Double-stranded RNA targeting Hemiptera insects and its pesticide composition and use
By designing dsRNA targeting the brown planthopper gene and utilizing Escherichia coli fermentation and chitosan nanoparticle delivery system, the environmental pollution and drug resistance problems of chemical pesticides in the control of brown planthoppers were solved, achieving efficient and green pest control.
Patent Information
- Application Number
- CN202510484048.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-04-16
AI Technical Summary
Existing chemical pesticides have problems of environmental pollution, residues and pest resistance when used to control brown planthoppers, and there is a lack of efficient, green and specific control methods.
Double-stranded RNA (dsRNA) targeting specific genes of brown planthoppers was designed to silence pest gene expression through RNA interference technology, combined with Escherichia coli fermentation and chitosan nanoparticle delivery system to achieve efficient prevention and control.
It achieves efficient and specific control of brown planthoppers, reduces the use of chemical pesticides, reduces environmental pollution and residues, and has broad application prospects.
Smart Images

Figure CN119979544B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological pesticides, and in particular relates to double-stranded RNA targeting Hemiptera insects, and a pesticide composition and use thereof. Background Art
[0002] The brown planthopper (BPH, Nilaparvata lugens), a member of the Hemiptera family (Delphacidae), is a monophagous pest that inhabits and reproduces exclusively on rice plants. By sucking the phloem sap of rice, it restricts rice growth and reduces yields. Its long-distance migration makes its damage widespread, increasing the difficulty of prevention and control.
[0003] Brown planthoppers (NPL) cause both direct and indirect damage. Directly, they use their piercing-sucking mouthparts to suck sap from rice plants, depleting them of water and nutrients. In severe cases, this can cause rice to wither and even fall over, significantly reducing yields. Indirectly, their feeding and egg-laying leave wounds on rice stems and leaves, increasing the risk of water loss and pathogen invasion. Furthermore, the honeydew they produce can easily breed mold, further exacerbating the disease.
[0004] In agricultural production, chemical pesticides such as organophosphorus pesticides, carbamate pesticides, nicotinoid pesticides, pymetrozine, and buprofezin are often used to combat brown planthopper pests. Appropriate application of pesticides can effectively control pest populations and reduce damage. However, the use of chemical pesticides can pollute soil and the environment, kill other species in the food chain, and leave residues in rice, harming both the environment and human health. Furthermore, the use of chemical pesticides can increase the resistance of brown planthoppers, forcing the use of higher pesticide doses, creating a vicious cycle. Therefore, the development of new, green, safe, and effective control methods is urgent.
[0005] RNA interference (RNAi) is a gene silencing technique mediated by double-stranded RNA (dsRNA). Upon entry into host cells, exogenous dsRNA is cleaved by the endonuclease Dicer into small RNA fragments (siRNAs). These siRNAs are then unzipped into sense and antisense strands by RNA helicases. The antisense siRNAs then bind to enzymes in the body to form an RNA-induced silencing complex (RISC). RISC then cognates with mRNA and cleaves it, reducing the transcription of the gene. RNAi technology is ubiquitous in most eukaryotic organisms, offering high specificity and efficiency, making it an important tool for studying gene function and combating crop pests and diseases.
[0006] Numerous studies have demonstrated that RNAi can play a significant role in controlling brown planthoppers. Specifically, by silencing specific genes through dsRNA, it can lead to developmental abnormalities, decreased fertility, and even death in brown planthoppers. Green agriculture is a new agricultural development concept proposed in recent years, aiming to increase farmers' incomes while protecting the ecological environment and maintaining human health. Interferon utilizes the principles of RNAi to target specific genes in pathogens (insects or microorganisms), silencing the expression of the target gene and thereby inhibiting or eliminating the pathogen. Due to its high efficiency, high specificity, and absence of pesticide residues, it has great potential to replace traditional chemical pesticides and achieve green agriculture. However, there remains an unmet need for more effective RNAi solutions for controlling brown planthoppers. Summary of the Invention
[0007] The present invention provides dsRNA sequences targeting multiple genes in the brown planthopper. These dsRNA fragments, upon entry into the brown planthopper, can effectively knock down the expression of the target genes, significantly reducing the planthopper's survival rate. Given the advantages of RNA pesticides, such as safety and high efficiency, the use of the present dsRNA to target potential targets in the brown planthopper can achieve environmentally friendly and efficient pest control.
[0008] In one aspect, the present invention provides a double-stranded RNA targeting Hemiptera insects, wherein the double-stranded RNA targeting Hemiptera insects comprises a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 1, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 2.
[0009] In another aspect, the present invention provides a double-stranded RNA targeting Hemiptera insects, wherein the double-stranded RNA targeting Hemiptera insects comprises a sense strand and an antisense strand, wherein:
[0010] The sense strand has the nucleotide sequence shown in SEQ ID NO: 3, and the antisense strand has the nucleotide sequence shown in SEQ ID NO: 4; the sense strand has the nucleotide sequence shown in SEQ ID NO: 5, and the antisense strand has the nucleotide sequence shown in SEQ ID NO: 6; the sense strand has the nucleotide sequence shown in SEQ ID NO: 7, and the antisense strand has the nucleotide sequence shown in SEQ ID NO: 8; the sense strand has the nucleotide sequence shown in SEQ ID NO: 9, and the antisense strand has the nucleotide sequence shown in SEQ ID NO: 10; the sense strand has the nucleotide sequence shown in SEQ ID NO: 11, and the antisense strand has the nucleotide sequence shown in SEQ ID NO: 12; or, the sense strand has the nucleotide sequence shown in SEQ ID NO: 13, and the antisense strand has the nucleotide sequence shown in SEQ ID NO: 14.
[0011] In another aspect, the present invention provides a double-stranded RNA targeting Hemiptera insects, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 3, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 4.
[0012] In another aspect, the present invention provides a double-stranded RNA targeting Hemiptera insects, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 5, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 6.
[0013] In another aspect, the present invention provides a double-stranded RNA targeting Hemiptera insects, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 7, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 8.
[0014] In another aspect, the present invention provides a double-stranded RNA targeting Hemiptera insects, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 9, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 10.
[0015] In another aspect, the present invention provides a double-stranded RNA targeting Hemiptera insects, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 11, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 12.
[0016] In another aspect, the present invention provides a double-stranded RNA targeting Hemiptera insects, comprising a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence as shown in SEQ ID NO: 13, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO: 14.
[0017] In another aspect, the present invention provides an expression vector, characterized in that the expression vector comprises the sense strand or antisense strand of the double-stranded RNA targeting Hemiptera insects as described in any embodiment herein.
[0018] In another aspect, the present invention provides a host cell, characterized in that the host cell comprises the sense strand or antisense strand of the double-stranded RNA targeting Hemiptera insects, or the expression vector as described in any embodiment herein.
[0019] In another aspect, the present invention provides a method for preparing the double-stranded RNA targeting Hemiptera insects as described in any embodiment herein, the method comprising expressing using the expression vector or host cell as described in any embodiment herein.
