Immunomodulatory peptide Purenin and application thereof

Abstract

The invention relates to an immunomodulatory peptide Puerein and application thereof, and belongs to the field of biomedicine. The immunomodulatory peptide Puerein is a polypeptide coded by a defensive peptide gene of a special species Pu'er pan tree frog in China, the molecular weight is 1486.7 Dalton, the isoelectric point is 12.58, and the amino acid sequence of the immunomodulatory peptide Puerein is as shown in SEQ ID NO: 2. The gene GenBank access No.PQ862905 for coding the precursor of the immunomodulatory peptide Puerein is composed of 592 nucleotide sequences, and the nucleotide sequence of the gene GenBank access No.PQ862905 is as shown in SEQ ID NO: 1; wherein the 399th to 435th nucleotides are coding genes of the mature Pu'er ubiquitous frog multifunctional immunomodulatory peptide Puerein. The invention further discloses application of the Pu'er pan-tree frog immunomodulatory peptide Puerein in preparation of anti-oxidation, damaged DNA (deoxyribonucleic acid) removal and skin light damage resistance. The composition has the beneficial effects that the composition has a relatively strong skin light injury resisting effect on the skin and can remarkably inhibit the occurrence of skin light injury.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and in particular relates to an immunomodulatory peptide Puerenin and an application thereof. Background Art

[0002] The skin is the largest organ in the human body, covering the entire body surface. It is an important barrier that protects the body's internal organs and tissues from various pathogens and environmental stressors, but it is also vulnerable to various environmental risk factors. Ultraviolet radiation is one of the most important environmental risk factors for skin damage. Skin photodamage includes a series of skin diseases induced or aggravated by ultraviolet rays. The prevention and treatment of photodamage skin diseases has become a public health issue worldwide. Therefore, finding new and effective drugs that are safe, low-toxic and low-cost in the prevention and treatment of photodamage has become an urgent problem to be solved.

[0003] Free radicals are a type of atomic groups or atoms with one or more unpaired electrons that can exist independently and are produced during the metabolism of organisms. They are necessary for maintaining life, but they are also potential killers of biological macromolecules, cells and biological tissues. Some active peptides have fast and powerful free radical scavenging capabilities, which can protect the skin to the greatest extent and minimize the free radical damage induced by sunlight, ultraviolet rays, etc.

[0004] Amphibians are the most important type of resource in the exploration of bioactive peptide resources. Their skin is exposed. In order to resist various harsh environments, they can secrete a variety of bioactive peptides with novel molecular structures and complex and diverse functions. These active peptides are widely involved in various physiological activities of the body and have various pharmacological activities, such as anti-microbial, anti-tumor, antioxidant, immunomodulatory, wound repair, analgesic and other effects. At present, screening some pharmacologically active monomer compounds from amphibian skin is a hot spot for the invention of new drugs. According to domestic and foreign literature reports, different active peptides have been isolated from various biological sources, and some have entered the clinical stage. Pu'er Pan Tree Frog ( Polypedates puerensis ) is an amphibian of the family Rhacophoridae in the order Anura, class Amphibia, mainly distributed in the tropical and subtropical forests in and around Pu'er, Yunnan Province. There are few reports on the role of cathelicidin immunomodulatory peptides in its skin secretions in resisting skin photodamage, clearing damaged DNA and anti-oxidation. Summary of the invention

[0005] The first purpose of the present invention is to provide an immunomodulatory peptide Puerenin; the second purpose is to provide the application of the immunomodulatory peptide Puerenin.

[0006] The first object of the present invention is achieved in that the nucleotide sequence of the immunomodulatory peptide Puerenin is shown in the sequence listing SEQ ID NO: 1.

[0007] The immunomodulatory peptide Puerenin of the present invention is a cationic polypeptide encoded by the host defense peptide gene of the Chinese amphibian endemic species Puer pan tree frog, with a molecular weight of 1486.7 Daltons, a net charge of +5, an isoelectric point of 12.58, and a primary structure of the full sequence of the polypeptide (amino acid sequence SEQ ID NO: 2): Trp Gly Asn Arg Ala Val Arg Gly Arg Arg Arg Cys WGNRAVRGRRRC(12aa) The coding gene of the immunomodulatory peptide precursor consists of 592 nucleotides (SEQ ID NO: 1), and the sequence from the 5' end to the 3' end is: atggcgctcg ctgctgcact caccttcctg ctggggctgg cctgcaccat cctggcctcccctatacaag aatggagcgaggatgacgtc gccgtcatgg cgctgtacag cgcagattac tacaacaaagtatccggaga ggacgtcatt tacgggcttg tgggagacaa ggcggaatac gtcgatgaag aaaattttggatttcatcaa ctttttttcctgatacaaga aaccatttgc caaaaaagta acaacaacac ccagactgatggctgcgcat tcaaggaggg cggcgttgtg aaatcctgca cttcacgctt tttcacaaag gatgaccgggacgttgtggt gacctgccaataccaagatg gccaacagaa acactcaaga gtgagaagat ggggcaatcgcgctgtcaga ggaagaagac gctgttaaga cattgctgaa tgtaaccagc ccacttcccc tttttttaaaattttttcaa aaatcttgca tgaaaaattgacaaaaattt aaaaaatcac agaatataga gttagcatagaatttttgtt tgcaaaaaaa aaaaaaaaaa aaaaaaaaaa aa Among them, nucleotides 399–435 are the coding gene for the mature immunomodulatory peptide Puerenin.

