Aspergillus oryzae and its use
By using Aspergillus oryzae to prepare soy sauce koji, the problem of insufficient microbial fermentation in the brewing of soy sauce from meal-based raw materials in the existing technology has been solved, thereby improving the amino acid content and flavor of soy sauce.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-25
- Publication Date
- 2026-03-03
AI Technical Summary
In existing technologies, research on brewing soy sauce using meal raw materials such as peanut meal, flaxseed meal, and rapeseed meal mainly focuses on optimizing the pre-processing of raw materials, and lacks research on relying solely on natural microbial fermentation.
A strain of Aspergillus oryzae (CGMCC No. 41729) was provided for the preparation of soy sauce koji. By mixing it with koji material and culturing it in conjunction with the fermentation process, the amino acid content and flavor of the soy sauce were improved.
Aspergillus oryzae can produce a variety of enzymes, improve the utilization rate of raw materials, enhance the flavor and amino acid content of soy sauce, and optimize the brewing effect of soy sauce.
Smart Images

Figure CN119979343B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbiology, and more specifically to Aspergillus oryzae and its applications. Background Technology
[0002] Soy sauce, as one of the core condiments on people's dining tables, ranks among the top in consumption among various condiments. The soy sauce market has maintained a certain growth trend in recent years. According to my country's national standards for soy sauce brewing (GB / T 18186-2000 and SB / T 10173-1993), the production process of soy sauce can be clearly divided into two categories: low-salt solid-state brewing and high-salt dilute-state brewing. Both methods mainly use soybeans or soybean meal as the core raw material, supplemented with flour, wheat, bran, and other materials. After careful steaming and cooking, the mixture is fermented using various microorganisms such as Aspergillus oryzae, yeast, and lactic acid bacteria.
[0003] Besides traditional soybeans, protein sources for brewing soy sauce also widely include broad beans, peas, soybean meal, peanut meal, sunflower seed meal, rapeseed meal, sesame meal, coconut meal, and sugar lees, among other plant-based materials. Peanut meal, a byproduct of peanut oil extraction, boasts a protein content of nearly 50%, with a rich variety and balanced amino acid profile. Only methionine (Met) content is slightly low; the content of other amino acids is close to or meets the standards of the Food and Agriculture Organization of the United Nations (FAO). Peanut meal protein is rich in acidic, hydrophobic, and aromatic amino acids. It also contains various minerals, flavonoids, tannins, phenolic compounds, and triterpenoids or steroidal active substances. These characteristics make peanut meal an ideal raw material for brewing high-quality soy sauce. CN202310030142.1 discloses a method for preparing peanut meal soy sauce and its application, employing steam explosion technology for pretreatment of peanut meal to increase protein extraction rate, improve the total nitrogen utilization rate of peanut protein, and enhance the antioxidant activity of the soy sauce. There are few existing technologies for brewing soy sauce using peanut meal, and the focus is mainly on optimizing the pre-processing of raw materials. Flaxseed meal contains 37% protein, which is a high-quality plant protein mainly composed of albumin and globulin; 8% fat; 0.95% α-linolenic acid; 1% linoleic acid; and 1.2% lignans. The linolenic acid it contains is higher than that of other commonly used vegetable oils. It is a precursor to ω-3 high unsaturated fatty acids, which the human body cannot synthesize but are essential for life activities. CN201910699444.1 discloses an improved method for brewing functional soy sauce and soybean paste from flaxseed meal. Employing extrusion puffing and enzymatic hydrolysis technology, it can produce functional flaxseed soy sauce with a delicious flavor and rich aroma. The product contains amino acid nitrogen ≥0.8g / 100ml, total nitrogen ≥1.5g / 100ml, active calcium ≥0.57g / 100ml, linolenic acid 0.08-0.13mg / 100g, lignans 0.2-0.28mg / 100g, and trace amounts of linoleic acid. However, this method also focuses on optimizing the pre-processing of raw materials. Rapeseed meal is one of the main byproducts after rapeseed oil extraction, and is divided into ordinary rapeseed meal and low-erucic acid rapeseed meal. Rapeseed meal contains various components such as rapeseed protein, rapeseed polyphenols, phytic acid, and rapeseed polysaccharides. These components all have high utilization value. Rapeseed meal is rich in sulfur-containing amino acids such as methionine, cysteine, and histidine, and is also rich in selenium and phosphorus. However, its protein content is relatively low, while its crude fiber content is high. It also contains some anti-nutritional substances such as glucosinolates, tannins, phytic acid, and sinapicin. It has been reported to use low-erucic acid rapeseed meal as material to extract oil via aqueous enzymatic extraction and fermentation to produce soy sauce. CN201210443981.8 discloses a method using compound microbial fermentation combined with enzyme preparations to treat rapeseed meal, resulting in higher protein content. Currently, research on soy sauce production solely through natural microbial fermentation of rapeseed meal is rarely reported. Summary of the Invention
[0004] The purpose of this invention is to overcome the problems existing in the prior art and to provide a strain of Aspergillus oryzae and its applications.