[0020] In one or more embodiments, the method comprises the steps of:
[0021] S1: Extract RNA from brown planthopper;
[0022] S2: cDNA was obtained by reverse transcription using RNA from brown planthopper as template;
[0023] S3: Using cDNA as a template, amplify the target sequence by PCR;
[0024] S4: Clone the target sequence into the plasmid to obtain a recombinant plasmid vector;
[0025] S5: Transform the recombinant plasmid vector into competent cells, and use the competent cells transformed with the recombinant plasmid vector as host cells;
[0026] S6: culturing the host cells, using an inducer to induce the host cells to express double-stranded RNA targeting Hemiptera insects, and obtaining a fermentation liquid;
[0027] S7: Purification of double-stranded RNA targeting Hemiptera insects from fermentation broth.
[0028] Preferably, in step S1, the extraction method is the Trizol method.
[0029] Preferably, in step S3, the target sequence is selected from any one of SEQ ID NOs: 15 to 28.
[0030] Preferably, in step S4, the plasmid is pET-30a plasmid.
[0031] Preferably, in step S4, the cloning step includes:
[0032] S4-1: Treat the plasmid with a specific endonuclease and purify it by agarose gel electrophoresis to obtain a linearized plasmid;
[0033] S4-2: The PCR amplified product in S3 was connected to the linearized plasmid using DNA ligase to obtain a recombinant plasmid vector.
[0034] More preferably, in step S4-1, the specific endonuclease is EcoRI endonuclease.
[0035] More preferably, in step S4-1, the recombinant plasmid vector comprises two or more promoters.
[0036] Preferably, in step S5, the competent cells are HT115 (DE3).
[0037] Preferably, in step S6, the inducer is IPTG.
[0038] In one or more embodiments, in step S7, the purification step comprises:
[0039] S7-1: fermentation broth pretreatment;
[0040] S7-2: Positive pressure-bell jar type two-way filtration;
[0041] S7-3: Ethanol gradient precipitation.
[0042] Preferably, step S7-1 includes the following steps:
[0043] S7-1-1: Breaking the wall;
[0044] S7-1-2: water bath;
[0045] S7-1-3: ultrasonic treatment;
[0046] S7-1-4: Adjust the pH of the liquid obtained in S7-1-3 to 7.9-8.1 using buffer A, and centrifuge to obtain supernatant A; wherein the buffer A is an aqueous solution containing 0.15 M sodium bicarbonate, 0.014 M sodium tetraborate, and 0.48 M sodium chloride, and has a pH of 8.4-8.6;
[0047] S7-1-5: Use buffer B to adjust the pH value of supernatant A to 5.9-6.1, and then centrifuge to obtain supernatant B; wherein, the buffer B is an aqueous solution containing 0.15 M citric acid, 0.18 M hydrochloric acid, 0.22 M tris(hydroxymethyl)aminomethane and 0.62 M sodium chloride, and the pH value is 4.4-4.6.
[0048] More preferably, in step S7-1-2, the temperature of the water bath is 45 to 55°C.
[0049] More preferably, in step S7-1-3, the ultrasonic treatment time is 25 to 35 minutes.
[0050] More preferably, in step S7-1-4, the centrifugation is performed at 12000-14000 rpm and 9-11° C. for 18-22 minutes.
[0051] More preferably, in step S7-1-5, the centrifugation is performed at 14,000 to 16,000 rpm and 4 to 6° C. for 18 to 22 minutes.
[0052] Preferably, step S7-2 is to filter the liquid obtained in step S7-1 using a positive pressure-bell jar type double filtration device to obtain a filtrate.
[0053] More preferably, the pore size of the filter column used in the filtration process is 0.22 µm, the filter element is made of cellulose, and the pressure of the filtration process is 0.09-0.11 MPa.
[0054] Preferably, step S7-3 includes the following steps:
[0055] S7-3-1: The filtrate obtained in step S7-2 was precipitated with 27-33% (v / v) ethanol and centrifuged to obtain supernatant C;
[0056] S7-3-2: After the supernatant C is allowed to stand overnight at 9-11°C, anhydrous ethanol is added to the supernatant C under low-speed stirring until the final ethanol concentration reaches 65-75% (v / v);
[0057] S7-3-3: Centrifuge the liquid obtained in step S7-3-2 to collect the purified dsRNA.
[0058] More preferably, in step S7-3-3, the centrifugation is performed at 14,000 to 16,000 rpm and 3 to 5° C. for 35 to 45 minutes.
[0059] In another aspect, the present invention provides a pesticide composition comprising an effective amount of the double-stranded RNA targeting Hemiptera insects as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent or excipient.
[0060] In one or more embodiments, the carrier is chitosan nanoparticles.
[0061] In another aspect, the present invention provides a method for preparing the pesticide composition as described in any embodiment herein, comprising adding the double-stranded RNA targeting Hemiptera insects as described in any embodiment herein and a pharmaceutically acceptable carrier to a solvent.
[0062] In one or more embodiments, the method comprises the steps of:
[0063] S1: dissolving chitosan with acetate buffer to obtain chitosan acetate solution; dissolving dsRNA with sodium sulfate solution to obtain dsRNA sodium sulfate solution;
[0064] S2: slowly adding the dsRNA sodium sulfate solution to the chitosan acetate solution, mixing thoroughly, incubating, and vortexing after incubation to obtain a dsRNA chitosan nanoparticle preparation.
[0065] Preferably, in step S1, the pH of the acetate buffer is 4.4-4.6.
[0066] Preferably, in step S1, the concentration of chitosan in the chitosan acetate solution is 0.02% (w / v).
[0067] Preferably, in step S1, the concentration of sodium sulfate in the sodium sulfate solution is 45-55 mM.
[0068] Preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 10 to 5000 mg / L. More preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 1000 to 3000 mg / L. Further preferably, in step S1, the concentration of dsRNA in the dsRNA sodium sulfate solution is 2000 mg / L.
[0069] Preferably, in step S2, the volume ratio of the dsRNA sodium sulfate solution and the chitosan acetate solution used for mixing is 1:3 to 3:1. More preferably, in step S2, the volume ratio of the dsRNA sodium sulfate solution and the chitosan acetate solution used for mixing is 1:1.
[0070] Preferably, in step S2, the incubation temperature is 50-60°C; more preferably, in step S2, the incubation temperature is 55°C.
[0071] Preferably, in step S2, the incubation time is 30 to 90 seconds; more preferably, in step S2, the incubation time is 60 seconds.
[0072] Preferably, in step S2, the vortexing time is 5 to 60 seconds; more preferably, in step S2, the vortexing time is 30 seconds.
[0073] Preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 10 to 3000 mg / L. More preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 100 to 2000 mg / L. Further preferably, in step S2, the concentration of dsRNA in the chitosan nanoparticle preparation of dsRNA is 1000 mg / L.
[0074] In another aspect, the present invention provides use of the double-stranded RNA against Hemipteran insects as described in any embodiment herein in the preparation of a pesticide for controlling Hemipteran insects.
[0075] In another aspect, the present invention provides use of the pesticide composition according to any embodiment herein in the preparation of a pesticide for controlling Hemiptera insects.
