Pelteobagrus fulvidraco embryonic cell line and subculture method and application thereof
By establishing the yellow catfish embryonic cell line YCE and its subculture method, the lack of yellow catfish embryonic cell culture technology was solved, stable passage and high viability frozen storage were achieved, and an ideal model for the anti-infection research of yellow catfish was provided, and the physical data of water production was enriched.
Patent Information
- Application Number
- CN202510116336.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-24
- Publication Date
- 2025-05-13
AI Technical Summary
At present, there is a lack of isolation and culture technology for embryonic cells of yellow catfish, which limits the development of anti-infection and immunity research on yellow catfish. The existing yellow catfish cell lines are mainly derived from renal tissue, and there is a lack of research support for embryonic cell lines.
A yellow fish embryonic cell line YCE was established, and its subculture method was formulated, including treating cells with trypsin digestive fluid, adding passage cell culture medium with components such as fetal bovine serum and epidermal growth factor. Through these steps, stable passage of cells and high viability frozen storage of cells were achieved.
The successful establishment of the embryonic cell line of yellow catfish that can be passaged stably provides an ideal model for studying the anti-infection mechanism of yellow catfish, enriches the basic biological data of aquatic products, and provides a technical reference for the establishment of cell lines of other rare fish species.
Smart Images
Figure CN119979447A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of aquatic biological cell biology, and in particular relates to a yellow catfish embryonic cell line and a subculture method and application thereof. Background Art
[0002] Fish cell lines are easy to culture, have strong experimental repeatability and controllability. Currently, fish cell lines have been widely used in the isolation and expansion of aquatic viruses, the exploration of viral pathogenic mechanisms, the diagnosis of viral diseases, and the in vitro functional verification of immune genes. Most fish are cold-blooded animals and live in relatively low-temperature water environments for a long time. Therefore, compared with mammalian cell lines, fish cell lines can be cultured in a wide temperature range. In addition, most stably propagated mammalian cell lines are derived from immortalized cells of diseased or tumor tissues, while most established fish cell lines originate from normal tissues, such as embryos, tail fins, skin, gills, heart, liver, kidneys, spleen, brain, etc., and embryos are also listed as the main tissue source used in primary culture.
[0003] Yellow catfish (Pelteobagrus fulvidraco) is a major small-scale benthic freshwater economic fish in my country. It has delicious meat, no intramuscular spines, and high nutritional value, and is deeply loved by consumers. In recent years, with the substantial increase in breeding scale and stocking density, the diseases of yellow catfish have become more serious year by year, seriously endangering its artificial breeding industry. The pathogens that infect yellow catfish mainly include Aeromonas hydrophila, Edwardsiella, and viruses. These pathogenic microorganisms pose a potential threat to the intensive and healthy breeding of yellow catfish. It is urgent to establish a suitable yellow catfish anti-infection immunity research system to provide theoretical guidance for the prevention and control of diseases of important aquatic economic fish such as yellow catfish.
[0004] At present, there are only reports on cell lines derived from yellow catfish kidney tissue, and there are no publicly published patents and papers on the isolation and culture of yellow catfish embryonic cells. Therefore, it is necessary to build an in vitro research platform and establish a yellow catfish cell line with good cell status and stable passage, which has important potential in promoting the study of fish diseases and host immune responses. Summary of the invention
[0005] The purpose of the present invention is to provide a yellow catfish embryonic cell line and its subculture method and application. The present invention is the first to establish a yellow catfish embryo-derived cell line YCE (yellow catfish embryo-derived cell line), and use the cell line as a material for research, laying a foundation for in-depth research on the anti-infection mechanism of yellow catfish and enriching the basic biological data of aquaculture.
[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The invention provides a yellow catfish embryonic cell line. The yellow catfish embryonic cell line is a yellow catfish embryonic cell line YCE, and its preservation number is CCTCC NO: C202516.
[0007] Furthermore, the cell type of the yellow catfish embryonic cell line YCE is fibroblast-like cells.
