Anti-KOFU DNA polymerase antibody and application thereof

Abstract

The invention provides an antibody for resisting KOFU DNA polymerase and application of the antibody. After the provided monoclonal antibody and KOFU are mixed and incubated, the polymerization activity and the excision activity of KOFU DNA polymerase can be efficiently and specifically neutralized. After pre-denaturation, the activity of the KOFU DNA polymerase is recovered, and the KOFU DNA polymerase can be applied to amplification reaction.

Description

Technical Field

[0001] The present invention belongs to the field of immunology and genetic engineering, and specifically relates to an antibody against KOFU DNA polymerase and an application thereof. Background Art

[0002] In PCR technology, due to defects in primer sequence design, excessive primers, etc., non-specific amplification caused by primer dimers or mismatches, etc., the experimental results are inaccurate. In addition, the higher 3′-5′ exo-cutting (proofreading) activity also causes DNA polymerase to degrade primers and substrates (such as Y-type second-generation sequencing libraries) during system preparation at room temperature and the PCR program heating stage. Hot start PCR can solve the above problems very well. Hot start enzyme (Hot start enzyme) mainly uses enzyme modifiers to inhibit the activity of DNA polymerase at room temperature. When heated to the denaturation temperature, the modifier is inactivated and the enzyme activity is released, so that the PCR reaction can proceed normally. At present, most of the commercially available DNA polymerases use antibody hot start technology to solve these problems.

[0003] The DNA polymerase chimera KOFU is modified by replacing the Palm-figers region of Pfu DNA polymerase with the same region of KOD DNA polymerase. KOFU DNA polymerase has both high 5′-3′ polymerization activity and high 3′-5′ exonuclease (proofreading) activity, ensuring the yield and fidelity of PCR products. The high fidelity and amplification efficiency of KOFU DNA polymerase provide a better choice for the amplification of second-generation sequencing libraries.

[0004] However, there is no report on monoclonal antibodies against KOFU DNA polymerase. It is urgent to develop a monoclonal antibody that blocks KOFU DNA polymerase in order to improve the specificity and sensitivity of KOFU DNA polymerase. Summary of the invention

[0005] In order to solve at least one of the above problems, the present disclosure provides an antibody against KOFU DNA polymerase and its application. The antibody provided by the present disclosure can effectively and specifically neutralize the activity of KOFU DNA polymerase.

[0006] According to one aspect of the present disclosure, an anti-KOFU DNA polymerase antibody or an antigen-binding fragment thereof is provided, wherein the antibody or the antigen-binding fragment thereof comprises:

[0007] (1) the following three heavy chain variable region complementarity determining regions (HCDRs):

[0008] HCDR1 having the amino acid sequence of HCDR1 contained in the heavy chain variable region as shown in SEQ ID NO: 1, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR1 contained in the heavy chain variable region;

[0009] HCDR2 having the amino acid sequence of HCDR2 contained in the heavy chain variable region as shown in SEQ ID NO: 1, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR2 contained in the heavy chain variable region;

[0010] HCDR3 having the amino acid sequence of HCDR3 contained in the heavy chain variable region as shown in SEQ ID NO: 1, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR3 contained in the heavy chain variable region; and / or

[0011] (2) the following three light chain variable region complementarity determining regions (LCDR):

[0012] LCDR1 having the amino acid sequence of LCDR1 contained in the light chain variable region as shown in SEQ ID NO: 2, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR1 contained in the light chain variable region;

[0013] LCDR2 having the amino acid sequence of LCDR2 contained in the light chain variable region as shown in SEQ ID NO: 2, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR2 contained in the light chain variable region;

[0014] LCDR3 has the amino acid sequence of LCDR3 contained in the light chain variable region as shown in SEQ ID NO: 2, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR3 contained in the light chain variable region.

[0015] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2 and HCDR3 contained in the heavy chain variable region as shown in SEQ ID NO:1, and LCDR1, LCDR2 and LCDR3 contained in the light chain variable region as shown in SEQ ID NO:2.

[0016] In some embodiments, the HCDR1-3 and / or the LCDR1-3 are defined by the IMGT numbering system, the Kabat numbering system, the Chothia numbering system, the Contact numbering system, or a combination thereof.

[0017] In some embodiments, the antibody or antigen-binding fragment thereof comprises:

[0018] (1) the following heavy chain variable region and / or light chain variable region, wherein HCDR1-3 and / or LCDR1-3 are defined according to the IMGT numbering system: a heavy chain variable region comprising the following three HCDRs: HCDR1 with a sequence of SEQ ID NO: 11, HCDR2 with a sequence of SEQ ID NO: 12, and HCDR3 with a sequence of SEQ ID NO: 13; and / or, a light chain variable region comprising the following three LCDRs: LCDR1 with a sequence of SEQ ID NO: 14, LCDR2 with a sequence of AAS, and LCDR3 with a sequence of SEQ ID NO: 15;

[0019] or

[0020] (2) the following heavy chain variable region and / or light chain variable region, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Kabat numbering system: a heavy chain variable region comprising the following three HCDRs: HCDR1 with a sequence of SEQ ID NO: 16, HCDR2 with a sequence of SEQ ID NO: 17, and HCDR3 with a sequence of SEQ ID NO: 18; and / or, a light chain variable region comprising the following three LCDRs: LCDR1 with a sequence of SEQ ID NO: 19, LCDR2 with a sequence of SEQ ID NO: 20, and LCDR3 with a sequence of SEQ ID NO: 15;

[0021] or

[0022] (3) the following heavy chain variable region and / or light chain variable region, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Chothia numbering system: a heavy chain variable region comprising the following three HCDRs: HCDR1 with a sequence of SEQ ID NO:21, HCDR2 with a sequence of SEQ ID NO:22, and HCDR3 with a sequence of SEQ ID NO:18; and / or, a light chain variable region comprising the following three LCDRs: LCDR1 with a sequence of SEQ ID NO:19, LCDR2 with a sequence of SEQ ID NO:20, and LCDR3 with a sequence of SEQ ID NO:15;

[0023] or

[0024] (4) the following heavy chain variable region and / or light chain variable region, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Contact numbering system: a heavy chain variable region comprising the following three HCDRs: HCDR1 with a sequence of SEQ ID NO:23, HCDR2 with a sequence of SEQ ID NO:24, and HCDR3 with a sequence of SEQ ID NO:25; and / or, a light chain variable region comprising the following three LCDRs: LCDR1 with a sequence of SEQ ID NO:26, LCDR2 with a sequence of SEQ ID NO:27, and LCDR3 with a sequence of SEQ ID NO:28.

[0025] In some embodiments, the antibody or antigen-binding fragment thereof comprises:

[0026] A heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 1, an amino acid sequence having one or more amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto; and

[0027] A light chain variable region having the amino acid sequence shown in SEQ ID NO: 2, an amino acid sequence having one or more amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto.

[0028] In some embodiments, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO:1 and a light chain variable region having the amino acid sequence shown in SEQ ID NO:2.