[0076] In another aspect, the present invention provides use of the double-stranded RNA against Hemipteran insects as described in any embodiment herein in controlling Hemipteran insects.
[0077] In another aspect, the present invention provides use of the pesticide composition according to any embodiment herein for controlling Hemiptera insects.
[0078] In another aspect, the present invention provides a method for controlling Hemipteran insects, comprising applying the double-stranded RNA against Hemipteran insects according to any embodiment herein.
[0079] In another aspect, the present invention provides a method for controlling Hemiptera insects, the method comprising applying the pesticide composition according to any embodiment herein.
[0080] Preferably, the Hemiptera insect is a Delphacidae insect. Preferably, the Hemiptera insect is selected from one or more of the group consisting of brown planthopper, white-backed planthopper, gray planthopper, peach aphid, and cotton aphid. More preferably, the Delphacidae insect is brown planthopper.
[0081] The present invention has at least one of the following beneficial effects:
[0082] 1. Compared with traditional chemical pesticides, the dsRNA provided by the present invention is a biological pesticide with the characteristics of high efficiency, specificity, rapid degradation and no residue. It can achieve the prevention and control of brown planthoppers through the mechanism of RNAi, which helps to reduce the use of chemical pesticides.
[0083] 2. This invention provides novel brown planthopper target genes as targets for RNAi. Survival results indicate that these genes play a crucial role in the survival of brown planthoppers, making them effective targets for control using gene silencing, with broad application prospects. Accordingly, this invention provides multiple dsRNA sequences targeting these targets, some of which demonstrate unprecedented control efficacy against brown planthoppers.
[0084] 3. The present invention utilizes E. coli fermentation to produce dsRNA, obtaining high-purity dsRNA through positive pressure-bell-jar dual filtration and alcohol gradient precipitation. This method is low-cost, simple to operate, and capable of large-scale production, breaking the limitations of traditional production methods and providing a feasible solution for the industrialized production of dsRNA.
[0085] 4. The present invention provides a nanoparticle carrier that can quickly penetrate the body wall of pests and efficiently enter living cells, achieving high dsRNA delivery efficiency and gene interference effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0086] Figure 1 This is the plasmid map of pET30a-GFP.
[0087] Figure 2 This is a liquid chromatography analysis spectrum of the product obtained by ethanol gradient precipitation.
[0088] Figure 3 is the survival rate of brown planthoppers 3 and 5 days after microinjection of dsRNA targeting each target. Figure 3 A in the figure is the survival rate of brown planthoppers 3 days after microinjection of dsRNA targeting each target; Figure 3 Panel B is the survival rate of brown planthoppers 5 days after microinjection of dsRNA targeting each target.
[0089] Figure 4 The relative expression levels of mRNA levels of seven target genes were measured one day after microinjection of dsRNA targeting each target.
[0090] Figure 5 This is a schematic diagram of indoor biological testing processing.
[0091] Figure 6 These are the results of measuring the mRNA expression levels of target genes of brown planthoppers in rice seedlings treated with the seedling immersion method for 3 days in an indoor bioassay.
[0092] Figure 7 The results are from an indoor bioassay where the brown planthopper (NLP) was found 5 days after the rice seedlings were treated with the seedling immersion method.
[0093] Figure 8 These are the results of the survival rate determination of brown planthoppers after rice seedlings were treated with dsRNA preparations and acetamiprid liquid by the seedling immersion method in an indoor biological test. DETAILED DESCRIPTION
[0094] Example 1: Target function and sequence design
[0095] The conserved domain database of the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov / cdd / ?term=) was used to analyze the sequence conserved regions. Combined with the online RNAi molecule design tool BLOCK-iT™ RNAi Designer (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ), corresponding target RNA sequences were designed for seven brown planthopper gene targets.
[0096]
[0097] dsRNA targeting target 1:
[0098] Sense strand (SEQ ID NO: 1)
