Tumor cell detection probe based on bispecific aptamer and application thereof

Abstract

The invention discloses a tumor cell detection probe based on a bispecific nucleic acid aptamer and application of the tumor cell detection probe. The tumor cell detection probe comprises a bivalent nucleic acid aptamer combined with a marker, and the bivalent nucleic acid aptamer is formed by connecting a DNA nucleic acid aptamer targeting EpCAM and a DNA nucleic acid aptamer targeting CD71 through a chemical reaction; the sequence of the DNA aptamer of the targeted EpCAM is as shown in SEQ ID No: 1; the DNA nucleic acid aptamer sequence of the targeted CD71 is as shown in SEQ ID No: 2. According to the tumor cell detection probe, high-sensitivity and high-specificity tumor cell liquid detection or biopsy can be realized, and false negative results caused by single EpCAM targeting technology recognition are reduced.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a tumor cell detection probe based on a bispecific nucleic acid aptamer and an application thereof. Background Art

[0002] The detection of circulating tumor cells is an important means of cancer screening, and the development of highly sensitive and highly specific recognition probes is the key to improving detection capabilities. Epithelial Cellular Adhesion Molecule (EpCAM) is a transmembrane protein highly expressed on the surface of tumor cells. It plays a key role in tumor proliferation, metastasis, epithelial-mesenchymal transition, immune escape and other processes. Therefore, EpCAM has unique value in the treatment, diagnosis and prognosis of tumors. As a commonly used circulating tumor cell (CTC) marker, EpCAM has many studies that have confirmed its value as a diagnostic in the early or metastatic stages of cancers such as breast cancer, colorectal cancer, and prostate cancer. CellSearch based on EpCAM recognition is also the only product in the world that has been successfully approved for CTC detection.

[0003] Epithelial-mesenchymal transition (EMT) is the process of epithelial cells transforming into mesenchymal cells, which plays an important role in the occurrence, development and metastasis of tumors. This process is often accompanied by a decrease in the expression of epithelial cell markers and an increase in the level of mesenchymal cell markers. Therefore, in the actual process of tumor progression, the expression level of EpCAM on the surface of tumor cells cannot always maintain a high expression state. The expression of EpCAM during EMT decreases significantly, greatly reducing the accuracy and sensitivity of circulating tumor cell detection technology based on EpCAM recognition. Therefore, the development of bispecific targeted probes can improve the ability to recognize tumor cells.

[0004] Transferrin receptor (CD71) is an important membrane protein for iron transport on the cell membrane surface. Due to abnormal tumor metabolism, CD71 is highly expressed on the surface of many tumor cells. It is also one of the potential targets for tumor diagnosis and treatment.

[0005] Nucleic acid aptamers are single-stranded DNA or RNA with a specific structure consisting of 15-80 bases. They have excellent properties such as low molecular weight, high stability, high specificity, and modifiability, and are therefore called "chemical antibodies."

[0006] Based on its highly programmable characteristics, the valence of nucleic acid aptamers can be increased through convenient chemical reactions, enzymatic reactions, etc. Compared with traditional single nucleic acid aptamers, multivalent nucleic acid aptamers are a special type of nucleic acid aptamers that have multiple binding sites and can synergistically bind to multiple target molecules at the same time. Multivalent nucleic acid aptamers are usually constructed by connecting single nucleic acid aptamer units together, thereby increasing their affinity and specificity for binding targets and improving their application potential in biology and medicine. Multivalent nucleic acid aptamers with multiple specificities can significantly enhance their ability to bind to targets while improving the sensitivity of recognition, thereby achieving accurate recognition of target cells. Summary of the invention

[0007] The present invention provides a tumor cell detection probe based on a bispecific nucleic acid aptamer, which can realize high-sensitivity and high-specificity tumor cell liquid detection or biopsy, and reduce the false negative results caused by single EpCAM targeting technology identification.

