Anti-human DCBLD2 nano antibody and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to an anti-human DCBLD2 nano antibody and application thereof. The anti-DCBLD2 nano antibody is successfully screened by using a phage display technology, and the nano antibody can be specifically combined with human DCBLD2 protein, can be prepared into an immune complex or a pharmaceutical composition for preventing or treating DCBLD2 target related diseases, and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular, relates to an anti-human DCBLD2 nanobody and uses thereof. Background Art

[0002] The DCBLD2 (CLCP1, ESDN) gene is a protein-coding gene located on chromosome 3. The protein it encodes belongs to a type I transmembrane protein, including an extracellular region (67-528aa), a transmembrane region (529-549aa), and an intracellular region (550-775aa). As a transmembrane protein, the structure of the DCBLD domain is very similar to that of neuroligin, including two Cub and Discoidin domains, and serves as a co-receptor for Semaphorin 3 and growth factors in axonal and angiogenesis. Studies have shown that the mRNA and protein expression levels of the DCBLD2 gene are significantly upregulated in highly metastatic lung adenocarcinoma cells, and it is involved in angiogenesis and the occurrence, development, and metastasis of tumors. Immunoprecipitation experiments showed that CLCP1 interacted with semaphorin 4B (SEMA4B), and the presence of SEMA4B enhanced the regulation of CLCP1 protein ubiquitination and proteasomal degradation, making CLCP1 a potential therapeutic target for inhibiting lung cancer metastasis. In addition, studies have shown that DCBLD2 is highly expressed in a variety of cancers, including colorectal cancer, glioblastoma, and head and neck tumors. Phosphorylation of DCBLD2 (Y750) recruits TNF receptor-associated factor 6 (TRAF6), leading to increased TRAF6 E3 ubiquitin ligase activity, which in turn activates AKT, thereby enhancing EGFR-driven tumorigenesis. Therefore, DCBLD2 and TRAF6 are potential therapeutic targets for human cancers associated with EGFR activation.

[0003] Nanobody (Nb), also known as single-domain antibodies (sdAbs) or VHH antibodies, has a molecular weight of 12-15kDa and is the smallest known active antigen-binding protein. Compared with monoclonal antibodies, nanobodies have larger CDR1 and CDR3, and have greater structural flexibility, which enhances the affinity of nanobodies to antigens, can recognize antigen gap epitopes, have strong tissue penetration, low immunogenicity, and are easy to humanize. They have broad application value and prospects in oncology, infectious diseases, circulatory system diseases, central nervous system diseases, and inflammatory diseases, especially in the blocking of immunosuppressive cells, the development of diagnostic and therapeutic antibodies, the neutralization of immunosuppressive molecules, cytokine regulation, and tumor immunotherapy such as CAR-T.

[0004] At present, there is no research on nano antibodies targeting human DCBLD2. In view of this, the present invention is proposed. Summary of the invention

[0005] The technical problem to be solved by the present invention is: there is a lack of nano antibodies targeting human DCBLD2 and a lack of effective treatment methods for DCBLD2-positive diseases.

[0006] The technical solution of the present invention to solve the above technical problems is: to provide a nanobody against human DCBLD2. The heavy chain variable region of the nanobody comprises CDR1, CDR2 and CDR3, and the amino acid sequences of CDR1, CDR2 and CDR3 are any one of SEQ ID No. 1 to 3, SEQ ID No. 5 to 7 or SEQ ID No. 9 to 11.

[0007] The nanoantibodies with the above amino acid sequences have good binding and reactivity with cells positive for DCBLD2 expression.

[0008] The above-mentioned anti-human DCBLD2 nanobody also includes a framework region, and the structure of its heavy chain variable region is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0009] Preferably, in the above-mentioned anti-human DCBLD2 Nanobody, when the Nanobody is a monovalent Nanobody, the amino acid sequence of the Nanobody is as shown in any one of SEQ ID No: 4, 8 or 12.

[0010] In a second aspect, the present invention further provides an antibody comprising the above-mentioned anti-human DCBLD2 nanobody or the heavy chain variable region of the anti-DCBLD2 nanobody.

[0011] Wherein, the antibody is any one of a full-length antibody, a heavy-chain antibody, a chimeric antibody, a multispecific antibody, a mouse antibody, a humanized antibody or an antigen-binding fragment.

[0012] Furthermore, the multispecific antibody is a bispecific antibody, a trispecific antibody or a tetraspecific antibody, etc.

[0013] Furthermore, the antigen-binding fragment comprises a F(ab') 2 , Fab', Fab, Fv and scFv, as long as they exhibit the desired antigen-binding activity.