[0008] The multifunctional immunomodulatory peptide Puerenin of the present invention is used in the preparation of drugs for treating skin light damage, drugs for removing damaged DNA, drugs for protecting skin from oxidation and removing free radicals in the body, and in the preparation of cosmetics.

[0009] The present invention has found that Puerenin has both antioxidant activity and DNA-binding and DNA-clearing activity, providing an anti-skin photodamage effect, so Puerenin is a multifunctional cathelicidin immunomodulatory peptide.

[0010] The invention provides a Pu'er pan tree frog ( Polypedates puerensis ) in anti-oxidation, removal of damaged DNA and anti-skin photodamage.

[0011] The beneficial effects of the present invention are: providing a Puer Pan tree frog skin multifunctional immunomodulatory peptide Puerenin with strong anti-skin photodamage activity, the immunomodulatory peptide has strong DNA binding activity, and can remove damaged DNA in photodamaged mice; the immunomodulatory peptide has strong antioxidant activity and anti-skin photodamage effect, and can be used in the preparation of anti-skin photodamage drugs, damaged DNA removal drugs, free radical removal drugs in the body, and cosmetics. The tree frog skin multifunctional immunomodulatory peptide has the advantages of simple sequence and low synthesis cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a schematic diagram showing that the immunomodulatory peptide Puerenin has a very strong antioxidant effect; Figure 2 Schematic diagram of the immunomodulatory peptide Puerenin's strong DNA binding and damaged DNA removal effects; Among them, (A) Puerenin can bind to DNA; DNA and Puerenin-DNA complexes were prepared and then identified by 1% agarose gel electrophoresis; (B) Binding affinity between DNA and Puerenin; (C) Puerenin clears damaged DNA in photodamaged mice; Figure 3 Schematic diagram showing that the immunomodulatory peptide Puerenin has a strong effect in protecting against skin photodamage. DETAILED DESCRIPTION

[0013] The present invention is further described below in conjunction with the embodiments and drawings, but the present invention is not limited in any way. Any changes or substitutions made based on the teachings of the present invention belong to the protection scope of the present invention.

[0014] The nucleotide sequence of the immunomodulatory peptide Puerenin of the present invention is shown in the sequence listing SEQ ID NO: 1.

[0015] The amino acid sequence encoded by the immunomodulatory peptide Puerenin is shown in SEQ ID NO:2.

[0016] The application of the immunomodulatory peptide Puerenin of the present invention is the application of the immunomodulatory peptide Puerenin in the preparation of a drug for treating skin photodamage.

[0017] The present invention is further described below with specific implementation cases: 1. Antioxidant effect of the multifunctional immunomodulatory peptide Puerenin from the skin of Puer pan tree frog ABTS+ clearance method to detect the antioxidant effect of functional immunomodulatory peptide Puerenin: ABTS + •It is a fairly stable blue-green free radical cation. In the presence of antioxidants with hydrogen-donating ability, it turns into colorless ABTS. Antioxidant peptides remove ABTS + • The ability of the samples was determined by the change in absorbance at 734 nm. + • The clearance rate is proportional to ABTS + •The clearance rate (%) is calculated according to the following formula: Clearance rate (%) = (A control -A sample ) / A control ×100 A control is the absorbance of the control group (usually a solution without sample, or a solution without antioxidant activity); A sample is the absorbance of the sample group (the solution containing the sample to be tested). The higher the clearance rate, the stronger the antioxidant activity of the sample.

[0018] ① Preparation of ABTS storage solution, the concentration is 2mM. ② Preparation of K2S2O8 PBS solution, the concentration is 70mM. ③ ABTS + • Preparation: Before use, mix ABTS stock solution and K2S2O8 solution in a volume ratio of 250:1 and keep at room temperature in the dark for 15-16 hours. ④ Dilute ABTS with PBS before the experiment + • Solution, so that its A734 is between 0.8±0.030. Pipette the diluted ABTS +•Add 10uL of the sample to be tested (final concentration is 0, 20, 40, 80μg / mL) to 200μL of the solution and measure its absorbance once a minute at a wavelength of 734nm.

[0019] The above experiments all used sample dissolving solution (PBS) as a control.