[0008] The technical solution of the present invention is as follows:

[0009] A tumor cell detection probe based on a bispecific nucleic acid aptamer, comprising a bivalent nucleic acid aptamer combined with a marker, wherein the bivalent nucleic acid aptamer is formed by connecting a DNA nucleic acid aptamer targeting EpCAM and a DNA nucleic acid aptamer targeting CD71 through a chemical reaction;

[0010] The DNA aptamer sequence targeting EpCAM is shown in SEQ ID No: 1; the DNA aptamer sequence targeting CD71 is shown in SEQ ID No: 2.

[0011] The DNA aptamer sequence targeting EpCAM is:

[0012] TCATATTGGGGACGGTGTAGTCCATAACTAAAGCAGTCTGGTGG ACATTTTTAGAGTATGA;

[0013] The DNA aptamer sequence targeting CD71 is:

[0014] CTAGGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCCTAG.

[0015] Preferably, in the DNA aptamer targeting EpCAM and the DNA aptamer targeting CD71, the 3' or 5' end of one aptamer is modified with an azide group (-N3), and the 3' or 5' end of the other aptamer is modified with a dipropyl cyclooctyne group (-DBCO), and the two aptamers are connected by a click chemistry reaction; the 3' or 5' end of one of the aptamers is modified with a marker.

[0016] Preferably, the method for preparing the bivalent nucleic acid aptamer combined with a marker comprises:

[0017] (1) mixing a solution of a DNA aptamer targeting EpCAM modified with an azide group (-N3) or a dipropylcyclooctyne group (-DBCO) with a solution of a DNA aptamer targeting CD71 modified with a dipropylcyclooctyne group (-DBCO) or an azide group (-N3); wherein the 3' or 5' end of one of the DNA aptamers is modified with a marker;

[0018] (2) The mixed solution of step (1) is reacted at 20 to -20°C to obtain a bivalent nucleic acid aptamer bound to a label.

[0019] Preferably, the concentration of the DNA aptamer solution is 10uM, the volume of the reaction system is 20ul, and the solvent used for the aptamer mixture contains 1mM Mg 2+ of ultrapure water.

[0020] In step (2), the mixed solution of step (1) is reacted at 20 to -20°C for 1 to 5 hours.

[0021] Preferably, the marker is a fluorescent molecule.

[0022] Furthermore, the fluorescent molecule is Cy5.

[0023] The present invention also provides an application of the tumor cell detection probe based on the bispecific nucleic acid aptamer in the preparation of a product for detecting tumor cells in body fluids.

[0024] The body fluid is blood or urine; the tumor cells are human ovarian cancer cells or human bladder cancer cells.

[0025] The present invention also provides an application of the tumor cell detection probe based on the bispecific nucleic acid aptamer in the preparation of a product for detecting tumor cells in living tissues.

[0026] The tumor cells are human colorectal cancer cells, human breast cancer cells or human gastric cancer cells.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] (1) Compared with the single EpCAM targeting technology, the tumor cell detection probe based on the bispecific nucleic acid aptamer of the present invention can avoid the problem of insufficient recognition ability for EpCAM-negative tumor cells, significantly improve the affinity and sensitivity for target cells, and can accurately identify tumor cells in a complex body fluid environment;

[0029] (2) The tumor cell detection probe based on the bispecific nucleic acid aptamer of the present invention is more stable in vivo and accumulates more significantly in the target tissue than the monovalent nucleic acid aptamer. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a schematic diagram of the working principle of the tumor cell detection probe of the present invention;

[0031] Figure 2 This is a polyacrylamide gel electrophoresis diagram of the bivalent nucleic acid aptamer prepared in Example 1, wherein lane 1 is the CD71 aptamer, lane 2 is the EpCAM aptamer, and lane 3 is the bivalent nucleic acid aptamer;

[0032] Figure 3 The electrophoresis diagram of the stability of different nucleic acid aptamers in 10% fetal bovine serum in Example 2;