[0029] In some embodiments, the antibody or antigen-binding fragment thereof includes an antibody Fab fragment, a Fab' fragment, a F(ab')2 fragment, a Fv fragment, a scFv fragment, a nanobody, a heavy chain variable region VH fragment, or a light chain variable region VL fragment.

[0030] In some embodiments, the antibody or antigen-binding fragment thereof is derived from IgG, IgA, IgM, IgD or IgE.

[0031] In some embodiments, in the antibody or antigen-binding fragment thereof, the heavy chain is derived from any one of IgG1, IgG2a, IgG2b, IgG3 or IgG4, and / or the light chain is derived from any one of a kappa light chain and a lambda light chain.

[0032] In some embodiments, in the antibody or antigen-binding fragment thereof, the heavy chain is derived from IgG1, and the light chain is derived from a kappa light chain.

[0033] In some embodiments, the KOFU DNA polymerase has an amino acid sequence as shown in SEQ ID NO: 3, or an amino acid sequence having one or more amino acids substituted, deleted or added thereto.

[0034] According to yet another aspect of the present disclosure, an isolated nucleic acid molecule is provided, which encodes the antibody or antigen-binding fragment thereof.

[0035] According to yet another aspect of the present disclosure, an expression cassette is provided, comprising the isolated nucleic acid molecule.

[0036] In some embodiments, the expression cassette further comprises a promoter.

[0037] In some embodiments, the expression cassette further comprises one or more of the following: an enhancer, a terminator, a non-coding region, or a reporter gene.

[0038] According to another aspect of the present disclosure, an expression vector is provided, which comprises the isolated nucleic acid molecule.

[0039] According to another aspect of the present disclosure, a host cell is provided, which comprises the isolated nucleic acid molecule, the expression cassette or the expression vector.

[0040] In some embodiments, the host cell comprises a eukaryotic or prokaryotic cell.

[0041] In some embodiments, the prokaryotic cell comprises a bacterium.

[0042] In some embodiments, the bacteria include Escherichia coli, such as BL21(DE3), EcB1, EcB1SAintimin, EcB1SAintiminfap, EcB1SAYeeJ, EcB1SAYeeJfap.

[0043] In some embodiments, the eukaryotic cell comprises a yeast, insect, plant, mammalian cell or a hybridoma cell.

[0044] In some embodiments, the hybridoma cell is obtained by fusion of a myeloma cell and a B lymphocyte.

[0045] In some embodiments, the B lymphocytes are from the spleen.

[0046] According to another aspect of the present disclosure, a complex is provided, which includes the antibody or antigen-binding fragment thereof and KOFU DNA polymerase, wherein the antibody or antigen-binding fragment thereof specifically binds to the KOFU DNA polymerase.

[0047] In some embodiments, the ratio of the antibody or antigen-binding fragment thereof to the KOFU DNA polymerase includes (0.8-12 μg):1U.

[0048] In some embodiments, the complex can trigger a 5'-3' extension reaction of a DNA chain or a 3'-5' exo-cleavage reaction of a DNA chain.

[0049] In some embodiments, the complex is capable of initiating a DNA amplification reaction.

[0050] According to another aspect of the present disclosure, a kit is provided, which comprises the antibody or antigen-binding fragment thereof, or the complex.

[0051] In some embodiments, the kit further comprises a buffer, Mg 2+ , dNTP, DNA template and primers that can complementarily bind to the DNA template.

[0052] According to another aspect of the present disclosure, a conjugate is provided, comprising: the antibody or antigen-binding fragment thereof; and a conjugation portion.

[0053] In some embodiments, the conjugated moiety is selected from a detectable label.

[0054] In some embodiments, the detectable label includes but is not limited to radioactive isotopes, fluorescent substances, luminescent substances, colored substances, polyethylene glycol, nuclides, nucleic acids, polypeptides with binding activity, proteins, receptors, ligands, etc.

[0055] According to another aspect of the present disclosure, there is provided a method for preparing the complex, comprising the step of incubating the antibody or antigen-binding fragment thereof with KOFU DNA polymerase.

[0056] According to another aspect of the present disclosure, a method for amplifying a DNA fragment by polymerase chain reaction is provided, the method comprising the step of amplifying using the antibody and KOFU DNA polymerase; or the step of amplifying using the complex.

[0057] In some embodiments, the method includes heating the complex to ≥90°C, ≥91°C, ≥92°C, ≥93°C, ≥94°C, ≥95°C, ≥96°C, ≥97°C, ≥98°C, ≥99°C, ≥100°C, ≥101°C, ≥102°C, ≥103°C, ≥104°C or ≥105°C to activate its activity, and then using the activated complex to amplify the DNA fragment.

[0058] According to another aspect of the present disclosure, a reaction system is provided, characterized in that the reaction system comprises the antibody or antigen-binding fragment thereof, or the complex.

[0059] In some embodiments, the reaction system further comprises a buffer, Mg 2+ , dNTP, DNA template and primers that can complementarily bind to the DNA template.

[0060] According to another aspect of the present disclosure, provided is the use of the antibody or antigen-binding fragment thereof, or the complex in blocking KOFU DNA polymerase or amplifying DNA.

[0061] In some embodiments, blocking KOFU DNA polymerase includes blocking its 5'-3' DNA polymerase activity and 3'-5' DNA exonuclease activity.

[0062] In some embodiments, the blocked KOFU DNA polymerase obtained by blocking the KOFU DNA polymerase is heated to ≥90°C, ≥91°C, ≥92°C, ≥93°C, ≥94°C, ≥95°C, ≥96°C, ≥97°C, ≥98°C, ≥99°C, ≥100°C, ≥101°C, ≥102°C, ≥103°C, ≥104°C or ≥105°C, and then the antibody or antigen-binding fragment thereof is denatured and inactivated, thereby restoring the activity of the blocked KOFU DNA polymerase.

[0063] According to another aspect of the present disclosure, provided is the use of the antibody or antigen-binding fragment thereof, the isolated nucleic acid molecule, the expression cassette, the expression vector or the host cell in preparing the complex or the conjugate.

[0064] In some embodiments, the DNA polymerase activity of the complex is blocked before heating, and the activity is activated by heating, and the activity includes 5'-3' DNA polymerase activity and 3'-5' DNA exonuclease activity, and the heating temperature is ≥90°C, ≥91°C, ≥92°C, ≥93°C, ≥94°C, ≥95°C, ≥96°C, ≥97°C, ≥98°C, ≥99°C, ≥100°C, ≥101°C, ≥102°C, ≥103°C, ≥104°C or ≥105°C.

[0065] According to another aspect of the present disclosure, provided is a use of the antibody or antigen-binding fragment thereof, the isolated nucleic acid molecule, the expression cassette, the expression vector, or the host cell or the complex in preparing a kit.