[0005] To achieve the above objectives, the first aspect of the present invention provides a strain of Aspergillus oryzae, the preservation number of which is CGMCC No.41729.
[0006] A second aspect of the present invention provides a composition for preparing soy sauce koji, the composition comprising Aspergillus oryzae and koji material as described above.
[0007] A third aspect of the present invention provides a method for preparing soy sauce koji, the method comprising: inoculating Aspergillus oryzae as described above into koji material for cultivation.
[0008] A fourth aspect of the present invention provides a method for brewing soy sauce, wherein the method includes: preparing soy sauce koji according to the aforementioned method; and mixing the soy sauce koji with brine for fermentation.
[0009] The fifth aspect of the present invention provides the use of Aspergillus oryzae as described above or the composition as described above in the preparation of seasonings.
[0010] Through the above technical solution, Aspergillus oryzae can produce high levels of protease, aminopeptidase, glutaminase, cellulase, amylase and pectinase. Applying Aspergillus oryzae to soy sauce brewing can improve the utilization rate of raw materials, increase the amino acid content in soy sauce, and enhance the flavor of soy sauce.
[0011] According to several preferred embodiments of the present invention, the koji material contains flaxseed cake, resulting in soy sauce koji with higher pectinase and saccharifying enzyme activities; the koji material contains rapeseed meal, resulting in soy sauce koji with higher saccharifying enzyme activities; the koji material contains peanut meal, resulting in soy sauce koji with higher protease and saccharifying enzyme activities. Accordingly, the koji material formulation can be selected as needed to obtain soy sauce koji with different enzyme activities.
[0012] Biological Preservation
[0013] The strain provided by this invention is classified and named Aspergillus oryzae. Aspergillus oryzae It was deposited on December 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41729 and address at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description
[0014] Figure 1 This invention describes the colony morphology of Aspergillus oryzae CCNH232 on malt extract culture medium.
[0015] Figure 2 The strain morphology of Aspergillus oryzae CCNH232 of this invention is shown under an optical microscope. Detailed Implementation
[0016] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0017] The first aspect of the present invention provides a strain of Aspergillus oryzae, the preservation number of which is CGMCC No.41729, and in this invention it is numbered CCNH232.
[0018] The *Aspergillus oryzae* strain described in this invention, after being cultured on malt extract medium for 72 hours, produced colonies that completely filled the dish. The colonies were light yellowish-green, round, with vigorous hyphae growth and a loose texture. Initially white or yellow, the mycelium later turned yellowish-brown to light greenish-brown. Figure 1 As shown. The conidia of *Aspergillus oryzae* are spherical or nearly spherical, yellowish-green, with a diameter of 4.5-7 μm, some reaching 8-10 μm. The conidiophores are about 2 mm long, with vesicles nearly spherical or flask-shaped (40-50 μm). The morphology of the *Aspergillus oryzae* strain described in this invention under an optical microscope is shown below. Figure 2 As shown.
[0019] A second aspect of the present invention provides a composition for preparing soy sauce koji, the composition comprising Aspergillus oryzae and koji material as described above.
[0020] According to the present invention, preferably, the content of Aspergillus oryzae is 0.5-1 wt% of the koji material, calculated as spore content.
[0021] Furthermore, the koji material is a mixture of meal raw materials, bran, and water.
[0022] A third aspect of the present invention provides a method for preparing soy sauce koji, the method comprising: inoculating Aspergillus oryzae as described above into koji material for cultivation.
[0023] According to the present invention, preferably, the cultivation conditions include: a cultivation temperature of 28-32°C, a cultivation environment humidity of 80-90%, and a cultivation time of 48-96 hours.
[0024] Furthermore, the cultivation conditions include: a cultivation temperature of 28-30℃, a cultivation environment humidity of 85-90%, and a cultivation time of 48-72h.
[0025] Furthermore, the koji material is a mixture of meal raw materials, bran, and water.