[0014] The above antigen-binding fragments, i.e., functional fragments of antibodies, generally have the same binding specificity as the antibodies from which they are derived. It is easy for a person skilled in the art to understand based on the contents described in the present invention that the functional fragments of the above antibodies can be obtained by, for example, enzymatic digestion (including pepsin or papain) and / or by chemical reduction to split disulfide bonds. Based on the structure of the complete antibody disclosed in the present invention, a person skilled in the art can easily obtain the above functional fragments.

[0015] The above antigen-binding fragments can also be synthesized by recombinant genetic techniques also known to those skilled in the art or by, for example, an automatic peptide synthesizer, such as those sold by Applied BioSystems and the like.

[0016] The "chimeric antibody" described in the present invention is an antibody formed by fusing the variable region of a non-human antibody with the constant region or framework region of a human antibody, which can reduce the immune response induced by the non-human antibody.

[0017] Furthermore, in the above-mentioned antibody, the human heavy chain constant region is the heavy chain constant region of hIgG1, hIgG2, hIgG3 or hIgG4 or a mutation thereof.

[0018] In a third aspect, the present invention also provides a nucleic acid encoding the above-mentioned nanobody.

[0019] Wherein, the nucleotide sequence of the nucleic acid is shown in SEQ ID NOs: 13-15.

[0020] SEQ ID No.13 Nucleotide encoding the anti-DCBLD2 nanobody 1G6

[0021] CAGGTGCAGCTGCAGGAGTCTGGGGATGATAGCGTGCGCGCGGGCGGCAGCCTGCGCCTGAGCTGC

[0022] GCGGCGAGCCGCTTTTATGATAGCGGCCCGAGCTATAACCTGGTTTCGCCAGGTGCCGGGCAAAGAAC

[0023] ATGAATGGGTGACCGCGTGGAGCGAAGATGGCTATCTGGGCACCACCTATGCGCCGAGCGTGCCGG

[0024] GCCGCTTTGCGACCAGCCAGCATAAAGCGAAAAACACCCTGTATCTGCAGATGAACAGCCTGAAAC

[0025] CGGATGATACCGCGATGTATTGCTGCGCGAACCTGATGTTTGATTTTATTCCGCTGAGCGAACATTATTATAACGGCAGC TGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0026] SEQ ID No.14 Coding nucleotide of nanobody 3H7 against DCBLD2

[0027] CAGGTGCAGCTGCAGGAGTCTGGGGGCGATAGCGTGCAGGCGGGCGGCAGCCTGCGCGTGAGCTGC

[0028] ACCGCGAGCGGCTTTTATTGCAGCAACATGTATTATTGGTTTCGCCAGGCGCCGGGCAAAATGCGCG

[0029] AAGGCGTGAGCTTTGTGAGCACCCTGGTGCGCGGCAAACGCACCTGGTATGCGAACAGCGTGAACG

[0030] GCCGCTTTACCGTGAGCAAAGATAACGCGATGAACAGCCTGTATCTGCAGATGGATAGCCTGAAAG

[0031] CGGAAGATACCGCGATGTATTTTTGCGCGAACAGCACCGGCTTTGGCAAACTGCTGCAGTGGGCGCCGGAAGATCTGAACGCGAGCAAACTGTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA。

[0032] SEQ ID No.15 Coding nucleotide of nanobody 6F4 against DCBLD2

[0033] CAGGTGCAGCTGCAGGAGTCTGGGGGCCAGAGCGTGCAGACCGGCGGCAGCCTGCGCCTGAGCTGC

[0034] GCGTGCAGCGGCGATAGCGCGTTTGCGAGCAGCTATGCGTGGGTGCGCCAGGCGCCGGGCAAAGAA

[0035] CGCCAGGGCGTGGCGAGCATGACCGATGTGTATAGCCGCTTTACCAGCTATGCGGATTTTGTGAAAG

[0036] GCCGCTTTGCGATTAGCCGCGATAACGTGAAAAACACCGTGTATCTGCGCATGAACAACCTGAAACC

[0037] GGAAGATACCGCGATTTATTATTGCTATAGCATGACCCATAACGATCGCTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCA.

[0038] The present invention also provides a recombinant vector containing the nucleic acid encoding the above-mentioned nanobody.

[0039] The recombinant vector is an expression vector or a cloning vector, preferably an expression vector, which may refer to any recombinant polynucleotide construct that can directly introduce the target DNA fragment into the host cell by transformation, transfection or transduction to express the target gene.