[0033] Figure 4 The analysis diagrams of the binding ability of different nucleic acid aptamers to cells in Example 2; (a) is the binding with non-cancerous cell L-02; (b) is the binding with CD71-positive EpCAM-negative cell CCRF-CEM; (c) is the binding with CD71-positive EpCAM-positive cell SW620; (d) is the binding with CD71-positive EpCAM-positive cell N87; (e) is the binding with CD71-positive EpCAM-positive cell HT29; (f) is the binding with CD71-positive EpCAM-positive cell 5637; (g) is the binding with CD71-positive EpCAM-positive cell OVCAR3;

[0034] Figure 5 Figures are affinity analysis diagrams of different aptamers at different concentrations and target cells in Example 2; (a) shows the binding to 5637, HT29, N87, OVCAR3, and SW620 cells at a concentration of 5 nM; (b) shows the binding to 5637, HT29, N87, OVCAR3, and SW620 cells at a concentration of 15 nM; (c) shows the binding to 5637, HT29, N87, OVCAR3, and SW620 cells at a concentration of 25 nM;

[0035] Figure 6 This is a graph analyzing the binding stability of the bivalent nucleic acid aptamer and the EpCAM aptamer to the target cells in Example 2;

[0036] Figure 7The following are analysis diagrams of the ability of the bivalent nucleic acid aptamer OVCAR3 cells in detecting tumor cells in the blood in Example 3; (a) is a flow cytometry scatter plot of the bivalent aptamer detecting tumor cells in the blood containing 200,000 calcein-labeled tumor cells; (b) is a statistical analysis of the bivalent aptamer detecting tumor cells in the blood containing different numbers of tumor cells;

[0037] Figure 8 This is a diagram analyzing the binding of the bivalent nucleic acid aptamer, EpCAM aptamer, CD71 aptamer and 5637 cells in artificial urine in Example 3;

[0038] Fig. 9 The results of the detection of tumor tissues by the bivalent aptamer and the monovalent aptamer in Example 4 in OVCAR3 tumor-bearing mice; (a) is the fluorescence imaging image collected by IVIS at different time points after the mice were injected with different nucleic acid aptamers; (b) is the statistical graph of the fluorescence values ​​of the tumor site at different time points; (c) is the fluorescence imaging image of the main tissues and organs and tumors of the mice 12 hours after injection. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be pointed out that the embodiments described below are intended to facilitate the understanding of the present invention and do not have any limiting effect on the present invention.

[0040] like Figure 1 As shown in the figure, the EpCAM single-targeting strategy is limited by the downregulation of EpCAM expression during the epithelial-mesenchymal transition process in the process of identifying tumor cells, and cannot accurately identify target cells. However, bispecific nucleic acid aptamers can enhance the affinity of aptamers to target cells and reduce off-target effects. At the same time, they can reduce the probability of false negatives in the single EpCAM targeting process, greatly improving the accuracy of tumor cell identification and detection.

[0041] Example 1

[0042] Preparation of EpCAM-CD71 bispecific bivalent nucleic acid aptamer

[0043] First, EpCAM nucleic acid aptamers modified with an azide group at the 3' or 5' end and CD71 nucleic acid aptamers modified with a DBCO group and Cy5 at the 3' or 5' end were synthesized. All materials were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0044] The nucleotide sequence of the EpCAM-targeting aptamer is:

[0045] TCATATTGGGGACGGTGTAGTCCATAACTAAAGCAGTCTGGTGG ACATTTTTAGAGTATGA;

[0046] The nucleotide sequence of the CD71 targeting nucleic acid aptamer is:

[0047] CTAGGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCCTAG.

[0048] The two modified aptamer single chains were added to ultrapure water containing 1mM magnesium ions, so that the final concentration of each aptamer was 10uM. After mixing evenly, the mixture was placed at 20 to -20°C for a reaction time of 4 hours. The reaction results were verified by 8% polyacrylamide gel electrophoresis (PAGE, 1×TBE, 100V, 40min). The results showed that the EpCAM aptamer could be successfully coupled to the CD71 aptamer. The experimental results are shown in Figure 2. Figure 2 shown.