[0066] Beneficial effects:

[0067] The purpose of the present disclosure is to provide a monoclonal antibody against polymerase and its application. The monoclonal antibody provided has high titer and can efficiently and specifically neutralize the polymerization activity and exo-cutting activity of the blocked KOFU DNA polymerase after mixed incubation with KOFU. After pre-denaturation, the KOFU DNA polymerase recovers its polymerization activity and exo-cutting activity. The PCR based on the KOFU DNA polymerase and its monoclonal antibody complex is more convenient to operate, and the system can be prepared at room temperature or low temperature, and the results are more specific, efficient and accurate. It can also be applied to the amplification of sequencing libraries, so that the resulting library has higher specificity and sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 The figure shows the SDS-PAGE analysis of the purified KOFU DNA polymerase protein.

[0069] Figure 2 The results of the test on the neutralization of KOFU DNA polymerase polymerization activity by mouse serum are shown.

[0070] Figure 3 The results of the mouse serum neutralization test on the exo-activity of KOFU DNA polymerase are shown.

[0071] Figure 4 The results of the test of the polymerization activity of KOFU DNA polymerase in the culture supernatant of the second subclone cells are shown.

[0072] Figure 5 The results of the test of the exo-activity of KOFU DNA polymerase in the culture supernatant of the second subclone cells are shown.

[0073] Figure 6 PAGE analysis of purified SM06 and SM08 antibodies is shown. Lane 1: Protein Marker. Lane 2: SM06 antibody. Lane 2: SM08 antibody.

[0074] Figure 7 The SDS-PAGE analysis of the purified SM06 and SM08 antibodies is shown. Lane 1: Protein Marker. Lane 2: SM06 antibody. Lane 2: SM08 antibody.

[0075] Figure 8 The graph shows the effect of hybridoma cell SM06 and SM08 monoclonal antibodies neutralizing the polymerization activity of KOFU DNA polymerase.

[0076] Fig. 9 The figure shows the recovery effect of KOFU DNA polymerase polymerization activity after hot start.

[0077] Fig.10The graph shows the effect of hybridoma cell SM06 monoclonal antibody neutralizing the exo-activity of KOFU DNA polymerase.

[0078] Fig.11 The figure shows the effect of recovery of KOFU DNA polymerase exo-activity after hot start.

[0079] Fig.12 Shown is the RT-PCR agarose gel electrophoresis diagram. DETAILED DESCRIPTION

[0080] The present invention uses purified KOFU DNA polymerase as an immunogen to immunize mice, screens out the mouse serum with the best blocking effect on KOFU polymerization activity, and screens out the main clone through the blocking effect on KOFU enzyme polymerase and exonuclease, uses the main clone to dilute and culture subclones, and obtains a KOFU DNA polymerase monoclonal antibody after screening and verification, comprising a heavy chain complementary determining region (CDR) and a light chain CDR, wherein the heavy chain CDR region and the light chain CDR region are shown in Table 1, and the heavy chain variable region and the light chain variable region sequences are shown in Table 2. The monoclonal antibody can neutralize the 5'-3' polymerization activity and 3'-5' exonuclease activity of KOFU DNA polymerase.

[0081] Table 1 CDR sequences of monoclonal antibodies

[0082]

[0083]

[0084] Table 2 Heavy chain variable region and light chain variable region sequences of monoclonal antibodies

[0085]

[0086] The present disclosure also provides a hybridoma cell that produces the above-mentioned monoclonal antibody. After conventional domestication, the hybridoma cell can be suspended and cultured to produce a large amount of monoclonal antibodies.

[0087] The monoclonal antibody of the KOFU DNA polymerase disclosed in the present invention can effectively neutralize the polymerization activity and exo-cutting activity of the polymerase at the same time with only 0.8 μg of the antibody at 1 U of the polymerase. Therefore, the PCR based on the complex of the KOFU DNA polymerase and the monoclonal antibody is more convenient to operate, the system can be prepared at room temperature or low temperature, and the results are more specific, efficient and accurate.

[0088] definition

[0089] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0090] As used herein, the articles "a," "an," and "an" include plural referents unless the context clearly dictates otherwise.

[0091] The expression "about" as used herein is understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is not aware of the use of the term based on the context in which it is used, "about" will mean up to plus or minus 10% of the specified value.

[0092] The term "specific recognition" or "specific binding" as used herein means that the antibody has recognition and binding selectivity for a ligand or receptor and can be distinguished from unwanted or non-specific binding.

[0093] The term "antibody" as used herein includes complete antibodies and any antigen binding fragments (i.e., "antigen binding portion", "antigen binding polypeptide" or "immunobinder"), or single chains thereof. "Antibody" is a glycoprotein comprising at least two heavy chains (H) and two light chains (L) interconnected by disulfide bonds, or an antigen binding portion thereof. Each heavy chain includes a heavy chain variable (VH) region and a heavy chain constant region (CH). Each light chain includes a light chain variable (VL) region and a light chain constant region (CL). The VH region and the VL region each contain three highly variable regions of amino acid composition and arrangement order, referred to as hypervariable regions or complementary determining regions (complementarity determining regions, CDR), CDR1, CDR2 and CDR3. The amino acid composition and arrangement order of the regions in the VH region and the VL region except the CDR region are relatively conservative, referred to as framework regions (framework regions, FR). VH or VL each has four framework regions, represented by FR1, FR2, FR3 and FR4, respectively.

[0094] There are five main classes of immunoglobulins, IgA, IgD, IgE, IgG and IgM, and these main classes can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. The heavy chain constant domains corresponding to different classes of immunoglobulins are called α, δ, ε, γ and μ, respectively. The light chain includes different types of κ or λ, but the CH lengths of different classes of immunoglobulins are different, for example, IgG, IgA and IgD include CH1, CH2 and CH3, while IgM and IgE include CH1, CH2, CH3 and CH4. The hinge region is located between CH1 and CH2, is rich in proline, and is easy to stretch and bend, thereby changing the distance between the antigen binding sites, which is conducive to the antibody binding to antigen epitopes located at different positions. The hinge region is easily hydrolyzed by papain, pepsin, etc., to produce different hydrolysis fragments. The site where papain hydrolyzes Ig is near the N-terminus of the two heavy chains connected by disulfide bonds in the hinge region, and Ig can be split into two identical Fab segments and one Fc segment. The Fab segment is an antigen binding fragment (fragment antigen binding, Fab), which consists of a complete light chain and the VH and CH1 domains of the heavy chain.

[0095] Unless otherwise indicated, "antibody active fragment", "antibody fragment", "target binding fragment" and "antigen binding fragment" are interchangeable in the context of the present invention and refer to antibody fragments that can specifically bind to an antigen, such as fragments that retain one or more CDR regions. Examples of antigen binding fragments include, but are not limited to, Fab, Fab', F(ab')2 and Fv fragments; bispecific antibodies; linear antibodies; single-chain antibody molecules, such as single-chain Fv (ScFv); nanobodies and multispecific antibodies formed from antibody fragments.