[0099] ACGAGGGGCAAAUGAAUCACAUCCAGAUAGGGUUCCAAGUCAAACAGAAUUUCAUCAGUUUGAUUGAUAUUUGUUUCGAUGAAACCGUAUUGACGGCUAAUUACUCGCUGUAUCAAGCCAGCUACAGAAUCGCUG GUAGGCAAGUCCGGAUUUCCCAGGAUGAAUUUCAUCGCCGGAAAAUUCUACGGCGACAAUUGAAAUUUGGAAACUAUACUCGAGAAAGAAACAACGAGAAACGUUAGCCAAGAUUCUGGGAUCGGAAAAUUUAGCUAG UACUUACAUUAAAGAUGACAAAAACUACUAUCUAGCAAGAGGACAUUUAACAGCCAAAGCUGACUUUGUCUAUGGAGCUGAACAGAUGGCUACAUUCUACUACAUCAAUGUGGCGCCUCAAUGGCAAAUCAUCAA CGCUGGAAAUUGGGCUGCACUUGAAGAUAAUGUUCGCAACUACAUCAUCAACAAUAAACUGGAAGUUCUCAUCUACACCAUCCCUCACGGUGUAGCCGUAUUACCUGAUGCAGAUGGAAUCUACCAGCCUCUCUAC
[0100] Antisense strand (SEQ ID NO: 2)
[0101] GUAGAGAGGCUGGUAGAUUCCAUCUGCAUCAGGUAAUACGGCUACACCGUGAGGGAUGGUGUAGAUGAGAACUUCCAGUUUAUUGUUGAUGAUGUAGUUGCGAACAUUAUCUUCAAGUGCAGCCCAAUUUCCAGCGUUGAUGAUUUGCCAUUGAGGCGCCACAUUGAUGUAGUAGAAUGUAGCCAUCUGUUCAGCUCCAUAGACAAAGUCAGCUUUGGCUGUUAAAUGUCCUCUUGCUAGAUAGUAGUUUUUGUCAUCUUUAAUGUAAGUACUAGCUAAAUUUUCCGAUCCCAGAAUCUUGGCUAACGUUUCUCGUUGUUUCUUUCUCGAGUAUAGUUUCCAAAUUUCAAUGUCGCCGUAGAAUUUUCCGGCGAUGAAAUUCAUCCUGGGAAAUCCGACUUGCCUACCAGCGAUUCUGUAGCUGGCUUGAUACAGCGAGUAAUUAGCCGUCAAUACGGUUUCAUCGAAACAAAUAUCAAUCAAACUGAUGAAAUUCUGUUUGACUUGGAACCCUAUCUGGAUGUGAUUCAUUUGCCCCUCGU
[0102] dsRNA targeting target 2:
[0103] Sense strand (SEQ ID NO: 3)
[0104] UCAAGCUGCCAAGGAGCAUGUAUUGGCAGUUUCAAGGGAUUUCAUUUCACAGCCAAGAUUGACAUAUAAAACUGUUUGUGGUGUCAACGGCCCUUUGGUGAUCUUGGAUGAGGUCAAAUUCCCCAAGUUUGCUGAAAUUGUUCAGCUCAAACUUGCUGAUGGAACUGUUCGUUCCGGUCAAGUAUUGGAAGUCAGCGGCACUAAGGCUGUUGUACAGGUCUUCGAAGGAACUUCCGGAAUUGAUGCGAAAAACACUCUGUGUGAGUUCACCGGUGAUAUCCUUCGGACGCCAGUAUCAGAAGAUAUGCUUGGUCGUGUAUUCAACGGAAGUGGUAAGCCCAUCGACAAAGGACCUCCCAUUCUUGCCGAGGAUUAUCUCGACAUUCAAGGUCAACCCAUCAAUCCUUGGUCGCGUAUCUAUCCCGAGGAAAUGAUCCAGACUGGAAUUUCAGCCAUCGACGUCAUGAACUCGAUUGCUCGUGGCCAGAAAAUUCCCAUCUUUUCAGCUGCCGGUCUACCUCACAACGAAAUUGCUGCUCAAAUCUGUAGACAGGCUGGUCUUGUCAAACUGCCAGGAAAGUCAGUUCUCGAU
[0105] Antisense strand (SEQ ID NO: 4)
[0106] AUCGAGAACUGACUUUCCUGGCAGUUUGACAAGACCAGCCUGUCUACAGAUUUGAGCAGCAAUUUCGUUGUGAGGUAGACCGGCAGCUGAAAAGAUGGGAAUUUUCUGGCCACGAGCAAUCGAGUUCAUGACGUCGAUGGCUGAAAUUCCAGUCUGGAUCAUUUCCUCGGGAUAGAUACGCGACCAAGGAUUGAUGGGUUGACCUUGAAUGUCGAGAUAAUCCUCGGCAAGAAUGGGAGGUCCUUUGUCGAUGGGCUUACCACUUCCGUUGAAUACACGACCAAGCAUAUCUUCUGAUACUGGCGUCCGAAGGAUAUCACCGGUGAACUCACACAGAGUGUUUUUCGCAUCAAUUCCGGAAGUUCCUUCGAAGACCUGUACAACAGCCUUAGUGCCGCUGACUUCCAAUACUUGACCGGAACGAACAGUUCCAUCAGCAAGUUUGAGCUGAACAAUUUCAGCAAACUUGGGGAAUUUGACCUCAUCCAAGAUCACCAAAGGGCCGUUGACACCACAAACAGUUUUAUAUGUCAAUCUUGGCUGUGAAAUGAAAUCCCUUGAAACUGCCAAUACAUGCUCCUUGGCAGCUUGA
[0107] dsRNA targeting target 3:
[0108] Sense strand (SEQ ID NO: 5)
[0109] AAGCCCCUCUCAGAGUUCCUCGACUUUGUGCGCUAUGCCUACAUGAUCGACAACACCAUUCUGCUAAUGACAGGCACUCUCCAUCAGCGACCUGUUGACGAGGUGGCAGCCCGUUGUCACCCGCUCGGCCGCUUCCAGCAAUGGAGGCAGUACACGUGGCGUUGACUCCUCGCGAGCUCUACAACGCGGUGAUUGUGGACACGCCCCUCGCACCCUUCUUCCUCGACUGCAUCAAUGAGCACAGUCUCAACGAGGUCAAUGUCGAACUUAUACGCAACAUGCUCUACAAGGCAUAUUUGGAGAGCUUCGACAAGUUCUGCAAGAAUCUGGGUGGCAUCACAGCUGAGACGAUGUCUGAGAUACUAGCGUUCGAGUGUGACAGACGUGCCUUCAUGAUCACCAUCAACUCGUUCCGCACCGAACUGACCAAGAGUGAGCGCGCCAGUCUGUUCCCACGCUGCGGCCUGCUGCAUCCCACCGGACUGGCUGCUCUGGCUGCGGCUGACAACUAUGAACAGGUGACCUUCAUCAG
[0110] Antisense strand (SEQ ID NO: 6)
[0111] CUGAUGAAGGUCACCUGUUCAUAGUUGUCAGCCGCAGCCAGAGCAGCCAGUCCGGUGGGAUGCAGCAGGCCGCAGCGUGGGAACAGACUGGCGCGCUCACUCUUGGUCAGUUCGGUGCGGAACGAGUUGAUGGUGAUCAUGAAGGCACGUCUGUCACACUCGAACGCUAGUAUCUCAGACAUCGUCUCAGCUGUGAUGCCACCCAGAUUCUUGCAGAACUUGUCGAAGCUCUCCAAAUAUGCCUUGUAGAGCAUGUUGCGUAUAAGUUCGACAUUGACCUCGUUGAGACUGUGCUCAUUGAUGCAGUCGAGGAAGAAGGGUGCGAGGGGCGUGUCCACAAUCACCGCGUUGUAGAGCUCGCGAGGAGUCAACGCCACGUGUACUGCCUCCAUUGCUGGAAGCGGCCGAGCGGGUGACAACGGGCUGCCACCUCGUCAACAGGUCGCUGAUGGAGAGUGCCUGUCAUUAGCAGAAUGGUGUUGUCGAUCAUGUAGGCAUAGCGCACAAAGUCGAGGAACUCUGAGAGGGGCUU
[0112] dsRNA targeting target 4:
[0113] Sense strand (SEQ ID NO: 7)
[0114] AAAACUGCCGAGAAAAACGUCACCCAAUUGGAAUCAAUCAUUAUAACAAAAGCGAAAAUGGUGGUGCAAACGGCGAGACAAAAUUUCAUAUCUGAAGUGACUACUGAUAUCCACCAAAGCUUGGAAAACUGUGUAACUGAAGAUGGCUAUGCCAGCGUUCUAAAGAGUCUCAUAAUUCAAGCUCUUUGCAUGUUGCAAGAGGCAGACGUGAUAGUGCAAGUGAGAGAGCAGGACAGAGAUAUCGUAAAAUCAGCCACCAAUGAAAUGAUGGACAGGUACAAGUCUAUCACCGGACAGGACUGCAACAUCACUUUGUCCAAAAAGAAUUUGCCCGGGAAAAGUAUUGGAGGCACUGUUGUCUACAACAAACGCUGUACACUAAAGGUAGACAACACACUUUACGACAGGUUGAGAAUAGUUCUGGAACAAUCGUUGCCAAUGUUCAGGGAGUUAUUAUUCAACGA
[0115] Antisense strand (SEQ ID NO: 8)
[0116] UCGUUGAAUAAUAACUCCCUGAACAUUGGCAACGAUUGUUCCAGAACUAUUCUCAACCUGUCGUAAAGUGUGUUGUCUACCUUUAGUGUACAGCGUUUGUUGUAGACAACAGUGCCUCCAAUACUUUUCCCGGGCAAAUUCUUUUUGGACAAAGUGAUGUUGCAGUCCUGUCCGGUGAUAGACUUGUACCUGUCCAUCAUUUCAUUGGUGGCUGAUUUUACGAUAUCUCUGUCCUGCUCUCUCACUUGCACUAUCACGUCUGCCUCUUGCAACAUGCAAAGAGCUUGAAUUAUGAGACUCUUUAGAACGCUGGCAUAGCCAUCUUCAGUUACACAGUUUUCCAAGCUUUGGUGGAUAUCAGUAGUCACUUCAGAUAUGAAAUUUUGUCUCGCCGUUUGCACCACCAUUUUCGCUUUUGUUAUAAUGAUUGAUUCCAAUUGGGUGACGUUUUUCUCGGCAGUUUU
[0117] dsRNA targeting target 5:
[0118] Sense strand (SEQ ID NO: 9)