[0049] Example 2

[0050] Study on the biological properties of EpCAM-CD71 bispecific bivalent nucleic acid aptamer.

[0051] In order to study the biological stability of the synthesized bivalent nucleic acid aptamers, the specific operations are as follows: 1uM of EpCAM-CD71 bivalent nucleic acid aptamer, EpCAM monovalent nucleic acid aptamer, and CD71 monovalent nucleic acid aptamer were diluted to 1uM with DMEM culture medium containing 10% fetal bovine serum, and stored at 37°C. After 0, 1, 2, 6, 8, 10, and 12 hours, 10ul was respectively aspirated, the protein was denatured at 95°C, and stored at -20°C. After the samples at the last time point were collected completely, they were melted uniformly and verified using 8% polyacrylamide gel electrophoresis. The results showed that the three nucleic acid chains would be degraded to varying degrees over time, but the bivalent nucleic acid aptamer could still have obvious residues after 12 hours, and its stability was significantly better than that of the monovalent nucleic acid aptamer. The results are as follows Figure 3 shown.

[0052] In order to study the specific binding ability of the prepared bivalent nucleic acid aptamer probe to target cells, the Cy5-labeled library sequence was first synthesized as a control. Then, cell lines with high expression of EpCAM and CD71 (human colorectal cancer cells SW620, HT29, human ovarian cancer cells OVCAR3, human gastric cancer cells N87, human bladder cancer cells 5637), cell lines with high expression of CD71 and almost no expression of EpCAM (human T cell leukemia cells CCRF-CEM) and human normal liver cells L-02 were selected and incubated with different aptamers. The specific steps are as follows: use enzyme-free cell digestion solution to digest SW620, HT29, OVCAR3, N87, 5637, and L-02 cells into single-cell suspensions, use binding buffer (DPBS, 4.5 g / L glucose, 5 mM magnesium chloride, 0.1 mg / ml tRNA, and 1 mg / ml BSA4) to resuspend 200,000 cells in each portion in a 100 ul system, and use 2.5 nM Cy5-labeled EpCAM-CD71 bivalent nucleic acid aptamer, EpCAM monovalent nucleic acid aptamer, CD71 monovalent nucleic acid aptamer, and non-targeted Library sequence. After incubation at 4°C for 40 minutes, wash 3 times, and detect using Beckman CytoFLEX LX flow cytometer. The results showed that at an extremely low concentration of 2.5 nM, for cell lines with high expression of both EpCAM and CD71, the binding ability of the EpCAM-CD71 bivalent nucleic acid aptamer at all concentrations was better than that of the monovalent nucleic acid aptamer. For cell lines with negative EpCAM expression and high CD71 expression, the EpCAM single-target aptamer lost its binding ability, while the bivalent nucleic acid aptamer was able to maintain its recognition ability for this type of cell. At the same time, for normal human cell lines such as L-02, the bivalent nucleic acid aptamer was able to maintain a weak signal, indicating that the bivalent aptamer is highly specific to tumor cells. The results are as follows Figure 4 shown.

[0053] In order to study the affinity of the prepared bivalent nucleic acid aptamer probe to the target cells, the Cy5-labeled EpCAM-CD71 bivalent nucleic acid aptamer was synthesized according to Implementation 1, and SW620, HT29, OVCAR3, N87, 5637 were selected. After digestion to single cells with enzyme-free digestion solution, 200,000 cells were resuspended in 100ul binding buffer, and incubated at 4°C for 40min with 0.5, 5, 15, and 25nM Cy5-labeled bivalent nucleic acid aptamer, EpCAM monovalent nucleic acid aptamer, and CD71 monovalent nucleic acid aptamer, respectively, and detected using Beckman CytoFLEX LX flow cytometer. The results showed that at each incubation concentration, the bivalent nucleic acid aptamer showed a stronger fluorescence signal, indicating that the bivalent nucleic acid aptamer has a stronger affinity for the target cells. The results are as follows Figure 5 shown.