[0008] The invention also provides a subculture method of the yellow catfish embryonic cell line, which specifically comprises: taking the yellow catfish embryonic cell line YCE and culturing it at a constant temperature for 3-5 days, discarding the old culture medium, adding trypsin digestion solution, allowing trypsin to rinse all cells, then discarding trypsin and residual cell supernatant, adding new trypsin digestion solution to continue digesting cells, patting the side of the cell bottle with the palm of a hand during digestion to loosen the adherent cells, adding a subculture cell culture medium containing 10% fetal bovine serum, 1 ng / mL epidermal growth factor, penicillin and streptomycin when 70% of the cells are observed to fall off, gently blowing the cell suspension, and continuing to culture separately.
[0009] Furthermore, the most suitable subculture period in the subculture method is 5 days / generation.
[0010] Furthermore, the cell culture medium is an M199 basic culture medium supplemented with fetal bovine serum, epidermal growth factor, penicillin and streptomycin.
[0011] Furthermore, the volume concentration of the fetal bovine serum is 10% to 20%.
[0012] Furthermore, the concentrations of epidermal growth factor, penicillin, and streptomycin in the cell culture medium are 1 ng / mL, 100 U / mL, and 100 U / mL, respectively.
[0013] The invention also provides the application of the yellow catfish embryonic cell line in the research of anti-infection regulation mechanism.
[0014] Furthermore, the yellow catfish embryonic cell line YCE can be used to prepare an anti-infection model, exogenous plasmids can be transfected into yellow catfish embryonic cells for expression, and pathogen stimulation can induce an immune response in yellow catfish embryonic cells.
[0015] Compared with the prior art, the beneficial technical effects of the present invention are: The present invention successfully established for the first time in vitro the embryonic cells of yellow catfish that can be stably and continuously propagated, and the cells have normal growth, good morphology, stable characteristics, and high cell viability after freezing. The embryonic cell line provides a technical reference for the establishment of freshwater fish cell lines and enriches the basic biological data of fish.
[0016] The present invention provides a technical method for obtaining embryo-derived cells from fertilized eggs. A large number of pure donor cells can be obtained at one time through aseptic culture and separation without endangering the life of the donor fish, thereby improving the success rate of establishing a cell line. The genetic information of the obtained cells is stable and the adhesion efficiency is high. This method is also suitable for the rapid and large-scale acquisition of cells of other fish species or the establishment of embryonic cell lines, providing a new idea for the germplasm preservation of other rare fish species and the development of cell line resources.
[0017] The yellow catfish cell line YCE established in the present invention can be induced by pathogens such as Edwardsiella and viruses to upregulate the expression of immune-related genes (such as IL-6, Mx1, etc.), providing an ideal cell line research model for the study of the anti-infection immune regulation mechanism of yellow catfish. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 These are primary and subcultured yellow catfish embryonic cells; A is the P0 generation yellow catfish embryonic cells; B is the P5 generation yellow catfish embryonic cells; C is the P50 generation yellow catfish embryonic cells; and D is the revived P50 generation yellow catfish embryonic cells.
[0019] Figure 2 The figure is a schematic diagram of chromosomes of the P50 generation yellow catfish cell line; A is a schematic diagram of the chromosome karyotype of a single cell, and B is a statistical diagram of the number of chromosomes in 50 cells.
[0020] Figure 3 The invention is for the identification of immune-related molecules of the cell source of the yellow catfish cell line; wherein XM_027154883.2 is the mRNA sequence of the yellow catfish interferon gene published on NCBI, and MN258120.1 is the mRNA sequence of the IRF7 gene; and YCE IFN and YCE IRF7 are gene sequences of the yellow catfish cell line established by the invention.
[0021] Figure 4 The fluorescent protein signal was detected 24 hours after the yellow catfish cell line was transfected with the peGFP-N3 expression vector. A is a microscopic photograph under white light, B is a fluorescent microscopic photograph, and green is the fluorescent signal of cells expressing eGFP.