[0119] AAUGAUCCUGAAUUUGUCAAGCGCCAAGAAGCCAAGUCAUCGGCUCUUGACGAACAGCUGAAAGAGUACAUCGCCGAAUGGCGCAAACAGAGGUCAAAGGAGGAGGAUGAUCUCAAAAAGCUCAAGGAGAAACAGGCCAAGCGCAAGGUCAUGCGAGCGGAAGAAGAAAAGAAAAUGGCGGAACGCAAGAAGCAAGAGGAGGAGCGCAGAGUGAAGGAGAUCGAAGAGAAGAAACAGAGAGACAUGGAAGAGAAAAGAAAGCGCUUGGAAGAGGCCGAGAAGAAGAGACAGACAAUGAUGGCGGCUCUCAAGGACCAGAGCAAAUCGAAAGGACCCAACUUCACCGUAAACAAGAAAACAGACUUGAACAUGACCUCAGCUCAAAUGGAAAGGAACAAGACUAAGGAGCAGCUGGAGGAGGAGAAGAAGAUCUCUCUGUCGUUCCGCAUCAAGCCGUUGGCCAUCGAGAACAUGAGCAUCAACGCACUGCGCGCCAAGGCCCAGGAACUGUGGGACUGCAUCGUCAAGCUCGAAACUGAGAAGUACGAUCUGGAGGAACGCCAGAA
[0120] Antisense strand (SEQ ID NO: 10)
[0121] UUCUGGCGUUCCUCCAGAUCGUACUUCUCAGUUUCGAGCUUGACGAUGCAGUCCCACAGUUCCUGGGCCUUGGCGCGCAGUGCGUUGAUGCUCAUGUUCUCGAUGGCCAACGGCUUGAUGCGGAACGACAGAGAGAUCUUCUUCUCCUCCUCCAGCUGCUCCUUAGUCUUGUUCCUUUCCAUUUGAGCUGAGGUCAUGUUCAAGUCUGUUUUCUUGUUUACGGUGAAGUUGGGUCCUUUCGAUUUGCUCUGGUCCUUGAGAGCCGCCAUCAUUGUCUGUCUCUUCUUCUCGGCCUCUUCCAAGCGCUUUCUUUUCUCUUCCAUGUCUCUCUGUUUCUUCUCUUCGAUCUCCUUCACUCUGCGCUCCUCCUCUUGCUUCUUGCGUUCCGCCAUUUUCUUUUCUUCUUCCGCUCGCAUGACCUUGCGCUUGGCCUGUUUCUCCUUGAGCUUUUUGAGAUCAUCCUCCUCCUUUGACCUCUGUUUGCGCCAUUCGGCGAUGUACUCUUUCAGCUGUUCGUCAAGAGCCGAUGACUUGGCUUCUUGGCGCUUGACAAAUUCAGGAUCAUU
[0122] dsRNA targeting target 6:
[0123] Sense strand (SEQ ID NO: 11)
[0124] AUUGAGACAACAAAAAUCAGUAUAAUGUUGAACACCAUGGGACAGAUAUUCGAUGAAGAAGAAUUGAACGCUUUGAUCAGAGAAAAUGAUCCAGACAAAUCCGGUAGACUGAACUUUGAUGGAUUUUGCCGCAUUGCAACACAUUUCCUAGAAGAAGAUGAUGCUGAAGCUAUGCAAGAAGAAUUGAAAGAAGCCUUCAGAUUGUAUGACAAAGAAGGUAACGGUUACAUCACAACGGGAACGCUGAGGGAAAUCUUGGCCGCUCUGGAUGAUAAACUGAAUAAUGAUGAUUUAGAUGGUAUCAUUGCUGAGAUCGACACUGACGGAUCAGGCACAGUCGACUUUGAUGAAUUCAUGGAGAUGAUGACAGGAGAAUAAAUGACCUGAAACGCUAUGGAGGCAAUGCCAUAUCUAUCCCUUCCAAAAAAUCCUUCAUUAAUGCAAGAUAUAAUCUUCUUCUAUCUGAUCGAGUCUGAGGCUGGAAAACUUGUGAUUC
[0125] Antisense strand (SEQ ID NO: 12)
[0126] GAAUCACAAGUUUUCCAGCCUCAGACUCGAUCAGAUAGAAGAAGAUUAUAUCUUGCAUUAAUGAAGGAUUUUUUGGAAGGGAUAGAUAUGGCAUUGCCUCCAUAGCGUUUCAGGUCAUUUAUUCUCCUGUCAUCAUCUCCAUGAAUUCAUCAAAGUCGACUGUGCCUGAUCCGUCAGUGUCGAUCUCAGCAAUGAUACCAUCUAAAUCAUCAUUAUUCAGUUUAUCAUCCAGAGCGGCCAAGAUUUCCCUCAGCGUUCCCGUUGUGAUGUAACCGUUACCUUCUUUGUCAUACAAUCUGAAGGCUUCUUUCAAUUCUUCUUGCAUAGCUUCAGCAUCAUCUUCUUCUAGGAAAUGUGUUGCAAUGCGGCAAAAUCCAUCAAAGUUCAGUCUACCGGAUUUGUCUGGAUCAUUUUCUCUGAUCAAAGCGUUCAAUUCUUCUUCAUCGAAUAUCUGUCCCAUGGUGUUCAACAUUAUACUGAUUUUUGUUGUCUCAAU
[0127] dsRNA targeting target 7:
[0128] Sense strand (SEQ ID NO: 13)
[0129] AGAAGAAGCUCAGGUUGUUGCUGAGGAAAAAGGCUGCUGAGGAAUUGAAGAAGGAACAGGAGAGGAAAGCCGCGGAAAGGAGAAGGAUCAUCGAGGAGAGGUGUGGCAAGGCUGUUGAUCUCGAUGACGGAAGUGAAGAGAAAGUCAAGGCAACUUUAAAAACCUAUCACGACAGAAUUGGAAAAUUGGAGGAUGAAAAAUUUGACCUGGAAUAUAUUGUAAAAAAGAAAGACUUCGAGAUCGCUGACCUCAACAGCCAGGUGAAUGACCUCCGUGGUAAAUUUGUCAAGCCAACCUUGAAAAAAGUCUCCAAAUAUGAGAACAAAUUCGCCAAGCUCCAGAAGAAAGCAGCUGAAUUCAAUUUCAGAAAUCAGCUCAAAGUUGUCAAGAAGAAGGAAUUCACCUUGGAAGAAGAAGACAAGGAGAAAAAGGGAAUCGUCGAUUGGUCAAAGAAGGACGAGAAGAAGGACGGCGGAGAUGGAACACCAGCUGAAGCGACAGAAGGGGCACCCGACGACGGGGACCUGCUGGACGACG
[0130] Antisense strand (SEQ ID NO: 14)
[0131] CGUCGUCCAGCAGGUCCCCGUCGUCGGGUGCCCCUUCUGUCGCUUCAGCUGGUGUUCCAUCUCCGCCGUCCUUCUUCUCGUCCUUCUUUGACCAAUCGACGAUUCCCUUUUUCUCCUUGUCUUCUUCUUCCAAG GUGAAUUCCUUCUUCUUGACAACUUUGAGCUGAUUUCUGAAAUUGAAUUCAGCCUGCUUUCUUCUGGAGCUUGGCGAAUUUGUUCUCAUAUUUGGAGACUUUUUUCAAGGUUGGCUUGACAAAUUUACCACGGAG GUCAUUCACCUGGCUGUUGAGGUCAGCGAUCUCGAAGUCUUUCUUUUUACAAUAUAUUCCAGGUCAAAUUUUUCAUCCUCCAAUUUUCCAAUUCUGUCGUGAUAGGUUUUUAAAGUUGCCUUGACUUUCUCUU CACUUCCGUCAUCGAGAUCAACAGCCUUGCCACACCUCUCCUCGAUGAUCCUUCUCCUUUCCGCGGCUUUCCCUCCUGUUCCUUCUUCAAUUCCUCAGCAGCCUUUUUCCUCAGCAACAACCUGAGCUUCUUCU
[0132] Example 2: Construction of recombinant dsRNA expression strain
[0133] To prepare dsRNA for target validation, a recombinant strain for fermentation production was first constructed. Five third-instar nymphs of the brown planthopper (N. lugens) were collected as samples, and total RNA was extracted using the Trizol method. The extracted total RNA was used as a template for reverse transcription and cDNA synthesis. Using the synthesized cDNA as a template, polymerase chain reaction (PCR) was used to amplify the target fragments listed in Table 3, referring to the reaction systems and conditions in Tables 1 and 2. For each target, only the target fragment corresponding to either the sense or antisense strand was amplified. PCR products were then separated by 1.2% agarose gel electrophoresis. The target bands were excised and recovered using a gel recovery kit and further purified to obtain highly purified desired products.
[0134] Table 1: PCR system
[0135]
[0136] Table 2: PCR amplification program
[0137]
[0138] Table 3: Target fragments corresponding to target RNA
[0139]
[0140] The pET-30a plasmid used in this example is commercially available.
[0141] The pET-30a plasmid was digested with EcoRI according to the reaction system shown in Table 4, and the reaction was incubated at 37°C for 1 hour. After the digestion reaction, the digestion products were separated by agarose gel electrophoresis and then purified by gel recovery to obtain the purified linearized plasmid.