[0026] According to the present invention, preferably, the mass ratio of the meal raw material, water and bran is 2-4:1-3:1.
[0027] Furthermore, the mass ratio of the meal raw materials, water, and bran is 3-4:2-3:1.
[0028] According to the present invention, the oilseed meal can be a by-product remaining after the extraction of seed oils commonly used in the art. Preferably, the oilseed meal is at least one of flaxseed meal, rapeseed meal, and peanut meal.
[0029] A fourth aspect of the present invention provides a method for brewing soy sauce, wherein the method includes: preparing soy sauce koji according to the aforementioned method; and mixing the soy sauce koji with brine for fermentation.
[0030] According to the present invention, the mixing method of soy sauce koji and brine can refer to conventional mixing methods in the art, as long as the purpose of the present invention can be achieved.
[0031] According to the present invention, preferably, the mass ratio of the soy sauce starter to the brine is 1:1-2.
[0032] Furthermore, the mass ratio of the soy sauce starter to the brine is 1:1-1.5.
[0033] According to the present invention, preferably, the concentration of the brine is 10-17 wt%.
[0034] Furthermore, the concentration of the brine is 10-13 wt%.
[0035] According to the present invention, the brine refers to an aqueous solution of sodium chloride.
[0036] According to the present invention, preferably, the fermentation conditions include: a fermentation temperature of 40-50°C and a fermentation time of 15-25 days.
[0037] Furthermore, the fermentation conditions include: a fermentation temperature of 43-48℃ and a fermentation time of 18-22 days.
[0038] The fifth aspect of the present invention provides the use of Aspergillus oryzae as described above or the composition as described above in the preparation of seasonings.
[0039] According to the present invention, the condiments include, but are not limited to, soy sauce, soybean paste, fermented soybean paste, and fermented black beans.
[0040] According to the present invention, the preparation method of the seasoning can be a conventional method in the art, and those skilled in the art can choose according to their needs.
[0041] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention, and are not intended to limit the present invention.
[0042] Unless otherwise specified, all reagents and materials used in the following examples were purchased from reputable chemical reagent suppliers and were of analytical purity.
[0043] In the following embodiments:
[0044] The protease activity is defined as: 1 nmol of tyrosine produced per minute by 1 gram of soy sauce koji catalyzing the hydrolysis of casein is defined as 1 unit of enzyme activity. The protease hydrolyzes casein to produce tyrosine; tyrosine reduces phosphomolybdic acid to produce tungsten blue; tungsten blue has a characteristic absorption peak at 680 nm. The protease activity is obtained by measuring the rate of increase of absorbance at 680 nm under alkaline (pH=10.5), acidic (pH=3.0), and neutral (pH=7.5) conditions and summing the results.
[0045] Amylase activity is defined as the amount of enzyme required per minute per gram of soy sauce koji to catalyze the production of 1 mg of reducing sugar from α-1,4-glycosidic bonds in starch, under conditions of 4℃ and pH 5.2. The reducing sugar reduces 3,5-dinitrosalicylic acid to a brownish-red substance. α-Amylase is acid-sensitive, and β-amylase is heat-sensitive. Based on these characteristics, the activity of another type of amylase can be measured after inactivation at 70℃ for 15 min. Quantification is performed by measuring the absorbance at 540 nm using a microplate reader or visible light spectrophotometer, and using a standard curve method.
[0046] The activity of saccharifying enzyme is defined as the amount of enzyme required to break down soluble starch to produce 1 mg of glucose per minute, at 40℃ and pH 4.6. Saccharifying enzyme hydrolyzes soluble starch to produce glucose, which then reacts with 3,5-dinitrosalicylic acid to form a reddish-brown compound with maximum light absorption at 540 nm. Within a certain range, the color intensity of the reaction solution is directly proportional to the amount of glucose. Quantification is performed using a standard curve method.
[0047] Lipase activity is defined as follows: at 37℃ and pH 7.5, one unit of lipase activity is defined as the rate at which one gram of soy sauce koji hydrolyzes olive oil to produce 1 μmol of fatty acids per minute. Lipase catalyzes the hydrolysis of oil esters into fatty acids, and the rate of fatty acid production is determined using the copper soap method to calculate lipase activity.