[0054] In order to study the stability of the prepared bivalent nucleic acid aptamer probe binding to the target cell, the Cy5-labeled EpCAM-CD71 bivalent nucleic acid aptamer was synthesized according to Implementation 1, and SW620, HT29, OVCAR3, N87, and 5637 were selected. After digestion to single cells with enzyme-free digestion solution, they were incubated with Cy5-labeled bivalent nucleic acid aptamer and EpCAM single-target nucleic acid aptamer at a concentration of 20nM in binding buffer at 4°C for 40min, washed 3 times, and 100ul was taken at 0, 10, 20, 30, 40, 50, and 60min time points for detection using Beckman CytoFLEX LX flow cytometer. The results showed that after the EpCAM-CD71 bivalent nucleic acid aptamer bound to the target cell, the signal displacement over time was significantly lower than that of the EpCAM monovalent nucleic acid aptamer, and the binding strength was higher. The specific results are as follows Figure 6 shown.

[0055] Example 3

[0056] Study on the detection of tumor cells in body fluids using EpCAM-CD71 bispecific bivalent nucleic acid aptamer probe.

[0057] In order to study the ability of EpCAM-CD71 bivalent nucleic acid aptamer to detect tumor cells in blood, Cy5-labeled EpCAM-CD71 bivalent nucleic acid aptamer was synthesized according to implementation 1, and an appropriate amount of SD rat blood was prepared, and red blood cells were removed by adding red blood cell lysis solution to obtain a colorless blood cell suspension. The purpose of adding red blood cell lysis solution here is to reduce the interference with later detection. The specific operation is as follows: first, OVCAR3,5637 cells were digested into a single cell suspension using enzyme-free digestion solution, stained with calcein dye for 30 minutes, and then washed 3 times. 500ul of each rat blood cell after lysis was taken, and different numbers (1000, 10000, 50000, 100000, 200000) of calcein-labeled tumor cells were added. At the same time, a portion of blood cells without tumor cells was prepared, and incubated with 20nM Cy5-labeled EpCAM-CD71 bivalent nucleic acid aptamer at 4 degrees Celsius for 40 minutes, and then washed 3 times. Among them, the blood cell tumor cell mixture with 200,000 tumor cells added needed an additional portion to be prepared without adding aptamer incubation as a negative control, and was detected using Beckman CytoFLEX LX flow cytometer. The results showed that the EpCAM-CD71 bispecific nucleic acid aptamer probe can well distinguish the injected tumor cells in the blood cells, and has the ability to be used as a circulating tumor cell detection probe. The specific results are shown in Figure 7 shown.

[0058] Study on the detection of tumor cells in urine using EpCAM-CD71 bispecific bivalent nucleic acid aptamer probe.

[0059] In order to study the ability of EpCAM-CD71 bivalent nucleic acid aptamer to detect tumor cells in urine, Cy5-labeled EpCAM-CD71 bivalent nucleic acid aptamer was synthesized according to Implementation 1. The specific implementation steps are as follows: 5637 cells were digested into a single cell suspension using enzyme-free cell digestion solution, 200,000 cells were reselected in a 100ul system using commercial artificial urine buffer, and 2.5nM Cy5-labeled EpCAM-CD71 bivalent nucleic acid aptamer, EpCAM monovalent nucleic acid aptamer, CD71 monovalent nucleic acid aptamer and Library sequence were incubated at 4°C for 40min, washed 3 times, and detected using Beckman CytoFLEX LX flow cytometer. The results showed that in a simulated urine environment, the ability of EpCAM-CD71 bivalent nucleic acid aptamer to bind to bladder cancer cells was better than that of monovalent nucleic acid aptamer, and it has the ability to detect bladder cancer tumor cells in urine. The specific results are as follows: Figure 8 shown.