[0022] Figure 5 The immune stimulation effects of different pathogens on yellow catfish cells; A is the induced expression of IL-6 gene in yellow catfish cells after 48 hours of Edwardsiella stimulation; B is the induced expression of interferon-stimulated gene Mx1 after 48 hours of polyI:C induction. DETAILED DESCRIPTION
[0023] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, the following will be described in detail with reference to the accompanying drawings and specific embodiments. The following are only some embodiments of the present invention, not all embodiments. The following embodiments are provided only to explain this invention and cannot be used to limit the scope of protection of the invention. Furthermore, other embodiments obtained without innovative labor are all within the scope of protection of the present invention.
[0024] It should be noted that the methods used in the following examples, unless otherwise specified, and the specific experimental methods are not indicated in the examples, can be carried out under conventional conditions, and the reagents and materials described in the following examples, unless otherwise specified, can be obtained from commercial channels.
[0025] Example 1: Method for establishing a yellow catfish embryonic cell line 1.1 Preparation before the experiment The invention mainly relates to the acquisition and cultivation of fish embryo cell lines, and thus a number of fertile male and female adult fish parents (sourced from the Institute of Hydrobiology, Chinese Academy of Sciences) are prepared; in order to obtain clean embryo cells from the source, about 2L of pure water required for artificial induction of labor, insemination and embryo-related operations is prepared, and after high-pressure sterilization, the bottle cap is loosened and placed in an ultra-clean workbench for more than 24 hours; an M199 culture medium containing 20% fetal bovine serum is prepared for primary culture, and a cell culture-grade DMSO solution is prepared for cell preservation.
[0026] 1.2 Obtaining primary embryonic cells Select female yellow catfish parents that can induce spawning, disinfect the surface of the cloaca of the female yellow catfish to be spawned with 75% alcohol, squeeze out the eggs and collect them in a sterile culture dish with a diameter of 100 mm; add 10ul of male fish semen to every 200 fish eggs, and add 20ml of sterile water to activate the in vitro fertilization reaction. Replace new sterile water for about 20 seconds, and place the culture dish containing the fertilized eggs in an ultra-clean workbench to continue culturing and developing for 48 hours; use the needle of a 1ml sterile syringe to peel off the egg membrane to obtain the embryo, collect 30-50 embryos in a sterilized 1.5ml EP tube, add 1ml of 0.25 W / V% EDTA-trypsin to digest for 30 minutes, and then use a 1ml pipette to blow away the cell clusters, and transfer the cell suspension to 50 containing 20ml M199 culture medium. mL centrifuge tube, continue to blow the suspension with a 10ml pipette to fully disperse the cell clusters; collect the cell clusters by low-speed centrifugation at 1500g, resuspend the cells with 5ml cell culture medium containing 20% fetal bovine serum, use a 1ml pipette to blow the cell clusters apart and transfer them to a 60mm cell culture dish to allow them to adhere to the wall and grow. During the cell proliferation period, replace half of the culture medium every 5 days to obtain primary cells; 1.3 Subculture: The primary cultured cells proliferate and divide to form a monolayer of cells. When the cell confluence rate reaches 80%, subculture begins. Aspirate the original culture medium in the culture dish, add 1 ml of trypsin to digest the cells until the cells become round, aspirate the trypsin digestion solution, add 4 ml of cell culture medium containing 20% fetal bovine serum and growth factors, blow the cells to make a cell suspension, and subculture at a ratio of 1:1 for 3-5 generations. After subculture to the sixth generation, transfer the cells to a T25 cell bottle, and continue to subculture in the form of 1 to 2 using a subculture medium containing 10% serum. Stable subculture lasts for 100 generations until a stable genetic yellow catfish embryonic cell line YCE is obtained. Figure 1 As shown, A is the primary cell P0, B is the P5 cell, C is the P50 cell, and D is the revived P50 cell.
[0027] The 100th generation of the cell line, the Pelteobagrus fulvidraco embryonic cell line YCE, has been sent to the China Center for Type Culture Collection (CCTCC) for preservation. The address is Wuhan University, Wuhan, China. The preservation date is December 31, 2024. Pelteobagrus fulvidraco The deposit number is CCTCC NO: C202516.