[0048] Cellulase activity was defined as the amount of enzyme required to catalyze the production of 1 μg of reducing sugar from sodium carboxymethyl cellulose per minute, at 37℃ and pH 5.5. The content of reducing sugar produced by cellulase degradation of sodium carboxymethyl cellulose was determined using the anthrone colorimetric method. Absorbance at 620 nm was measured using an ELISA reader or visible light spectrophotometer, and quantification was performed using a standard curve method.
[0049] Glutaminase activity is defined as: one unit of enzyme activity is defined as the amount of glutamine produced from glutamate by 1 nmol of ammonia per minute, produced by 1 gram of soy sauce koji at 37℃ and pH 7.0. Glutaminase catalyzes the hydrolysis of glutamine to L-glutamate and ammonia, and the rate of ammonia increase is detected using Nessler's reagent. Absorbance at 420 nm is measured using an ELISA reader or a visible light spectrophotometer, and quantification is performed using a standard curve method.
[0050] Pectinase activity is defined as follows: at 50℃ and pH 3.5, one unit of pectinase activity is defined as the amount of galacturonic acid produced per hour by the decomposition of pectin by each gram of soy sauce koji. Pectinase hydrolyzes pectin to produce galacturonic acid, which has a reducing aldehyde group. This galacturonic acid reacts with DNS reagent to form a reddish-brown substance. The absorbance at 540 nm is measured using an ELISA reader or a visible light spectrophotometer, and quantification is performed using a standard curve method.
[0051] Tanninase activity was defined as the amount of enzyme required to hydrolyze 0.01 µmol of propyl gallate per minute per gram of soy sauce koji at 40℃ and pH 5.0. Propyl gallate, an antioxidant, was used as the substrate for the tanninase enzymatic reaction. The change in optical density before and after the reaction was measured at 270 nm, and quantification was performed using a standard curve method.
[0052] Aminopeptidase activity was determined using a double-antibody sandwich method. Purified aminopeptidase antibody was coated onto microplates to create a solid-phase antibody. Aminopeptidase was then added sequentially to the wells coated with the monoclonal antibody, followed by binding with HRP-labeled aminopeptidase antibody to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, the substrate TMB was added for color development. TMB was converted to blue under the catalysis of HRP, and then to yellow under acidic conditions. The color intensity was positively correlated with the aminopeptidase level in the sample. Absorbance was measured at 450 nm using a microplate reader, and the aminopeptidase activity in the sample was calculated using a standard curve.
[0053] The test methods for amino acid nitrogen and total nitrogen are based on GB / T 18186-2000.
[0054] The test methods for total acid and pH are in accordance with GB 12456-2021.
[0055] The test method for glutamic acid content is based on GB 5009.124-2016.
[0056] The culture medium formulations used in the following examples are as follows:
[0057] Malt extract culture medium: 20g malt powder, 10g peptone, 2g glucose, 1g dipotassium hydrogen phosphate, 5g sodium chloride, 1L distilled water.
[0058] PDA medium: 200g potato, 20g glucose, 15g agar, 1L distilled water.
[0059] The reference strain, Hu Niang 3.042 (Aspergillus oryzae), was purchased from the China National Research Institute of Food Fermentation Industries. The preservation number of this strain is CICC 2339.
[0060] Example 1
[0061] This embodiment is used to illustrate the screening and identification of Aspergillus oryzae CCNH232 described in this invention.
[0062] (1) Screening of strains: The Aspergillus oryzae described in this invention was isolated from the brewing process of Baijiu. The diluted solution of Daqu powder was spread on PDA solid medium by gradient dilution method and cultured at 30℃ for 5 days. After the colonies grew, colonies with phenotypic differences such as morphology, color and size were picked and streaked on the plate to obtain single colonies of multiple strains. A single strain was obtained by purification and numbered CCNH232.
[0063] (2) Morphological identification: After culturing in malt extract medium for 72 hours, the colonies filled the dish, were light yellowish-green, round, with vigorous hyphae growth, loose texture, initially white or yellow, later turning yellowish-brown to light greenish-brown, as shown in the image. Figure 1 As shown. The conidia of *Aspergillus oryzae* are spherical or nearly spherical, yellowish-green, with a diameter of 4.5-7 μm, some reaching 8-10 μm. The conidiophores are about 2 mm long, with apical sacs nearly spherical or flask-shaped (40-50 μm), such as... Figure 2 As shown.
[0064] (3) Molecular identification: The ITS sequence of the above single strain was sequenced, and its ITS sequence is shown in SEQ ID NO.1.