[0142] Table 4: Enzyme digestion system
[0143]
[0144] The recovered and purified PCR product was mixed with the digested pET-30a plasmid using the ligation reaction system shown in Table 5. The reaction was allowed to proceed at 16°C for 1 hour. DNA ligase was used to allow the PCR product and the linearized plasmid to form a series of recombinant plasmids, pET-30a-target1 to pET-30a-target7, through base pairing. After the ligation reaction, the ligation product was transformed into HT115(DE3) competent cells using the heat shock method. HT115(DE3) is an RNase III-deficient Escherichia coli strain with DE3 characteristics. HT115(DE3) competent cells are commercially available.
[0145] The pET-30a-GFP recombinant plasmid used as a control was constructed in the same manner and transformed into HT115 (DE3) competent cells. The plasmid map of pET-30a-GFP is shown in Figure 1 The transformed cells were evenly spread on a plate containing kanamycin and cultured in a 37°C constant temperature incubator for 12-14 hours.
[0146] Table 5: Connection system
[0147]
[0148] After the culture was completed, single colonies were selected from the plates and amplified according to the colony PCR amplification system shown in Table 6. Positive clones that successfully transformed with the target fragments corresponding to the targets shown in Table 3 were screened and sequenced for analysis. Specifically, since the recombinant plasmid retained the double T7 promoter in the pET-30a plasmid (see Figure 1), with two T7 promoters located at either end of the target fragment, driving expression in opposite directions. Therefore, positive clones expressing either the sense or antisense strand of the target fragment will express double-stranded RNA of the corresponding target. For positive clones with correct sequencing results, glycerol was added to a final concentration of 25% as a protective agent to create glycerol stocks, which were stored in a −80°C ultra-low temperature freezer for subsequent experimental research and application.
[0149] Table 6: Colony PCR system
[0150]
[0151] Example 3: Purification of dsRNA from strain fermentation products
[0152] The recombinant bacteria were cultured in LB medium. When the OD600 value of the culture broth approached 0.4, 0.5 mM IPTG was added to induce dsRNA expression. The cells were then cultured at 37°C for 14 hours and harvested. The dsRNA was then extracted and purified from the fermentation product. The purification process primarily involved pretreatment of the fermentation broth, positive pressure-bell jar filtration, and alcohol gradient precipitation. The specific procedure is as follows:
[0153] Fermentation Broth Pretreatment: First, the dsRNA fermentation broth obtained by disrupting the cell wall of recombinant E. coli expressing the target dsRNA fragment was pretreated in a 50°C water bath and then sonicated for 30 minutes. The pH of the fermentation broth was then adjusted to 8 using Buffer A. The broth was centrifuged at 13,000 rpm and 10°C for 20 minutes in a tubular centrifuge, and supernatant A was collected. The pH of supernatant A was then adjusted to 6 using Buffer B, and the broth was centrifuged at 15,000 rpm and 5°C for 20 minutes. Supernatant B was then collected.
[0154] The specific composition of buffer A is: 0.15 M sodium bicarbonate, 0.014 M sodium tetraborate and 0.48 M sodium chloride, with a pH value of 8.5; the specific composition of buffer B is: 0.15 M citric acid, 0.18 M hydrochloric acid, 0.22 M tris(hydroxymethyl)aminomethane and 0.62 M sodium chloride, with a pH value of 4.5.
[0155] Positive pressure-bell jar double filtration: Then, the supernatant B was filtered using a positive pressure-bell jar double filtration device. The pore size of the filter column used was 0.22 µm, a cellulose filter element was used, and the pressure was maintained stable at 0.1 MPa.
[0156] Ethanol gradient precipitation: The liquid after bell-type filtration was precipitated with ethanol at a final concentration of 30% (v / v). Centrifuged at 10,000 rpm and 4°C for 20 minutes using a tubular centrifuge to collect the supernatant C. The supernatant C was allowed to stand at 10°C overnight. After a jelly-like state formed on its surface, it was stirred at a low speed of 1,000 rpm while anhydrous ethanol was gradually added to it to a final concentration of ethanol of 70% (v / v). Finally, the solid was collected by centrifugation at 15,000 rpm and 4°C for 40 minutes using a tubular centrifuge. The results of liquid chromatography analysis of the solid are shown in the figure. Figure 2 As shown, it shows that RNA with higher purity was obtained.