[0096] The term "variable region" or "variable domain" used herein refers to the domain of the antibody heavy chain or light chain that participates in the binding of an antigen-binding molecule to an antigen. The variable domains of the heavy and light chains of natural antibodies (VH and VL, respectively) generally have similar structures, wherein each domain comprises four conserved framework regions (FR) and three hypervariable regions (HVR). A single VH or VL domain may be sufficient to confer antigen binding specificity. The term "variable" of the present invention refers to certain segments of the variable domain that are generally different in sequence between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody for its specific antigen. However, variability is not uniformly distributed throughout the variable domain. Instead, it is concentrated in three segments called hypervariable regions (HVR) within the light and heavy chain variable domains. The more highly conserved portion of the variable domain is referred to as the framework region (FR). The variable domains of natural heavy and light chains each comprise four FR regions, most of which adopt a β-folded configuration, connected by three HVRs, which form a loop connection, and in some cases form a part of the β-folded structure. The HVRs in each chain are held together by the FR regions and, together with the HVRs of the other chains, contribute to the formation of the antigen-binding site of the antibody. The constant domains are not directly involved in the binding of the antibody to the antigen, but have other effector functions, such as participation in the antibody-dependent cellular toxicity of the antibody.

[0097] The term "monoclonal antibody" or "mAb" as used herein refers to an antibody molecule / preparation of single molecular composition. A monoclonal antibody displays a single binding specificity and affinity for a particular epitope. The antibodies of the present invention may be derived from different species, including but not limited to mice, rats, rabbits, guinea pigs, and humans.

[0098] The term "codon optimization" as used herein refers to modifying the codons of a nucleic acid molecule in a gene or coding region to reflect the typical codon usage of a host organism without changing the polypeptide encoded by the nucleic acid molecule. Such optimization includes replacing at least one, or more than one, or a large number of codons with one or more codons that are more commonly used in the genes of the host organism. Codon optimization can improve the translation of transcript RNA molecules transcribed from a coding sequence in an expression host cell or organism, or improve the sequence of transcription of a coding sequence. Codon optimization includes, but is not limited to, a process including selecting codons for a coding sequence to adapt to the codon preference of an expression host organism. Many organisms show a bias or preference for using specific codons to encode in order to insert specific amino acids into growing polypeptide chains. Codon preference or codon bias, which differs in codon usage between organisms, is allowed by the degeneracy of the genetic code, and is well documented between many organisms. Codon bias is generally associated with the translation efficiency of messenger RNA (mRNA), which is in turn considered to be particularly dependent on the properties of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons most frequently used in peptide synthesis. Thus, custom genes can be expressed in specific host cells based on codon optimization.

[0099] The term "hot start" as used herein generally refers to a means of limiting the availability of essential reaction components (e.g., polymerase) when the reaction mixture is maintained at a first temperature (usually a lower temperature) until a second temperature (usually a higher temperature) is reached to allow the essential components to participate in the reaction (e.g., extension, exonuclease, and / or amplification reaction). A hot start reaction generally involves incubation at a first (e.g., lower) temperature, and then rising to a second (e.g., higher) temperature that allows the desired reaction to proceed. Activation of a hot start reaction can be achieved by incubating the reaction mixture at a temperature equal to or higher than the primer hybridization (annealing) temperature. Using a temperature equal to or higher than the primer hybridization temperature can ensure primer binding specificity. A hot start can be achieved by adding a thermolabile molecular entity to bind to the DNA polymerase to increase the temperature at which the DNA polymerase initiates polymerization or a proofreading reaction.

[0100] The term "blocking" as used herein includes using a molecule that is not resistant to special conditions (such as high temperature, high pH, ​​high ion concentration, etc.) to specifically bind to the enzyme under general conditions (such as lower temperature or room temperature), so that the enzyme is completely or partially unable to exert its activity. In some embodiments, the blocking includes using the antibody or antigen-binding fragment thereof described in the present disclosure to specifically bind to a DNA polymerase (such as KOFU), so that it is completely unable to exert polymerization and exotomy activities under low temperature or room temperature conditions.

[0101] The term "activation" as used herein includes the separation of molecules from enzymes under special conditions (e.g., high temperature, high pH, ​​high ion concentration, etc.), so that the enzyme is released and can be active. In some embodiments, the activation includes inactivating the antibody or antigen-binding fragment thereof described in the present disclosure from DNA polymerase (e.g., KOFU) at high temperature, so that the latter recovers polymerase and exonuclease activity.

[0102] The term "polyacrylamide gel electrophoresis (PAGE)" used in this article refers to a common electrophoresis technique using polyacrylamide gel as a supporting medium. PAGE includes native-PAGE and denaturing polyacrylamide gel electrophoresis (protein denaturant is usually SDS, nucleic acid denaturant is usually urea, formamide, etc.). During the Native-PAGE process, proteins can remain intact and gradually separate in a gradient according to molecular weight, shape and the amount of charge attached to them. SDS-PAGE can separate proteins only based on the difference in molecular weight of protein subunits.

[0103] Among them, SDS (sodium dodecyl sulfate) is an anionic surfactant. As a denaturant and solubilizing agent, it can break the hydrogen bonds within and between molecules, causing the molecules to unfold, thereby destroying the secondary and tertiary structures between protein molecules. Strong reducing agents such as β-mercaptoethanol and dithiothreitol (DTT) can break the disulfide bonds between cysteine ​​residues. After adding reducing agents and SDS to the sample and gel, the molecules are depolymerized into polypeptide chains. The depolymerized amino acid side chains and SDS combine to form protein-SDS micelles, and the negative charge carried greatly exceeds the original charge of the protein, thus eliminating the charge differences and structural differences between different molecules.

[0104] The term "isolated" as used herein refers to a state obtained from a natural state by artificial means. If a certain "isolated" substance or component exists naturally, it may be because its natural environment has changed, or the substance has been separated from the natural environment, or both. For example, a certain unisolated polynucleotide or polypeptide exists naturally in a living organism, and the same polynucleotide or polypeptide with high purity separated from the natural state is called an isolated polynucleotide or polypeptide. The term "isolated" neither excludes mixed artificial or synthetic substances, nor excludes other impure substances that do not affect the activity of the isolated substance. For example, an isolated antibody may be substantially free of other cellular materials and / or chemicals.

[0105] As used herein, the term "nucleic acid molecule" refers to any one or more nucleic acid segments, such as DNA or RNA fragments, present in a polynucleotide.

[0106] The term "vector" as used herein refers to a nucleic acid vector into which a polynucleotide can be inserted. When a vector allows the expression of a protein encoded by a polynucleotide inserted therein, the vector is called an expression vector. The vector can be transformed, transduced or transfected into a host cell to express the genetic material elements carried in the host cell. Vectors are well known to those skilled in the art, and include but are not limited to plasmids, bacteriophages, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC); bacteriophages such as lambda phage or M13 phage and animal viruses. Animal viruses that can be used as vectors include but are not limited to retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papovaviruses (such as SV40). The vector may contain multiple elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector may contain an origin of replication. As for the vector for expressing the antibody, a vector type in which the antibody heavy chain and light chain exist in different vectors or a vector type in which the heavy chain and light chain exist in the same vector can be used.