[0040] In a fourth aspect, the present invention also provides a host cell containing the above-mentioned recombinant vector.

[0041] The present invention also provides a method for preparing an antibody, comprising: transducing the recombinant vector containing the anti-DCBLD2 nanobody of the third aspect of the present invention into the host cell of the fourth aspect by transfection or infection, collecting the culture supernatant or host cells after expanded culture, and further purifying to obtain the recombinant nanobody. Specifically, the present invention does not specifically limit the culture conditions of the host cells, and the culture conditions that enable the host cells to express and produce the antibody can be obtained based on conventional technical knowledge.

[0042] In a fifth aspect, the present invention also provides a recombinant protein or a pharmaceutical composition thereof, which includes the above-mentioned anti-DCBLD2 nanoantibody or the above-mentioned antibody, and also includes an active agent; the active agent includes at least one of an immune checkpoint-related preparation, an antibody-drug conjugate, a bispecific antibody, a multispecific antibody, a radionuclide or a kinase inhibitor.

[0043] In an optional embodiment, the therapeutic agent includes at least one of: a chemotherapeutic drug, a radionuclide, a photosensitizer, a photothermal agent, an immune checkpoint inhibitor, a toxin, a factor, a kinase inhibitor, an antibody to an inhibitory second signal molecule, a PD-L1 inhibitor, and a PD-1 / PD-L1 monoclonal antibody drug.

[0044] In a sixth aspect, the present invention also provides the use of the above-mentioned anti-DCBLD2 nanobody, antibody, nucleic acid, recombinant vector, host cell, recombinant protein or pharmaceutical composition thereof in the preparation of a drug for preventing or treating a DCBLD2-positive expression disease.

[0045] Wherein, the drug is at least one of an immune cell, a reagent or a composition.

[0046] Wherein, the DCBLD2-positive expression disease is at least one of lung cancer, colorectal cancer, lung cancer, glioblastoma or head and neck tumor.

[0047] The present invention has the following beneficial effects:

[0048] The present invention uses human DCBLD2 as a target, and prepares anti-DCBLD2 nano antibodies through phage display technology, and all of them can specifically bind to DCBLD2 antigens. The anti-DCBLD2 nano antibodies obtained by the present invention can specifically bind to human DCBLD2 protein, and can be made into immune complexes or pharmaceutical compositions for preventing or treating DCBLD2 target-related diseases, and have broad application prospects in the fields of prevention and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 In the embodiment of the present invention, indirect ELISA is used to detect the immune titer;

[0050] Figure 2 In the embodiment of the present invention, indirect ELISA is used to detect the specific binding activity of anti-DCBLD2 nanobody and DCBLD2 protein;

[0051] Figure 3 In the embodiment of the present invention, indirect ELISA is used to detect the reactivity of anti-DCBLD2 nanobody and DCBLD2 protein;

[0052] Figure 4 In the embodiment of the present invention, IFA was used to detect the binding of anti-DCBLD2 nanobody to DCBLD2-Hela cells.

[0053] Figure 5 This embodiment of the present invention utilizes a mouse xenograft model to evaluate the in vivo anti-tumor activity of an anti-DCBLD2 antibody-drug conjugate (ADC). DETAILED DESCRIPTION

[0054] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0055] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0056] The specific implementation modes of the present invention are further described in detail below in conjunction with examples, but it does not mean that the protection scope of the present invention is limited to the scope described in the examples.

[0057] Example 1 Preparation of anti-DCBLD2 protein specific nanobody

[0058] First, DCBLD2-His protein (Cat: 13615-H08H) (1 mg / time) purchased from Sino Biological Biotechnology Co., Ltd. was mixed with an equal volume of aluminum adjuvant and then immunized Bactrian camels three times in a row. Peripheral blood was collected and the antibody titer was detected by indirect ELISA. The results showed that the antibody titer against DCBLD2 in the peripheral blood of camels was 1:256,000 ( Figure 1 As shown), the titer standard for subsequent library construction was reached. One week after shock immunization, 200 mL of peripheral anticoagulated blood was collected from the camel's neck vein aseptically, and peripheral blood lymphocytes were separated by centrifugation using Ficoll-PaquePlus lymphocyte separation solution. The total RNA of lymphocytes was extracted using an RNA extraction kit, and the VHH gene was amplified by RT-PCR. The amplified VHH gene was cloned into the phage display vector pMECS by enzyme digestion and ligation, and then transformed into Escherichia coli TG1 competent cells by electroporation. The results showed that a library with a capacity of 3.95×10 9 VHH phage antibody library.