[0065] SEQ ID NO.1:
[0066] CCTTCCGGTAAGGTAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAGCCGGAAGA。
[0067] The β-tubulin gene sequence of the above single strain was sequenced, and its β-tubulin gene sequence is shown in SEQ ID NO.2.
[0068] SEQ ID NO.2:
[0069] .
[0070] The obtained ITS sequences were compared with the NCBI database. The strain CCNH232 showed the highest homology with Aspergillus oryzae (GenBank: MN010539.1), with a sequence identity of 99.98%.
[0071] The obtained β-tubulin sequence was compared with the NCBI database. The strain CCNH232 showed the highest homology with Aspergillus oryzae (GenBank: HQ285487.1), with a sequence identity of 100%.
[0072] Based on the above morphological and molecular identification results, strain CCNH232 was finally determined to belong to Aspergillus oryzae (Aspergillus oryzae). Aspergillus oryzae The Aspergillus oryzae CCNH232 was deposited with a depository institution, with accession number CGMCCNo.41729.
[0073] Example 2
[0074] This embodiment illustrates the preparation process of soy sauce koji and the enzyme activity in soy sauce koji.
[0075] (1) Crush the large block and cake-shaped meal raw materials (Table 1) to a particle size of 2 mm and a powder weight of 10 wt%. Mix the meal raw materials with wheat bran (mass ratio of 7:3) and add distilled water to achieve a moisture content of 45 wt%. Steam the obtained koji material at 120°C for 20 min and cool it to about 30°C for later use.
[0076] (2) The strain was purified and expanded using PDA medium. After culturing at 30℃ for 72 h, mature Aspergillus oryzae CCNH232 spores were collected. 0.06 wt% of the spores were inoculated into the koji material, and cultured in a constant temperature and humidity incubator at 30℃ and 90% humidity for 72 h in the dark to obtain Aspergillus oryzae CCNH232 soy sauce koji. Following the same method, spores of Hu Niang 3.042 were inoculated into the koji material to obtain Hu Niang 3.042 soy sauce koji as a reference. The enzyme activities of protease, aminopeptidase, amylase, saccharifying enzyme, lipase, glutaminase, cellulase, tanninase, and pectinase in the soy sauce koji were determined.
[0077] (3) The test results are shown in Table 1. The various indicators of Hu Niang 3.042 soy sauce koji are used as the standard and expressed as 1.00. The parameters of Aspergillus oryzae CCNH232 soy sauce koji are converted into corresponding ratios. The enzyme activities of protease, aminopeptidase, amylase, saccharifying enzyme, lipase, glutaminase, cellulase, tanninase and pectinase in Aspergillus oryzae CCNH232 soy sauce koji are significantly higher than those in Hu Niang 3.042 soy sauce koji, indicating that the comprehensive enzyme activity of Aspergillus oryzae CCNH232 is stronger.
[0078] Table 1
[0079]
[0080] Example 3
[0081] This example illustrates the application of Aspergillus oryzae CCNH232 in reduced-salt fermented soy sauce.
[0082] (1) Aspergillus oryzae CCNH232 and Hu Niang 3.042 (as a reference) were used to prepare koji according to the method in Example 2. The koji and 11wt% brine were mixed evenly at a mass ratio of 1:1.3 and fermented at 45℃ for 20 days to obtain soy sauce mash. During the fermentation, water was added and the mixture was stirred once every 48 hours to keep the moisture content of the soy sauce mash constant. After fermentation, 70wt% of the koji and 11wt% brine were added to the soy sauce mash, and the oil was extracted twice to obtain crude oil. The amino acid nitrogen, total acid, pH, total nitrogen and glutamic acid content in the crude oil were measured.
[0083] (2) The crude amino acid nitrogen content of peanut meal soy sauce prepared by Aspergillus oryzae CCNH232 as a fermentation strain reached 0.80 g / 100 mL and the total nitrogen content reached 1.64 g / 100 mL; the crude amino acid nitrogen content of rapeseed meal soy sauce reached 0.78 g / 100 mL and the total nitrogen content reached 1.44 g / 100 mL; the crude amino acid nitrogen content of flaxseed cake soy sauce reached 0.79 g / 100 mL and the total nitrogen content reached 1.64 g / 100 mL.
[0084] (3) Using the parameters of Huniang 3.042 crude oil as the standard and expressed as 1.00, the parameters of Aspergillus oryzae CCNH232 crude oil were converted into corresponding ratios, and the results are shown in Table 2. The amino acid nitrogen, total nitrogen, and glutamic acid content in Aspergillus oryzae CCNH232 crude oil were significantly higher than those in crude oil obtained from Huniang 3.042, and all reached the first-class level.