[0107] The term "host cell" as used herein is used interchangeably and refers to a cell into which an exogenous nucleic acid has been introduced, and also includes the offspring of such cells. Host cells include "transformants / transformants" and "transformed cells", including primary transformed cells and offspring derived therefrom. The nucleic acid of the offspring may not be completely identical to the parent cell and may contain mutations. Host cells include cultured cells, for example cultured mammalian cells, such as CHO cells, 293 cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, yeast cells, insect cells and plant cells. Host cells of the present disclosure also include cells contained in transgenic animals, transgenic plants or cultured plants or animal tissues.

[0108] As used herein, the term "hybridoma" and the term "hybridoma cell line" are used interchangeably. When referring to the term "hybridoma" and the term "hybridoma cell line", they also include subclones and progeny cells of the hybridoma.

[0109] As used herein, the term "kit" refers to any delivery system for delivering materials, including kits for research and clinical applications.

[0110] In order to make the purpose, technical scheme and advantages of the present disclosure clearer, the present disclosure is further described in detail in conjunction with the following examples. The specific embodiments described herein are only used to explain the present disclosure and are not intended to constitute any limitation to the present disclosure. The actual scope of protection of the present disclosure is set forth in the claims. In the following description, descriptions of well-known structures and technologies are omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications. The equipment, instruments, reagents and / or kits used in the following examples are not mentioned in terms of their sources, and are all commercially available on the market or obtained by conventional methods known to those skilled in the art.

[0111] Example

[0112] Example 1: KOFU antigen preparation

[0113] Codon optimization: The amino acid sequence of SEQ ID NO: 3 was codon optimized to obtain a DNA sequence of KOFU (SEQ ID NO: 4) synthesized by Bio-Industry, which encodes the KOFU enzyme having the amino acid sequence shown in SEQ ID NO: 3. The synthesized DNA sequence was cloned into the expression vector pET28a.

[0114] KOFU expression: The pET28a expression vector containing the KOFU target gene was transformed into the Escherichia coli BL21 (DE3) strain. In the clean bench, a single colony was picked and inoculated into 1 mL of LB (K+) medium, and cultured at 37°C overnight with shaking. In the clean bench, the KOFU DNA polymerase / pET28a BL21 (DE3) expression strain activated overnight was inoculated into 10 mL of LB (K+) medium at a 2% inoculation amount, and cultured at 37°C with shaking for 4 hours until the bacterial logarithmic growth phase. After 4 hours, all 10 mL of the expression strain was transferred to 1 L of LB (K+) medium and cultured at 37°C with shaking. After the expression bacteria were cultured for about 3 hours, when the bacteria were cultured to an OD600 of about 0.8, isopropyl-β-D-thiogalactoside (IPTG) was added to the 1 L fermentation broth to a final concentration of 0.5 mM, and cultured at 25°C with shaking overnight (16h~18h).

[0115] Purification: Collect bacterial sludge by centrifugation, resuspend bacterial sludge with lysis solution, ultrasonically disrupt at 350W, 2s / 3s, 30min; heat treat disrupted bacterial solution at 80℃ for 30min; centrifuge at 4℃, 11000r / min for 20min to collect supernatant; filter and collect supernatant with 0.45μm filter and place on ice for later use. Purify KOFU DNA polymerase using Ni column (Huiyan Bio, HQ060313001L) and ion exchange column (Tian Di Ren He, SI035C15) on AKTA purification system. The eluted protein was finally dialyzed into PBS.

[0116] SDS-PAGE: Run SDS-PAGE on the dialyzed protein. The SDS-PAGE results are as follows: Figure 1 As shown, the purity is >95%, and it can be used as an antigen to immunize mice.

[0117] Example 2: Mouse immunization and serum titer detection

[0118] Purified KOFU DNA polymerase was used as the immunogen and five Balb / c mice were immunized by conventional immunization method, once every two weeks, for a total of three times.

[0119] Blood was collected one week after the third immunization, and the serum titer was tested by enzyme-linked immunosorbent assay (ELISA). In the ELISA test, 5 μg / mL KOFU DNA polymerase was used to coat the plate, and the serum was diluted with PBS. The serum dilution multiples were 8000 and 16000. 100 μL of diluted serum was added to each well of the ELISA plate for detection. The criterion for qualified titer: after the serum was diluted 16000 times, (OD450-blank) ≥ 1.0, where OD450-blank refers to the OD450 value of the mouse serum before immunization.

[0120] Table 3 shows the results of ELISA test on the titer of immunized mouse serum, and it can be seen that the titers of mice C and B are the best.

[0121] Table 3 ELISA test results of immune mouse serum titer

[0122]

[0123] Example 3: Functional detection of mouse serum polymerization activity

[0124] 1) Substrate annealing: According to the system shown in Table 4, primer POL-MB-primer (5'-TCTGGGTCATCTTCTC GCGG-3', SEQ ID NO: 5) and probe POL-MB (5'FAM-CACCCTGAAGTACCATCGAGCAC GGCATATGAGCTGCGCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAGACTC GATGGTACTTCAGGGTG-3'Dabcyl, SEQ ID NO: 6) were mixed, and the final concentration of POL-MB after mixing was 2.5 μM. The sample was heated at 95° C. for 10 min in a gold water bath and then the instrument was turned off. The sample was naturally cooled to room temperature in the gold water bath (generally cooled overnight) to complete annealing. The annealing product was used as the test substrate.

[0125] Table 4 Configuration of substrate annealing system for polymerization activity detection

[0126] Reagents Volume (μL) 10uMPOL-MB 125 100uMPOL-MB-primer 25 Tris-HCl (pH 7.4) 350

[0127] 2) Functional test of immune mouse serum blocking KOFU polymerization activity, the reaction system was configured according to Table 5.

[0128] Table 5 Mouse serum blocking KOFU polymerization activity reaction system

[0129]

[0130]

[0131] Mouse serum and polymerase were pre-mixed and incubated at 37°C for 30 min.

[0132] Reaction program: 37°C, 10 s; 37°C, 1 min (60 cycles, and fluorescence collection); 4°C, 1 min 20 s.

[0133] like Figure 2 The changes in the fluorescence curve during the reaction process show that the sera of the five immune mice have the best blocking effect on KOFU polymerization activity in mice B and E, followed by mouse C.

[0134] Example 4: Mouse serum exosome activity functional assay

[0135] 1) Substrate annealing: According to the system shown in Table 6, primer EXO-F (ATCAGCAGGCCACACGTTAAACT GT-3`BHQ2, SEQ ID NO: 7) and primer EXO-R (5`ROX-TGTCTTTAACGTGTGGCCTGCTGA T, SEQ ID NO: 8) were mixed at a ratio of 1:1, and the final concentration of the primers after mixing was 2.5 μM. The sample was heated at 95°C in a gold water bath for 10 minutes and then the instrument was turned off. The sample was naturally cooled to room temperature in the gold water bath (generally naturally cooled overnight) to complete annealing. The annealing product was used as a test substrate.

[0136] Table 6 Exo-activity detection substrate annealing system configuration

[0137] Reagents Volume (μL) 10uMEXO-F 125 10uMEXO-R 125 Tris-HCl (pH 7.4) 250

[0138] 2) Functional test of immune mouse serum blocking KOFU exo-activation, the reaction system was configured according to Table 7.