[0059] After three rounds of screening using phage display technology, the purified DCBLD2-His recombinant protein (2 μg / mL) was first coated on a 96-well ELISA plate, and the plate was blocked with 3% skim milk powder at 37°C for 1 h the next day. 1×10 10Recombinant phage containing nano-antibodies were prepared, incubated at 37°C for 1 hour, washed 5 times with PBST, and then eluted with 0.1M glycine (pH=1.5) to elute the phage bound to DCBLD2-His, and neutralized with 1M Tris-HCl (pH=8.0). The eluate was used to infect the host bacteria TG1 again and expanded for 3 rounds of screening. After picking monoclonal colonies for expansion, crude extract ELISA was used to detect antibodies that can bind to DCBLD2 protein, and the positive clones were sequenced and analyzed by sequence comparison to obtain a total of 3 anti-DCBLD2 nano-antibodies. Furthermore, the specificity of the above antibodies was tested by indirect ELISA, and the results are as follows: Figure 2 As shown, the results show that the anti-DCBLD2 nanobodies prepared in the examples can specifically bind to the DCBLD2 protein and do not react with irrelevant proteins PD1, PDL1, EGFR, HER2 and HER3.

[0060] Further, the VHH gene was amplified using the phage plasmid containing the nanobody gene of the present invention as a template and constructed into the eukaryotic expression vector pcDNA3.1-MCS-hFc by homologous recombination. After successful construction, it was transfected into HEK293T cells, and the supernatant was collected after 5 days of expression. The recombinant nanobody was purified by affinity chromatography using an NTA-Ni column. The sequence of the obtained nanobody is shown in Table 1 below.

[0061] Table 1 Antibody sequence information

[0062]

[0063]

[0064] Example 2 Indirect ELISA to detect the binding of DCBLD2 recombinant nanobody to DCBLD2 protein

[0065] DCBLD2-His recombinant protein was added to a 96-well ELISA plate at 2 μg / mL, coated overnight at 4°C, and then blocked with 3% skim milk powder at 37°C for 1 h. After washing 3 times with PBST, 100 μL of different concentrations (10 -6 ~10 0 The recombinant nanobody prepared in Example 1 was placed in a 37°C incubator for 1 h, washed 3 times with PBST, and 100 μL of HRP@goat anti-human antibody (1:4000) was added to each well and incubated for 1 h at 37°C. After washing 3 times with PBST, 100 μL of TMB colorimetric solution was added to each well and placed in a 37°C incubator to develop color for 5 min in the dark. 50 μL of 2M H 2 SO 4The reaction was terminated, and the absorbance at OD450 nm was read in a multifunctional microplate reader. A four-parameter fitting binding curve was drawn using Graphpad 9.0. The results are shown in Figure 3 The results showed that the prepared DCBLD2 recombinant nanobody had good binding activity with the DCBLD2-His protein and had no binding with the control protein hFc.

[0066] Example 3 Affinity detection of nanobody and DCBLD2 protein

[0067] The DCBLD2-His protein was respectively combined with the Nbs-hFc recombinant protein (1.5 μg / mL) captured on the Protein G chip using a Biacore 8k instrument to detect the binding affinity. The results are shown in Table 2. The affinity of the nanobody to the DCBLD2 protein is between 10 -8 ~10 -7 M.

[0068] Table 2 Binding affinity and kinetic analysis of anti-DCBLD2 nanoantibodies to DCBLD2 protein

[0069] Antibody Binding rate ka (1 / M*s) Dissociation rate kd (1 / s) Affinity KD(M) 1G6 3.48E+04 1.68E-03 4.82E-08 3H7 1.45E+05 1.23E-02 8.44E-08 6F4 1.69E+04 2.36E-03 1.40E-07

[0070] Example 4 IFA detection of the binding of DCBLD2 recombinant nanobody to DCBLD2-Hela cells

[0071] Hela cells were infected with a lentivirus containing the full-length DCBLD2 gene (gene number BC029658), and high-purity Hela cells stably expressing the DCBLD2 gene were obtained by flow sorting and named DCBLD2-Hela cells. The DCBLD2 recombinant nanobody (3 μg / mL) prepared in Example 1 was incubated with the DCBLD2-Hela cells inoculated in a cell culture plate at 37°C for 40 min, washed 3 times with PBS, and then incubated with 594@goat anti-human secondary antibody. After washing 3 times with PBS, imaging was performed using a fluorescence microscope. The results are as follows: Figure 4 As shown, the results showed that recombinant nanoantibodies 1G6, 3H7 and 6F4 were able to bind well to DCBLD2-Hela cells.