[0020] The results are as follows Figure 1 It shows that 80ug / ml of Puer Pan tree frog skin multifunctional immunomodulatory peptide Puerenin can quickly clear ABTS + The free radical scavenging rate is 90% within 2 minutes. This shows that the multifunctional immune regulatory peptide Puerenin from the skin of the Puer pan tree frog has a strong antioxidant effect, and also has the advantages of simple sequence and low synthesis cost, and can be used as a drug for the preparation of skin antioxidant protection and free radical scavenging in the body.

[0021] 2. DNA binding and damaged DNA removal of the multifunctional immunomodulatory peptide Puerenin from the skin of Puer pan tree frog 1. DNA binding activity assay: ① Prepare DNA and Puerenin-DNA complex, and then perform 1% agarose gel electrophoresis for identification. After the electrophoresis, take photos under UV light to record the data. The preparation method of Puerenin-DNA complex is: take 2 mg of Puerenin and 0.4 mg of DNA and dissolve them in 2 ml of PBS solution, incubate at room temperature for 15 minutes ( Figure 2 B). ② The dissociation constant (KD) was determined by BLI using the Octet RED96 system (ForteBio) for quantitative evaluation of the binding affinity between DNA and Puerenin. Biotin-labeled DNA (200nM) was immobilized on the Dip and Read biotin biosensor (ForteBio) and equilibrated with PBST solution. The biosensor was then exposed to different concentrations of peptides (5, 12.5, 25μM) and then washed with PBST (dissociation). The affinity (KD) was calculated using data analysis software (Forteio). The smaller the KD value, the stronger the binding affinity between the two substances. The BLI test results showed that Puerenin and CpG (a reporter molecule for DNA binding detection) had a higher affinity (KD=3.8pM) ( Figure 2 B).

[0022] 2. Puerenin removes damaged DNA in photodamaged mice: C57BL / 6 mice were treated with / without Puerenin (200 μg / mL) after UVB irradiation. Fresh skin tissues were taken from mice 96 hours later and dehydrated overnight at 4°C with 15% sucrose solution (prepared in PBS). The next day, the dehydrated skin samples were embedded with OCT embedding agent, and 15 μm quick-frozen skin frozen sections were prepared using a cryostat (Leica) for extracellular DNA staining of skin tissue. The sections were fixed in 4% paraformaldehyde for 30 minutes. Then, the sections were stained with SYTOX Orange nucleic acid staining solution (1:3000) for 15 minutes, washed three times with PBS, and finally sealed with neutral gum. The slides were imaged using a confocal microscope. The results of SYTOX Orange staining showed that extracellular DNA accumulated in large quantities in the skin of photodamaged model mice. Compared with the model group, the local cfDNA level in the Puerenin treatment group was significantly reduced. Furthermore, Puerenin treatment effectively downregulated the peripheral blood serum extracellular DNA to a level comparable to that of normal mice ( Figure 2 C).

[0023] The experimental results show that the multifunctional immunomodulatory peptide Puerenin has strong DNA binding activity and can effectively remove damaged DNA in photodamaged mice ( Figure 2 ).

[0024] 3. Application of Puerenin, a multifunctional immunomodulatory peptide from the skin of Puer pan tree frog, in the preparation of therapeutic drugs against skin photodamage Adult female C57BL / 6 mice (6-8 weeks, 18-20g) were used in the experiment. After one week of adaptive feeding under standard conditions, the mice were randomly divided into four groups (10 in each group): normal group (hair removal only, no UVB irradiation), model group (UVB irradiation + PBS treatment) and Puerenin treatment group (UVB irradiation + Puerenin treatment). The model group and the treatment group received a one-time high-dose UVB radiation with a radiation dose of 1000mJ / cm². The normal group and the model group were smeared with PBS every day, and the Puerenin treatment group was smeared with 100μL of Puerenin solution (200μg / mL, the solvent was PBS) every day. The back skin of the mice was photographed and observed until the 7th day.

[0025] The results are as follows Figure 3 As shown: After ultraviolet radiation, diffuse erythema and swelling appeared on the mouse skin 24 hours after radiation, and the swelling progressively worsened. After scratching, the skin became eroded, ulcerated, exuded, and scabbed. Puerenin treatment can significantly inhibit ultraviolet-induced skin erythema and edema.

[0026] The experimental results show that the multifunctional immunomodulatory peptide Puerenin has a strong effect in resisting skin photodamage ( Figure 3 ).

Claims

1. An immunomodulatory peptide Puerenin, characterized in that The nucleotide sequence of the immunomodulatory peptide Puerenin is shown in the sequence table SEQ ID NO:

1.

2. The immunomodulatory peptide Puerenin according to claim 1, characterized in that The amino acid sequence encoded by the immunomodulatory peptide Puerenin is shown in SEQ ID NO:

2.

3. A use of the immunomodulatory peptide Puerenin according to claim 1 or 2, characterized in that The immunomodulatory peptide Puerenin is used in the preparation of a drug for treating skin photodamage.

Images