[0139] Table 7 Mouse serum blocking KOFU exo-activity reaction system

[0140]

[0141] Mouse serum and polymerase were pre-mixed and incubated at 37°C for 30 min.

[0142] Reaction program: 37°C, 10 s; 37°C, 1 min (60 cycles, and fluorescence collection); 4°C, 1 min 20 s.

[0143] According to the changes in the fluorescence curve during the reaction, the sera of the five immune mice had the best blocking effect on KOFU polymerization activity in mice B and E, followed by mice C ( Figure 3 ).

[0144] According to Examples 2 to 4, the results of serum titer and functional testing were comprehensively analyzed, and mice C and E were selected for the next fusion experiment.

[0145] Example 5: Cell fusion and primary clone screening

[0146] 1) Preparation before cell fusion:

[0147] Preparation of spleen lymphocytes: The mice were sacrificed by taking blood from their eyeballs, and the spleens of mice C and E were taken, which contained mouse B lymphocytes. The surface fat was cut off, and the spleens were homogenized and passed through a cell sieve. The spleen cells were washed and resuspended in 1640 incomplete medium (thermo) and counted. Blank Balb / c mice were used to prepare feeder cells.

[0148] Preparation of SP20 myeloma cells: Cryopreserved mouse myeloma cells SP2 / 0 need to grow for 2 weeks after thawing to be in a state suitable for fusion. Before fusion, the cells are cultured to the logarithmic phase, resuspended in 1640 incomplete medium and counted.

[0149] 2) Cell fusion: The above mouse myeloma cells SP2 / 0 and spleen cells were mixed at a cell number ratio of 1:1 and fused by electrofusion. All cells were plated in 96-well plates for liquid culture, 100 μL / well (feeder cells were already plated in advance), and 30 plates were plated for each mouse.

[0150] 3) ELISA method to determine the antibody titer in the cell well culture supernatant: 1 μg / ml antigen was coated on the ELISA plate, 100 μL of hybridoma cell culture supernatant was added to each well, and the first 125 OD 450 - Supernatants from positive wells with blank values ​​≥1.0 or ≈1.0 need to be subjected to functional testing (Table 8).

[0151] Table 8 ELISA test results of the supernatant of the main clone culture that needs to be tested for function

[0152]

[0153]

[0154] 4) The culture supernatants of the top 125 clones screened by ELISA were subjected to KOFU polymerization activity blocking experiment screening, and the reaction system was configured according to Table 9.

[0155] Table 9 Cell supernatant blocking KOFU polymerization activity reaction system

[0156]

[0157] The cell culture supernatant and polymerase were premixed and incubated at 37°C for 30 min. Two or three replicates were set.

[0158] Reaction program: 37°C, 10 s; 37°C, 1 min (60 cycles, and fluorescence collection); 4°C, 1 min 20 s.

[0159] The culture supernatants of the top 125 bead clones screened by ELISA were subjected to KOFU exo-activity blocking experiment screening, and the reaction system was configured according to Table 10.

[0160] Table 10 Cell supernatant blocking KOFU exo-activity reaction system

[0161]

[0162] The cell culture supernatant and polymerase were mixed in advance and incubated at 37°C for 30 min. Two or three replicates were set.

[0163] Reaction program: 37°C, 10 s; 37°C, 30 s (100 cycles, and fluorescence collection); 4°C, 1 min 20 s.

[0164] According to the results of the blocking experiment, the functional test results of 30 main clones, including 1-E7, 10-C3, 11-F1, 13-H6, 13-C10, 13-H11, 14-B2, 14-C7, 15-D3, 16-A3, 16-C5, 17-A2, 18-C2, 18-F6, 19-H7, 1-A4, 1-C1, 1-E6, 20-B8, 21-F1, 21-H8, 22-A2, 2-E3, 2-E7, 30-A3, 3-B11, 6-A9, 7-A2, 8-F1, and 8-H6, were better, and the next subcloning experiment was carried out.

[0165] Example 6: Subcloning of hybridoma cells

[0166] 1) First subcloning

[0167] The 30 selected positive cells were diluted to an average of 0.8 cells per well by limiting dilution method and divided into 96-well plates containing feeder cells. Each positive cell was diluted and divided into 48 wells. After culturing for about 5 days, the wells containing cells were observed and the supernatant antibody ELISA test was performed according to step 3) in Example 5. Part of the first subclone culture supernatant was selected for KOFU polymerization activity and exo-activity blocking function test (specific operation is the same as Example 5). The main selection principles are: monoclonal, ELISA OD 450 -Blank ≥ 1.0, a maximum of 5 subclones of each main clone were selected. Table 11 shows the ELISA test results of the supernatant of the first clone (subclone 1) that needed to be functionally tested according to the selection principle.

[0168] Table 11: Results of sub-supernatant ELISA test requiring blocking function test

[0169]

[0170]

[0171] The supernatants of all the cell lines in the above table were tested for KOFU polymerization activity and exo-activity blocking function (test method refers to Example 5). According to the test results, A10, G9, H10, F1, D1, H12, G7, H10, and A6 (a maximum of 2 subclones corresponding to each main clone were selected) had good blocking effects on KOFU polymerization and exo-activity. These 9 cell lines were subjected to a second subcloning (second subcloning).

[0172] 2) Second subcloning:

[0173] The selected 9 strains were subjected to one round of limiting dilution to obtain stable monoclones. The diluted monoclones were tested by ELISA according to step 3) in Example 5. The results of ELISA are shown in Table 12. The KOFU polymerization activity and exo-activity function of the culture supernatant of the second subclone cells were verified according to the primers, reagents and reaction procedures of step 4) in Example 5. The results are shown in Table 12. Figure 4 and Figure 5 .

[0174] Table 12 ELISA test results of the second subclone culture supernatant

[0175]

[0176] Figure 4 and Figure 5 The comparison results showed that the functional detection results of SM06 and SM08 in the second subclone were better, so SM06 and SM08 were selected for the next experiment.

[0177] Example 7: Cultivation of hybridoma cells SM06 and SM08 and antibody production

[0178] Although the culture supernatants of SM06 and SM08 in Example 6 performed well in the functional verification, due to the complex composition of the cell culture supernatant, other components in the cell supernatant may affect the interaction between the monoclonal antibody and KOFU polymerase, so the antibodies in the supernatant need to be purified for confirmation.

[0179] 1) Hybridoma cell culture: Culture according to conventional semi-adherent cell culture.

[0180] Cryopreservation medium: 1604 basic medium + 50% FBS + 10% DMSO. Cryopreservation cell density: 1×10 6 Pieces / mL.

[0181] Hybridoma culture medium: 1604 minimal medium + 10% FBS.

[0182] Cell passaging: Generally, normal passaging can be resumed after 2-3 generations of recovery. Hybridoma cells are semi-adherent cells. When the cells cover more than 80% of the bottom area of ​​the bottle under the microscope, cell passaging can be arranged. Tap the bottom of the bottle gently. After observing that most of the cells are in a suspended state under the microscope, blow and mix the cells for passaging (generally 1:2 or 1:3 passaging). After passaging, the cells should cover about 20%-30% of the bottom area of ​​the bottle. Generally, passaging can be arranged every 2-3 days.