[0028] Example 2: Biological characteristics of Pelteobagrus fulvidraco embryonic cell lines 2.1 Morphology: The cell type is fibroblast-like.
[0029] 2.2 Growth characteristics: The embryonic cells of yellow catfish began to adhere to the wall after about 30 minutes and were completely attached after 12 hours; the optimal subculture cycle was 5 days / generation.
[0030] 2.3 Stability: As of the date of application, the embryonic cells of Pelteobagrus fulvidraco have been passaged for 104 generations and have shown stable proliferation.
[0031] 2.4 Cryopreservation and thawing: Digest the cells with trypsin in a T25 cell flask. When most of the cells become round, tap the side of the culture flask to remove a few cells. Then discard the trypsin and resuspend the cells in a cell freezing solution containing 10% DMSO and 20% fetal bovine serum to a cell concentration of 1×10 6 cells / mL. The cell suspension was dispensed into 2 ml cryovials at 1.5 mL / tube. The cryovials were transferred into a 4°C precooled cell program cooling box, placed in a -80°C ultra-low temperature refrigerator for 12 to 16 h, and then the cryovials were transferred into -196°C liquid nitrogen for long-term storage. After thawing, the embryonic cells of yellow catfish attached to the wall quickly, and the growth morphology and condition were basically similar to those of cells that were not frozen. The thawing cells could be passaged and proliferated normally without obvious differences.
[0032] 2.5 Subculture method Yellow catfish embryonic cell line YCE was cultured in a T25 cell bottle at 28°C until the cell bottle was filled (about 5 days), the old culture medium was discarded, 1 ml of trypsin digestion solution was added, and the cell bottle was gently shaken to allow the trypsin to wash all cells. After 1 minute, the cell bottle was stood up, trypsin and residual cell supernatant were discarded from the bottom of the cell bottle, and new 500ul of trypsin digestion solution was added. The cell bottle was laid flat and allowed to stand for 3-5 minutes to continue digesting the cells. During the digestion period, the side of the cell bottle was patted once or twice with the palm of the hand to loosen the attached cells. The degree of cell digestion was observed under a microscope. When 70% of the cells were observed to fall off, 12 ml of cell culture medium containing 10% fetal bovine serum, 1 ng / mL epidermal growth factor, penicillin and streptomycin was immediately added. The cell suspension was gently blown 3-5 times with a pipette, and then divided into two cell bottles for further culture.
[0033] Example 3: Identification of the origin of Pelteobagrus fulvidraco embryonic cell lines 3.1 Karyotype analysis of yellow catfish cell lines Take a bottle of 50th generation yellow catfish embryonic cells, add colchicine with a final concentration of 20µg / ml, incubate at 28℃ for 4h, digest and collect cells, treat with 0.075mol / L KCl solution for 30min, add pre-cooled Carnoy's fixative, centrifuge at 1000rpm for 5min, remove the supernatant, and fix with pre-cooled Carnoy's fixative 3 times, each time for 15min. Use cold drop method to drop, dry and stain with 5% Giemsa for 10min, and observe under a microscope. Among the 100 mitotic cells observed, the chromosome mode of the 50th generation yellow catfish embryonic cells is 52 ( Figure 2 ), which is consistent with the chromosome characteristics of farmed yellow catfish (Xue Shuqun et al., Preliminary analysis of the chromosome karyotype of yellow catfish, Journal of Fisheries of China, 2006, 19: 11-13).
[0034] 3.2 Identification of genes related to embryonic cell lines in yellow catfish The 50th generation yellow catfish cells were digested and centrifuged to extract total RNA using Trizol. cDNA was obtained by reverse transcription reaction; primers were designed based on the known yellow catfish interferon gene (F: CCCCGGAAGAATTTCTG, R: CCATTTTCTTCAGGAGTGAC) and interferon regulatory factor IRF7 gene sequences on NCBI (F: GGCGGCGACGACTCATTCG, R: AGCCTGCTTTGAACACTC).