[0072] Example 5 Anti-tumor experiment in xenograft model mice

[0073] This example uses a xenograft mouse model to evaluate the in vivo antitumor activity of DCBLD2 antibody-drug conjugates (ADCs) conjugated with MMAE toxin. 6 A375 cells stably transfected with DCBLD2 in the logarithmic growth phase were inoculated subcutaneously on the right back of NCG mice. After about 6 days, the tumor grew to 150 mm.3 Afterwards, mice with uniform tumor volumes were randomly divided into groups, with 5 mice in each group. A blank control group was set up with an equal volume of PBS as the drug, and an irrelevant antibody-drug conjugate group was set up as the control group. The antibody-drug conjugate was administered intraperitoneally, 30 μg / mouse, once every 5 days, for a total of 4 times. The mice were weighed and the tumor size was measured every 3 days. The average volume of the transplanted tumor was calculated according to the formula V=1 / 2(L×W 2 ), where L represents the length of the tumor and W represents the width of the tumor. 3 Or if the tumor surface showed obvious ulceration, the mouse was killed and the animal experiment was terminated. The tumor inhibition rate of the antibody-drug conjugate was calculated based on the tumor volume of the experimental group and the control group. The calculation formula was: tumor inhibition rate (%) = [1-(tumor volume of the experimental group / tumor volume of the control group)] × 100%. The experimental results are as follows Figure 5 As shown, compared with the control group, the tumor volume of the four ADC drugs targeting DCBLD2 was significantly smaller than that of the control group (PBS and control), and the four anti-DCBLD2 ADC drugs had a significant inhibitory effect on the growth of DCBLD2-A375 tumor cells. The data were analyzed using one-way ANOVA analysis, ns indicates no statistical difference, **** indicates P<0.0001.

[0074] The above experiments collectively illustrate that the anti-human DCBLD2 nanoantibodies screened by the present invention can specifically bind to the DCBLD2 target with high affinity, and can be widely used in the prevention and treatment of diseases related to DCBLD2, providing a new option for the prevention or treatment of DCBLD2-positive diseases.

[0075] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A nanobody against human DCBLD2, characterized in that: The heavy chain variable region of the nanobody comprises CDR1, CDR2 and CDR3, and the amino acid sequences of CDR1, CDR2 and CDR3 are any one of SEQ ID No.1-3, SEQ ID No.5-7 or SEQ ID No.9-11 respectively.

2. The anti-DCBLD2 nanobody according to claim 1, characterized in that The nanobody also includes a framework region, and the structure of the nanobody is: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4; Preferably, the amino acid sequence of the heavy chain variable region is as shown in any one of SEQ ID No: 4, 8 or 12.

3. An antibody, characterized in that: Comprising the anti-DCBLD2 nanobody according to any one of claims 1 or 2 or comprising any one heavy chain variable region of the anti-DCBLD2 nanobody according to claim 1 or 2.

4. The antibody according to claim 3, characterized in that: The antibody is any one of a full-length antibody, a heavy chain antibody, a chimeric antibody, a multispecific antibody, a mouse antibody, a humanized antibody or an antigen-binding fragment; preferably, the antigen-binding fragment comprises any one selected from the group consisting of F(ab')2, Fab', Fab, Fv or scFv of an antibody.

5. A recombinant vector comprising a nucleic acid encoding the antibody according to any one of claims 1 to 4; preferably, the recombinant vector is a plasmid or a virus; the virus is an adenovirus, an adeno-associated virus, a retrovirus, a lentivirus or an oncolytic virus. A host cell comprising the recombinant vector according to claim 5.

7. A recombinant protein or a pharmaceutical composition thereof comprising the anti-DCBLD2 Nanobody according to claim 1 or 2 or the antibody according to claim 3 or 4.

8. The pharmaceutical composition according to claim 7, characterized in that: It also contains an active agent; the active agent includes at least one of an immune checkpoint-related preparation, an antibody-drug conjugate, a bispecific antibody, a multispecific antibody, a radionuclide or a kinase inhibitor.

9. Use of the anti-DCBLD2 nanobody according to claim 1 or 2, the antibody according to claim 3 or 4, the recombinant vector according to claim 5, the host cell according to claim 6, the recombinant protein according to claim 7 or a pharmaceutical composition thereof in the preparation of a drug for preventing or treating a disease that expresses positive DCBLD2.

10. The use according to claim 9, characterized in that: The drug includes at least one of an immune cell, a reagent or a composition; the DCBLD2-positive expression disease includes at least one of lung cancer, colorectal cancer, lung cancer, glioblastoma or head and neck tumor.

Images