[0183] 2) Antibody purification:

[0184] When producing antibodies, cells need to be cultured for 3-5 days, and the cells cannot be reused after producing antibodies.

[0185] Collect the culture supernatant and centrifuge at 3000-5000g for 20-30min. Filter the supernatant with a 0.45μM filter. Purify the antibody using the AKTA purification system and a ProteinA column. Immediately neutralize the eluted protein with 0.1x 1M Tris-HCl (pH 8.0). Finally, concentrate the antibody with a 30kD concentrator and replace the solution with PBS. The finished antibody was subjected to native-PAGE and SDS-PAGE electrophoresis.

[0186] Figure 6 and Figure 7 The Native-PAGE and SDS-PAGE analysis diagrams of the purified hybridoma cell monoclonal antibodies SM06 and SM08 are shown. It can be seen that the size of the SM06 and SM08 antibodies as a whole, the heavy chain and the light chain are in line with expectations, and the purity is more than 90%.

[0187] Example 8: Functional verification of SM06 and SM08 antibodies

[0188] In addition to testing the blocking effect of the antibody on the polymerization and exolysis of KOFU DNA polymerase, it is also necessary to test the hot start effect of the antibody after heating at 98°C for 45s.

[0189] 1) Functional test of antibody blocking KOFU polymerization activity: The reaction system was configured according to Table 13, and the blocking effect after incubation with different antibody input amounts (0.4 μg to 12 μg) and 1 U KOFU was tested.

[0190] Table 13 Antibody blocking KOFU polymerization activity reaction system

[0191]

[0192] The volume of “χ” is calculated based on the antibody concentration and input amount; the antibody and polymerase are mixed in advance and incubated at 37°C for 30 min. Set 2 or 3 replicates.

[0193] Reaction procedure: 37°C, 10s; 37°C, 1min (40 cycles, and collect fluorescence, the results are as follows Figure 8 ); 98°C, 45s; 37°C, 1min (40 cycles, and fluorescence was collected, the results are shown Fig. 9 as shown), 1min 20s.

[0194] Figure 8 The results showed that SM06 and SM08 monoclonal antibodies respectively neutralized the polymerization activity of KOFU DNA polymerase. It can be seen that 0.4μg SM06 antibody has a better blocking effect on polymerization activity than 12μg SM08 antibody, and 0.8μg SM06 antibody can achieve 95% polymerization activity blocking effect. Fig. 9 The results of the experimental group showed that after hot start at 98°C for 45s, the polymerization activity of KOFU DNA polymerase was well restored ( Fig. 9 ).

[0195] 2) Functional test of SM06 antibody blocking KOFU exo-activation: Prepare the reaction system according to Table 14

[0196] Table 14 Antibody blocking KOFU exo-activity reaction system

[0197]

[0198] The volume of “χ” is calculated based on the antibody concentration and input amount; the antibody and polymerase are mixed in advance and incubated at 37°C for 30 min. Set 2 or 3 replicates.

[0199] Reaction program: 37°C, 10s; 37°C, 30s (80 cycles, and collect fluorescence, the results are as follows Fig.10); 98°C, 45s; 37°C, 30s (80 cycles, and fluorescence was collected, the results are shown Fig.11 as shown), 1min 20s.

[0200] Fig.10 This is a diagram showing the effect of hybridoma cell SM06 monoclonal antibody neutralizing the exo-activity of KOFU DNA polymerase. Similarly, 0.8 μg of SM06 antibody can achieve a 96% exo-activity blocking effect, and after a hot start at 98°C for 45 seconds, the exo-activity of KOFU DNA polymerase was well restored ( Fig.11 ).

[0201] In summary, SM06 performed best in functional verification and was the hybridoma cell finally screened.

[0202] Example 9: Antibody Sequencing of Hybridoma Cell SM06

[0203] The heavy and light chains of the hybridoma cell SM06 monoclonal antibody were subtyped and sequenced.

[0204] The reverse transcription and PCR primers for the heavy chain were designed for the heavy chain constant regions of the four mouse antibody subtypes (IgG1, IgG2a, IgG2b, and IgG3), and the reverse transcription and PCR primers for the light chain were designed for the constant regions of the two mouse light chain types (kappa and lambda), as shown in Table 15.

[0205] Table 15 Primers used in this example

[0206]

[0207] In Table 15, " / rG / " represents a guanine nucleotide; / rG / / rG / / rG / represents an RNA sequence consisting of three guanine nucleotides.

[0208] References for TSO RT and ISPCR in Table 15: Meyer L, et al..A simplified workflow for monoclonal antibody sequencing. PLoS One. 2019 Jun 24; 14(6)).

[0209] SM06 cells were cultured and 1×10 6 TRizol reagent (Thermo Fisher, 15596018CN) was used to extract RNA from living cells.

[0210] Reverse transcription:

[0211] Prepare the premixed reaction system shown in Table 16:

[0212] Table 16. Premixed reaction system

[0213] Components quantity Total RNA 200ng Reverse RT primer (10 μM) 2μL 10mM dNTP 1μL <![CDATA[Nuclease-freeH2O]]> Make up to 10 μL

[0214] 65℃, 5min; immediately put on ice;

[0215] After the temperature stabilizes, separate instantly and prepare the system shown in Table 17:

[0216] Table 17. Reverse transcription reaction system

[0217] Components Volume (μL) 5×RTBuffer 4 Template-switch oligo (100 μM) 0.6 MaximaHMinusReverseTranscriptase(Thermofisher) 0.5 RNaseInhibitor(YEASEN,10603ES10) 0.5 <![CDATA[Nuclease-freeH2O]]> 4.4 Denatured product from the previous step 10 Total volume 20

[0218] 50℃, 30min; 85℃, 5min; 4℃, maintain.

[0219] PCR, the reaction system is shown in Table 18:

[0220] Table 18. PCR reaction system

[0221] Element Volume (μL) 2×KOFUmix 25 RT product cDNA 3 10 μM ISPCR 2.5 10 μM reverse primer 2.5 <![CDATA[Nuclease-freeH2O]]> 17 Total volume 50

[0222] The reaction procedure is shown in Table 19:

[0223] Table 19. Reaction schedule

[0224]

[0225]

[0226] The above PCR products were recovered by 1% agarose gel electrophoresis and pMD TM TA cloning was performed using 18-T Vector Cloning Kit (TAKARA), and 5 single colonies of each heavy and light chain were picked for bacterial culture and sequencing.

[0227] The determined sequences (consistency of at least 3 colonies) were aligned using IgBLAST and / or IMGT / V-QUEST to delineate the framework region (FR) and CDR of the antibody gene.

[0228] The obtained sequence was codon-optimized for the 293 expression system and sent to Bioengineering for gene synthesis (pCDNA3.4 expression plasmid delivery), expressed by the Expi293F expression system, purified by Protein A, and finally the antibody was functionally verified to determine the validity of the test sequence.