[0035] The cDNA was used as a template for sequence amplification. The amplification conditions were as follows: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 30 seconds, and 72°C for 5 minutes after 35 cycles. The PCR amplification products were detected by 2% (W / V) agarose gel electrophoresis, and the PCR products were recovered and connected to the pMD18-T vector for gene cloning and Sanger sequencing. The detection results were compared with the gene sequences in the public database. The results are shown in Figure 3 As shown, it was confirmed that the cells were derived from Pelteobagrus fulvidraco.
[0036] Example 4: Application of Yellow Catfish Cell Line as an Anti-Infection Model 4.1 Cell transfection assay When the cells are suitable for subculture, yellow catfish embryonic cell line YCE cultured in 2 bottles of T25 cell bottles were taken and digested by trypsin digestion. After most of the cells were digested and detached, 15 ml of cell culture medium was added to resuspend the cells, and the cell suspension was divided into 6-well cell culture plates and cultured for 24 hours; the green fluorescent protein expression plasmid peGFP-N3 was transfected into the cells using a transfection reagent, and the green fluorescent signal was detected under a fluorescence microscope after continuing to culture for 24 hours. The results are as follows: Figure 4 As shown, it shows that foreign plasmids can be transfected and expressed in yellow catfish embryonic cells.
[0037] 4.2 Virus stimulation experiment The cells were stimulated with Edwardsiella and polyI:C, a viral nucleic acid analog, respectively. After 24 hours, the cells were collected and RNA was extracted for RT-PCR experiments to detect the expression of inflammatory factor IL-6 and interferon-stimulated gene Mx1. The results are as follows Figure 4 As shown, pathogen stimulation can induce immune responses in embryonic cells of yellow catfish, including Figure 5 A is the expression of inflammatory factor IL-6, Figure 5 B is the expression of Mx1 gene. The results show that the yellow catfish cell line can be used as a tool model for anti-infection research.
[0038] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.
Claims
1. A yellow catfish embryonic cell line, characterized in that: The yellow catfish embryonic cell line is the yellow catfish embryonic cell line YCE, and its deposit number is CCTCC NO: C202516.
2. The yellow catfish embryonic cell line according to claim 1, characterized in that: The cell type of the yellow catfish embryonic cell line YCE is fibroblast-like cells.
3. The subculture method for the Pelteobagrus fulvidraco embryonic cell line according to claim 1, characterized in that: The subculture method comprises the following steps: taking the yellow catfish embryonic cell line YCE and culturing it at a constant temperature for 3-5 days, discarding the old culture medium, adding trypsin digestion solution to allow trypsin to rinse all cells, then discarding trypsin and residual cell supernatant, adding new trypsin digestion solution to continue digesting the cells, tapping the side of the cell bottle with the palm of the hand during digestion to loosen the adherent cells, adding subculture cell culture medium when 70%-80% of the cells are observed to fall off, gently blowing the cell suspension, and separating and continuing to culture.
4. The subculture method according to claim 3, characterized in that: The most suitable subculture period in the subculture method is 5 days / generation.
5. The subculture method according to claim 3, characterized in that: The cell culture medium is prepared by adding fetal bovine serum, epidermal cell growth factor, penicillin and streptomycin to the M199 basic culture medium.
6. The subculture method according to claim 5, characterized in that: The volume concentration of the fetal bovine serum is 10% to 20%.
7. The subculture method according to claim 5, characterized in that: The concentrations of epidermal growth factor, penicillin, and streptomycin in the passage cell culture medium are 1 ng / mL, 100 U / mL, and 100 U / mL, respectively.
8. Use of the yellow catfish embryonic cell line according to claim 1 in research on anti-infection regulatory mechanisms.
9. The use according to claim 8, characterized in that: The yellow catfish embryonic cell line YCE can be used to prepare an anti-infection model, exogenous plasmids can be transfected into yellow catfish embryonic cells for expression, and pathogen stimulation can induce an immune response of yellow catfish embryonic cells.