[0157] Through the above steps, the efficient purification of each target dsRNA was successfully achieved, providing high-quality and high-purity samples for subsequent in-depth research.
[0158] Example 4: Verification of the effects of each target dsRNA
[0159] According to the methods of Examples 2 and 3, dsRNA targeting all targets in Example 1 and GFP dsRNA were prepared, with GFP dsRNA as the control sequence; each dsRNA was dissolved in ultrapure water to a final concentration of 500 ng / μL. Brown planthopper nymphs in the third instar stage were selected as experimental subjects, and about 25 ng of dsRNA was introduced into the body of the brown planthopper by microinjection. The specific injection site was the area between the bases of the second pair of legs of the brown planthopper. In order to eliminate the interference of mechanical damage on subsequent experimental results, after completing all injection operations, the brown planthoppers were left to stand for 3 hours, and the surviving brown planthoppers were screened and transferred to glass test tubes and fed with rice seedlings as a food source. During the feeding process, the survival status of the brown planthoppers was counted at regular intervals, and the statistical results are as follows. Figure 3 On the third day after injection, the survival rates of the seven targets ranged from 10.2% to 53.7%, which were significantly lower than those of the control group (89.4%, see Figure 3 , A). On the fifth day after injection, the survival rate of the control group was 68.6%, while the survival rates of the seven targets were all below 26.3%. The survival rate of target 7 was below 10%, and the survival rates of targets 3 and 6 were reduced to 0, achieving 100% control efficacy (see Figure 3 , B). Figure 3 The results were obtained by using the Student's t test to analyze whether there were significant differences between the control group and the treatment groups. * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001.
[0160] Example 5: Effects of various target dsRNAs on target expression levels
[0161] Twenty-four hours after microinjection, samples of brown planthoppers were collected from both the experimental and control groups to examine changes in target gene expression levels in the brown planthoppers. To ensure the reliability and statistical significance of the experimental data, three biological replicates were set up for each sample group, with five brown planthopper nymphs collected from each replicate.
[0162] Total RNA was extracted from brown planthopper samples using the Trizol method. Reverse transcription was performed using the HiScript III All-in-one RTSuperMix Perfect for qPCR Kit (purchased from Vazyme) using the reaction systems shown in Table 7. The reaction conditions were: incubation at 50°C for 15 minutes, followed by rapid incubation at 85°C for 5 seconds to complete cDNA synthesis. The synthesized cDNA was diluted 6-fold for quantitative polymerase chain reaction (qPCR). For qPCR reaction system and parameter settings, refer to Tables 8 and 9.
[0163] Table 7: Reverse transcription system
[0164]
[0165] Table 8: qPCR reaction system
[0166]
[0167] Table 9: qPCR reaction conditions
[0168]
[0169] Quantitative PCR data showed that ( Figure 4 One day after microinjection, the relative mRNA expression levels of seven targets were significantly reduced, ranging from 16.0% to 72.1%. Targets 3 and 6 showed the most significant knockdown effects, with their relative expression levels dropping to 16.0% and 19.7%, respectively. Overall, the target knockdown effects mirrored the survival rate trends after microinjection, demonstrating that dsRNA can successfully enter the brown planthopper and induce gene knockdown through RNA interference, resulting in effective control. Figure 4 The results were obtained by using the Student's t-test to analyze whether there were significant differences between the control and treatment groups for each target. * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001.
[0170] Combining the experimental results of microinjection and gene knockdown, the seven target fragments can effectively cause the death of nymphs through the RNA interference mechanism, showing a good control effect on brown planthopper nymphs, indicating that these genes play a key role in the survival process of brown planthopper nymphs and have important potential and application value in the prevention and control strategy of brown planthoppers.
[0171] Example 6: Preparation of dsRNA Nanoparticle Formulations
[0172] In order to reduce the degradation effect of complex field environments on dsRNA, the present invention uses chitosan nanomaterials to encapsulate dsRNA to prepare a dsRNA nanoparticle preparation for RNA interference. The specific steps are as follows:
[0173] First, prepare a 0.1 M sodium acetate buffer and adjust the pH to 4.5 with acetic acid to obtain an acetic acid-sodium acetate buffer. Dissolve chitosan in the acetic acid-sodium acetate buffer to prepare a chitosan acetate solution with a concentration of 0.02% (w / v) chitosan. Next, dissolve dsRNA in a 50 mM Na₂SO₄ solution to obtain a dsRNA sodium sulfate solution with a dsRNA concentration of 2000 mg / L. Subsequently, the dsRNA sodium sulfate solution was slowly added dropwise to the chitosan acetate solution at a 1:1 volume ratio. After thorough mixing, the mixture was incubated at 55°C for 60 seconds. Following incubation, the mixture was rapidly vortexed for 30 seconds to produce a dsRNA-containing chitosan nanoparticle formulation. The final formulation contained 1000 mg / L of dsRNA.
[0174] Example 7: Indoor bio-test
[0175] The bioassay used a seedling immersion method to treat rice seedlings. The seedlings were treated with a solution of dsRNA (targeting targets 3 and 6, respectively) in the treatment groups, a solution containing naked dsRNA, and a dsRNA nanoformulation, respectively. Both groups were treated with 1000 mg / L of dsRNA. The control group was treated with water instead of the dsRNA solution. The specific groups are shown in Table 10.
[0176] Table 10: Grouping of indoor biological tests
[0177]
[0178] Select fresh rice seedlings, rinse them with clean water and dry them in the air. Soak the whole rice seedling in the soaking liquid for 4 seconds, then take it out and place it in a cool and ventilated place to dry naturally. Then, wrap the roots of the rice seedlings with soaked cotton and place them in glass test tubes, with three rice plants in each test tube. Select 15 healthy and active third-instar brown planthopper nymphs raised indoors, put them in the test tubes, seal them with absorbent cotton balls, and place them on a plant culture rack at 25±2℃ with 12 hours of light and dark alternation for cultivation. Figure 5 Each treatment was replicated four times, and the survival rate of brown planthoppers was measured after five days. The survival rate was calculated as follows: Survival rate (%) = (number of surviving insects / total number of insects) × 100%.
[0179] After 3 days of treatment, samples of brown planthoppers from the treatment and control groups were collected to detect the expression levels of the target genes. Figure 6 Compared to the control group, the mRNA expression levels of each gene in the naked dsRNA treatment group decreased by 15.8%-31.9%, while the mRNA expression levels of each gene in the dsRNA formulation group decreased by 54.5%-79.3%, showing significant differences from both the control group and the naked dsRNA group. These results clearly demonstrate that nanoparticle formulation carriers prepared using chitosan can greatly enhance the silencing effect of dsRNA on target genes, more effectively inhibiting target gene expression. Figure 6 The results in the table are the difference significance analysis of each group using ANOVA, where the same letters indicate no significant difference between the groups, and different letters indicate significant difference between the groups (P<0.05).