[0229] Subtype identification results Fig.12 The RT-PCR agarose gel electrophoresis diagram shown shows that the SM06 monoclonal antibody is IgG1 and the light chain is a κ chain.

[0230] The sequencing results showed that the nucleic acid sequences of the heavy chain and light chain variable regions were shown in SEQ ID NO:9 and SEQ ID NO:10, respectively, and the amino acid sequences were shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0231] The technical solution of the present disclosure is not limited to the above-mentioned specific embodiments, and all technical variations made according to the technical solution of the present disclosure fall within the protection scope of the present disclosure.

Claims

1. An anti-KOFU DNA polymerase antibody or an antigen-binding fragment thereof, the antibody or the antigen-binding fragment thereof comprising: (1) the following three heavy chain variable region complementarity determining regions (HCDRs): HCDR1 having the amino acid sequence of HCDR1 contained in the heavy chain variable region as shown in SEQ ID NO: 1, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR1 contained in the heavy chain variable region; HCDR2 having the amino acid sequence of HCDR2 contained in the heavy chain variable region as shown in SEQ ID NO: 1, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR2 contained in the heavy chain variable region; HCDR3 having the amino acid sequence of HCDR3 contained in the heavy chain variable region as shown in SEQ ID NO: 1, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR3 contained in the heavy chain variable region; and / or (2) the following three light chain variable region complementarity determining regions (LCDR): LCDR1 having the amino acid sequence of LCDR1 contained in the light chain variable region as shown in SEQ ID NO: 2, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR1 contained in the light chain variable region; LCDR2 having the amino acid sequence of LCDR2 contained in the light chain variable region as shown in SEQ ID NO: 2, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR2 contained in the light chain variable region; LCDR3 has the amino acid sequence of LCDR3 contained in the light chain variable region as shown in SEQ ID NO: 2, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR3 contained in the light chain variable region.

2. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2 and HCDR3 contained in the heavy chain variable region as shown in SEQ ID NO: 1, and LCDR1, LCDR2 and LCDR3 contained in the light chain variable region as shown in SEQ ID NO: 2; Preferably, the HCDR1-3 and / or the LCDR1-3 are defined by the IMGT numbering system, the Kabat numbering system, the Chothia numbering system, the Contact numbering system or a combination thereof; Preferably, the antibody or antigen-binding fragment thereof comprises: (1) the following heavy chain variable region and / or light chain variable region, wherein HCDR1-3 and / or LCDR1-3 are defined according to the IMGT numbering system: a heavy chain variable region comprising the following three HCDRs: HCDR1 with a sequence of SEQ ID NO: 11, HCDR2 with a sequence of SEQ ID NO: 12, and HCDR3 with a sequence of SEQ ID NO: 13; and / or, a light chain variable region comprising the following three LCDRs: LCDR1 with a sequence of SEQ ID NO: 14, LCDR2 with a sequence of AAS, and LCDR3 with a sequence of SEQ ID NO: 15; or (2) the following heavy chain variable region and / or light chain variable region, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Kabat numbering system: a heavy chain variable region comprising the following three HCDRs: HCDR1 with a sequence of SEQ ID NO: 16, HCDR2 with a sequence of SEQ ID NO: 17, and HCDR3 with a sequence of SEQ ID NO: 18; and / or, a light chain variable region comprising the following three LCDRs: LCDR1 with a sequence of SEQ ID NO: 19, LCDR2 with a sequence of SEQ ID NO: 20, and LCDR3 with a sequence of SEQ ID NO: 15; or (3) the following heavy chain variable region and / or light chain variable region, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Chothia numbering system: a heavy chain variable region comprising the following three HCDRs: HCDR1 with a sequence of SEQ ID NO:21, HCDR2 with a sequence of SEQ ID NO:22, and HCDR3 with a sequence of SEQ ID NO:18; and / or, a light chain variable region comprising the following three LCDRs: LCDR1 with a sequence of SEQ ID NO:19, LCDR2 with a sequence of SEQ ID NO:20, and LCDR3 with a sequence of SEQ ID NO:15; or (4) the following heavy chain variable region and / or light chain variable region, wherein HCDR1-3 and / or LCDR1-3 are defined according to the Contact numbering system: a heavy chain variable region comprising the following three HCDRs: HCDR1 with a sequence of SEQ ID NO:23, HCDR2 with a sequence of SEQ ID NO:24, and HCDR3 with a sequence of SEQ ID NO:25; and / or, a light chain variable region comprising the following three LCDRs: LCDR1 with a sequence of SEQ ID NO:26, LCDR2 with a sequence of SEQ ID NO:27, and LCDR3 with a sequence of SEQ ID NO:

28.

3. The antibody or antigen-binding fragment thereof according to claim 1 or 2, characterized in that: The antibody or antigen-binding fragment thereof comprises: A heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 1, an amino acid sequence having one or more amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto; and A light chain variable region having an amino acid sequence as shown in SEQ ID NO: 2, an amino acid sequence having one or more amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto; Preferably, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having the amino acid sequence shown in SEQ ID NO: 2; Preferably, the antibody or antigen-binding fragment thereof comprises an antibody Fab fragment, a Fab' fragment, a F(ab')2 fragment, a Fv fragment, a scFv fragment, a nanobody, a heavy chain variable region VH fragment or a light chain variable region VL fragment; Preferably, the antibody or antigen-binding fragment thereof is derived from IgG, IgA, IgM, IgD or IgE, Preferably, in the antibody or antigen-binding fragment thereof, the heavy chain is derived from any one of IgG1, IgG2a, IgG2b, IgG3 or IgG4, and / or the light chain is derived from any one of a kappa light chain and a lambda light chain.

4. An isolated nucleic acid molecule encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3.

5. An expression cassette comprising the isolated nucleic acid molecule of claim 4. An expression vector comprising the isolated nucleic acid molecule of claim 4 .

7. A host cell comprising the isolated nucleic acid molecule of claim 4, the expression cassette of claim 5 or the expression vector of claim 6; Preferably, the host cell comprises a eukaryotic or prokaryotic cell; Preferably, the prokaryotic cell comprises a bacterium; Preferably, the bacteria comprises Escherichia coli; Preferably, the eukaryotic cell comprises yeast, insect, plant, mammalian cell or hybridoma cell; Preferably, the hybridoma cell is obtained by fusion of myeloma cells and B lymphocytes.

8. A complex comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3 and KOFU DNA polymerase; Preferably, the KOFU DNA polymerase has an amino acid sequence as shown in SEQ ID NO: 3, or an amino acid sequence having one or more amino acids substituted, deleted or added thereto.

9. A kit comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, and KOFU DNA polymerase.

10. A method for amplifying DNA, the method comprising: A step of amplifying using the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3 and KOFU DNA polymerase; or The step of amplifying using the complex according to claim 8.

11. A conjugate comprising: the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3; and a conjugated moiety; Preferably, the coupling moiety is selected from detectable labels.

12. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 3 in blocking KOFU DNA polymerase or amplifying DNA.

Images