being recognized and cleared by the immune system. This extended circulation ensures that higher concentrations of nanoparticles reach the site of infection, enhancing the antibacterial effect. In addition, MCMs naturally target sites of infection and inflammation, and this targeting can be further improved by modifying nanoparticles with specific ligands that bind to specific bacterial pathogens. For example, the addition of aptamers that specifically recognize Staphylococcus aureus can improve the delivery efficiency of antimicrobial payloads to sites of infection, minimizing off-target effects and potential damage to healthy tissues.
[0069] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.
Claims
1. A bismuth-based bionic nanomaterial for visible light catalytic production of active oxygen and antibacterial properties, characterized in that: The nano material is a bismuth-based bionic nano material MCM-Apt@BiVO4 with a core-shell structure, with BiVO4 as the core and a macrophage membrane connected with a nucleic acid aptamer as the shell.
2. The bismuth-based bionic nanomaterial according to claim 1, characterized in that: The bismuth-based bionic nanomaterial MCM-Apt@BiVO4 is prepared by the following method: The macrophage membrane vesicles are mixed with the DSPE-PEG2000-MAL solution, and the mixture is shaken and cultured to obtain a modified macrophage membrane vesicle solution; the macrophage membrane vesicle solution is diluted, and the diluted macrophage membrane vesicle solution is taken, and then the BiVO4 solution is added, and the mixture is ultrasonically treated to obtain MCt@BiVO4; The modified nucleic acid aptamer solution was mixed with MCt@BiVO4 and incubated to obtain the bismuth-based bionic nanomaterial MCM-Apt@BiVO4.
3. The bismuth-based bionic nanomaterial according to claim 2, characterized in that: Each component is selected from the following parts: 0.5-1.5 parts of macrophage membrane vesicles, 5-15 parts of DSPE-PEG2000-MAL solution, 0.1-1 parts of diluted macrophage membrane vesicle solution, 0.5-2 parts of BiVO4 solution, 1-10 parts of modified nucleic acid aptamer solution, and 0.5-3 parts of MCt@BiVO4.
4. The bismuth-based bionic nanomaterial according to claim 2, characterized in that: The macrophage membrane vesicles are prepared by the following method: the macrophage membrane is subjected to ultrasonic treatment to obtain the macrophage membrane vesicles.
5. The bismuth-based bionic nanomaterial according to claim 2, characterized in that: The DSPE-PEG2000-MAL solution is a methanol solution of DSPE-PEG2000-MAL, and its concentration is selected from 10 to 20 mg / mL; the shaking culture conditions are selected from: shaking culture at 30 to 40° C. for 1 to 3 hours; the dilution multiple of the macrophage membrane vesicle solution is selected from 2 to 5 times; the ultrasonic treatment conditions are selected from: at 20 to 60 W / cm 2 Ultrasound is performed at a power of 1 to 10 minutes; the concentration of the BiVO4 solution is selected from 50 to 150 μg / mL.
6. The bismuth-based bionic nanomaterial according to claim 2, characterized in that: The BiVO4 is prepared by the following method: Bi(NO3)3·5H2O and EDTA were dissolved in a nitric acid solution, and then NH4VO3 was added to carry out a hydrothermal reaction. After the reaction was completed, the product was cooled, washed, and dried to obtain BiVO4 nanoparticles.
7. The bismuth-based bionic nanomaterial according to claim 6, characterized in that: The components are selected from the following parts: 0.5-2 parts of Bi(NO3)3·5H2O, 0.1-2 parts of EDTA, 20-200 parts of nitric acid solution, and 0.1-2 parts of NH4VO3; the concentration of the nitric acid solution is selected from 1-5M; the conditions of the hydrothermal reaction are selected from: reacting at 90-100°C for 6-7h.
8. The bismuth-based bionic nanomaterial according to claim 2, characterized in that: The modified nucleic acid aptamer solution is prepared by the following method: The aptamer solution was incubated with tri(2-carboxyethyl)phosphine (TCEP) solution on ice for 30 min to cleave the disulfide bonds and obtain a modified aptamer solution.
9. The bismuth-based bionic nanomaterial according to claim 8, characterized in that: The concentration of the nucleic acid aptamer solution is selected from 50 to 200 nM; the concentration of the tri(2-carboxyethyl)phosphine (TCEP) solution is selected from 0.5 to 2 M; the volume ratio of the nucleic acid aptamer solution to the tri(2-carboxyethyl)phosphine (TCEP) solution is selected from (1 to 2):1; and the incubation conditions are selected from: incubating at 4 to 6° C. for 8 to 12 hours.
10. Use of the bismuth-based bionic nanomaterial according to any one of claims 1 to 9 in the preparation of drugs for visible light photocatalytic production of active oxygen and / or antibacterial effects.