[0180] After 5 days of treatment, the survival rate of each group of brown planthoppers was measured as follows: Figure 7 The survival rate of brown planthoppers in the control group ranged from 82.7% to 86.4%. In comparison, the survival rate of brown planthoppers in the naked dsRNA group decreased slightly, while the survival rate of brown planthoppers in the dsRNA formulation group decreased significantly. Among them, the survival rate of brown planthoppers treated with the nanoformulation of target 6 was 11.6%, while the control effect of target 3 was even better, with a survival rate of only 7.2%. Figure 7 The results were obtained by ANOVA analysis of the differences between the groups. The same letters indicate no significant differences between the groups, and different letters indicate significant differences between the groups (P < 0.01).
[0181] Example 8: Comparison of the effects of dsRNA formulations and conventional chemical pesticides
[0182] To comprehensively evaluate the control efficacy of dsRNA formulations, this example compared the control efficacy of the conventional chemical pesticide acetamiprid with that of a dsRNA formulation targeting target 3 against brown planthoppers. A 50 mg / L acetamiprid solution was prepared, and a 500 mg / L dsRNA formulation was prepared using the method of Example 7. Nipples of brown planthoppers were treated using the seedling immersion method described in Example 7, and their survival rates were measured.
[0183] like Figure 8 As shown in the results, after 3 days of treatment, acetamiprid and dsRNA formulations showed significant lethality, with survival rates of around 50%. After 5 days of treatment, the survival rates of brown planthoppers in the acetamiprid and dsRNA formulations groups dropped to only 9.3% and 16.3%, respectively, both significantly lower than those in the control group (P < 0.01). However, there was no significant difference in survival rates between the acetamiprid and dsRNA formulations groups (P > 0.05). Figure 8 The results were obtained using ANOVA analysis of significance between groups. Identical letters indicate no significant differences between groups, while different letters indicate significant differences (P < 0.01). These results demonstrate that dsRNA formulations are comparable in effectiveness against brown planthoppers as the conventional chemical pesticide acetamiprid. However, dsRNA formulations offer significant advantages over traditional chemical pesticides such as acetamiprid in their environmental friendliness and pollution-free nature. This suggests that RNA-based biological control of rice brown planthoppers is a highly effective and promising method, offering promising prospects for future development in agricultural pest control.
[0184] The present invention has at least one of the following beneficial effects:
[0185] 1. Compared with traditional chemical pesticides, the dsRNA provided by the present invention, as a biological pesticide, has the characteristics of high efficiency, specificity, rapid degradation and no residue. It can achieve the prevention and control of brown planthoppers through the RNAi mechanism, which helps to reduce the use of chemical pesticides, improve the quality of agricultural products, meet consumers' demand for green and pollution-free food, and open up a new path for the green and sustainable development of agriculture.
[0186] 2. The present invention provides new brown planthopper target genes as targets for RNA interference. As can be seen from the survival rate results, these genes play an important role in the survival process of brown planthoppers and are effective targets for the prevention and control of brown planthoppers using gene silencing methods, with broad application prospects. Accordingly, the present invention provides multiple dsRNA sequences targeting these targets, some of which show unprecedented brown planthopper prevention and control efficiency. These dsRNAs can accurately interfere with the key genes of brown planthoppers, thereby effectively inhibiting their reproduction and survival and reducing damage to crops; compared with the dsRNA in the prior art, the dsRNA sequences provided by the present invention have better prevention and control effects, which is conducive to reducing the amount of dsRNA used, thereby reducing the prevention and control costs, and creating favorable conditions for the promotion and application of nucleic acid pesticides.
[0187] 3. While most current studies utilize in vitro transcription kits to synthesize small amounts of dsRNA, the present invention utilizes E. coli fermentation to produce dsRNA, obtaining high-purity dsRNA through positive pressure-bell-jar dual filtration and alcohol gradient precipitation. This method is low-cost, simple to operate, and capable of large-scale production, breaking the limitations of traditional production methods and providing a viable solution for the industrialized production of dsRNA.
[0188] 4. This invention utilizes a nanoparticle carrier that can rapidly penetrate the insect body wall and efficiently enter living cells, achieving high dsRNA delivery efficiency and gene interference efficacy. This nanoparticle carrier provides new technological reserves for the development of RNA formulations and pest control.
Claims
1. A double-stranded RNA targeting Hemiptera insects, characterized in that: The double-stranded RNA targeting Hemiptera insects comprises a sense strand and an antisense strand, wherein: the nucleotide sequence of the sense strand is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:
2.
2. An expression vector, characterized in that: The expression vector comprises the sense strand or antisense strand of the double-stranded RNA targeting Hemiptera insects as claimed in claim 1.
3. A host cell, characterized in that The host cell comprises the sense strand or antisense strand of the double-stranded RNA targeting Hemiptera insects according to claim 1, or the expression vector according to claim 2.
4. A method for preparing the double-stranded RNA targeting Hemiptera insects according to claim 1, comprising expressing the RNA using the expression vector according to claim 2, or expressing the RNA using the host cell according to claim 3.
5. The method according to claim 4, wherein The method comprises the following steps: S1: Extract RNA from brown planthopper; S2: cDNA was obtained by reverse transcription using RNA from brown planthopper as template; S3: Using cDNA as a template, amplify the target sequence by PCR; S4: Clone the target sequence into the plasmid to obtain a recombinant plasmid vector; S5: Transform the recombinant plasmid vector into competent cells, and use the competent cells transformed with the recombinant plasmid vector as host cells; S6: culturing the host cells, using an inducer to induce the host cells to express double-stranded RNA targeting Hemiptera insects, and obtaining a fermentation liquid; S7: Purification of double-stranded RNA targeting Hemiptera insects from fermentation broth.
6. The method according to claim 5, wherein In step S7, the purification step includes: S7-1: fermentation broth pretreatment; S7-2: Positive pressure-bell jar type two-way filtration; S7-3: Ethanol gradient precipitation.
7. A pesticide composition, characterized in that The pesticide composition comprises an effective amount of the double-stranded RNA targeting Hemiptera insects according to claim 1, and a pharmaceutically acceptable carrier.
8. The pesticide composition according to claim 7, wherein The carrier is chitosan nanoparticles.
9. A method for preparing the pesticide composition according to claim 7 or 8, characterized in that: The method comprises adding the double-stranded RNA targeting Hemiptera insects according to claim 1 and a pharmaceutically acceptable carrier into a solvent.
10. The method according to claim 9, wherein The method comprises the following steps: S1: dissolving chitosan with acetate buffer to obtain chitosan acetate solution; dissolving dsRNA with sodium sulfate solution to obtain dsRNA sodium sulfate solution; S2: slowly adding the dsRNA sodium sulfate solution to the chitosan acetate solution, mixing thoroughly, incubating, and vortexing after incubation to obtain a dsRNA chitosan nanoparticle preparation.
11. Use of the double-stranded RNA targeting Hemiptera insects as claimed in claim 1 in controlling brown planthopper.
12. Use of the pesticide composition according to claim 7 or 8 in controlling brown planthopper.
Citation Information
Patent Citations
Method for extracting dsRNA
CN114921457A