[0085] Table 2
[0086]
[0087] Example 4
[0088] This example illustrates the sensory evaluation of soy sauce fermented with Aspergillus oryzae CCNH232.
[0089] Blind sample evaluations were conducted on Hu Niang 3.042 fermented soy sauce and Aspergillus oryzae CCNH232 fermented soy sauce (prepared according to the method of Example 3) for color, flavor and state. The results are shown in Table 3.
[0090] Table 3
[0091]
[0092] Table 3 shows that, compared with Hu Niang 3.042 fermented soy sauce, the soy sauce fermented with Aspergillus oryzae CCNH232 has a stronger salty and umami flavor and a weaker astringent taste, which is related to its relatively higher glutamic acid content. In conclusion, compared with Hu Niang 3.042, Aspergillus oryzae CCNH232 is more suitable for low-salt solid-state soy sauce fermentation.
[0093] Example 5
[0094] This invention illustrates the application of Aspergillus oryzae CCNH232 in condiments.
[0095] Following the same method as in Example 2, *Aspergillus oryzae* CCNH232 was used to prepare koji (fermentation starter). The koji was then mixed evenly with 11 wt% brine at a mass ratio of 1:1.3 and fermented at 45°C for 20 days to obtain soy sauce mash. During this period, water was added and the mixture was stirred once every 48 hours to maintain a constant moisture content. Twice the weight of the soy sauce mash was then added with brine containing 20 wt% salt. After salting for 22 days, the brine was separated. The solid soy sauce mash was then pressed with salt and matured at room temperature to obtain soy sauce fermented mash. After blending and sterilization, the fermented mash was used to obtain soybean paste. The amino acid nitrogen content of peanut meal soybean paste prepared by Aspergillus oryzae CCNH232 was 0.87 g / 100 g, and the total nitrogen content was 1.66 g / 100 g; the amino acid nitrogen content of flaxseed cake soybean paste was 0.83 g / 100 g, and the total nitrogen content was 1.64 g / 100 g; the amino acid nitrogen content of rapeseed meal soybean paste was 0.84 g / 100 g, and the total nitrogen content was 1.65 g / 100 g.
[0096] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
Claims
1. A composition for preparing soybean meal-based soy sauce koji, characterized in that, The composition comprises Aspergillus oryzae and koji. The preservation number of the Aspergillus oryzae is CGMCC No. 41729; The koji material is a mixture of meal raw materials, wheat bran and water, wherein the meal raw materials are at least one of flaxseed meal, rapeseed meal and peanut meal.
2. The composition according to claim 1, wherein, The content of Aspergillus oryzae, calculated as spore content, is 0.5-1 wt% of the koji material.
3. A method for preparing soy sauce koji, characterized in that, The preparation method includes: inoculating Aspergillus oryzae into the koji material and culturing it; The preservation number of the Aspergillus oryzae is CGMCC No. 41729; The koji material is a mixture of meal raw materials, wheat bran and water, wherein the meal raw materials are at least one of flaxseed meal, rapeseed meal and peanut meal.
4. The preparation method according to claim 3, wherein, The cultivation conditions include: a cultivation temperature of 28-32℃, a cultivation humidity of 80-90%, and a cultivation time of 48-96 hours.
5. The preparation method according to claim 3, wherein, The mass ratio of meal raw materials, water and bran is 2-4:1-3:
1.
6. A method for brewing soy sauce, characterized in that, The method includes: preparing soy sauce koji according to any one of claims 3-5; and mixing the soy sauce koji with brine for fermentation.
7. The brewing method according to claim 6, wherein, The mass ratio of soy sauce starter to brine is 1:1-2; And / or, the concentration of the brine is 10-17 wt%.
8. The brewing method according to claim 6, wherein, The fermentation conditions include: a fermentation temperature of 40-50℃ and a fermentation time of 15-25 days.
9. The use of the composition according to claim 1 or 2 in the preparation of soy sauce.
Citation Information
Patent Citations
Technology for preparing sauce from rape-seed meal
CN102894344A
An improved method for brewing functional soy sauce and soybean paste from flaxseed meal.
CN110326770B
Preparation method and application of peanut meal soy sauce
CN115843998A
Aspergillus oryzae ZA184 and use thereof
CN109762742A
Aspergillus oryzae and application thereof in high-salt high-nitrogen fermented food
CN114317285A