[0060] Example 4

[0061] Study on the application of EpCAM-CD71 bispecific bivalent nucleic acid aptamer probe in tumor imaging in animals.

[0062] In order to study the imaging ability of EpCAM-CD71 bivalent nucleic acid aptamer in tumor tissue in animals, Cy5-labeled EpCAM-CD71 bivalent nucleic acid aptamer was synthesized according to Example 1. The specific implementation steps are as follows: At 6 weeks of age, female nude mice were used to construct an OVCAR3 subcutaneous tumor model. Specifically, 5 million tumor cells were inoculated subcutaneously in each mouse, and when the tumor size reached 100 mm 3 Around 1:10 pm, 150 nmoles / kg of Cy5-labeled bivalent aptamers, EpCAM aptamers, and CD71 aptamers were intravenously injected, and then IVIS was used for imaging at different time points (1, 3, 6, and 12 h). After the 12-h time point, the mice were dissected, and the heart, liver, spleen, lung, kidney, and tumor tissues were taken, and the organ tissues were imaged using IVIS. The fluorescent signals of the tumor sites of the mice after imaging at different time points were quantified. The results showed that the accumulation level and retention time of bivalent aptamers in tumor tissues were better than those of monovalent aptamers. The specific results are as follows: Fig. 9 shown.

[0063] The embodiments described above provide a detailed description of the technical solutions and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements and equivalent substitutions made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A tumor cell detection probe based on a bispecific nucleic acid aptamer, characterized in that: It includes a bivalent nucleic acid aptamer combined with a marker, wherein the bivalent nucleic acid aptamer is formed by connecting a DNA nucleic acid aptamer targeting EpCAM and a DNA nucleic acid aptamer targeting CD71 through a chemical reaction; The DNA aptamer sequence targeting EpCAM is shown in SEQ ID No: 1; the DNA aptamer sequence targeting CD71 is shown in SEQ ID No:

2.

2. The tumor cell detection probe based on bispecific nucleic acid aptamer according to claim 1, characterized in that: In the DNA aptamer targeting EpCAM and the DNA aptamer targeting CD71, the 3' or 5' end of one aptamer is modified with an azide group, and the 3' or 5' end of the other aptamer is modified with a dipropyl cyclooctyne group, and the two aptamers are connected by a click chemistry reaction; the 3' or 5' end of one of the aptamers is modified with a marker.

3. The tumor cell detection probe based on bispecific nucleic acid aptamer according to claim 1 or 2, characterized in that: The method for preparing the bivalent nucleic acid aptamer combined with a marker comprises: (1) mixing a solution of a DNA aptamer targeting EpCAM modified with an azide group or a dipropylcyclooctyne group and a solution of a DNA aptamer targeting CD71 modified with a dipropylcyclooctyne group or an azide group; wherein the 3' or 5' end of one of the DNA aptamers is modified with a marker; (2) The mixed solution of step (1) is reacted at 20 to -20°C to obtain a bivalent nucleic acid aptamer bound to a label.

4. The tumor cell detection probe based on bispecific nucleic acid aptamer according to claim 3, characterized in that: The concentration of DNA aptamer solution was 10uM, the volume of the reaction system was 20ul, and the solvent used for aptamer mixing contained 1mM Mg 2+ of ultrapure water.

5. The tumor cell detection probe based on bispecific nucleic acid aptamer according to claim 3, characterized in that: In step (2), the mixed solution of step (1) is reacted at 20 to -20°C for 1 to 5 hours.

6. Use of the tumor cell detection probe based on bispecific nucleic acid aptamer according to any one of claims 1 to 5 in preparing a product for detecting tumor cells in body fluids.

7. The use according to claim 6, characterized in that: The body fluid is blood or urine; the tumor cells are human ovarian cancer cells or human bladder cancer cells.

8. Use of the bispecific nucleic acid aptamer-based tumor cell detection probe according to any one of claims 1 to 5 in the preparation of a product for detecting tumor cells in living tissues.

9. The use according to claim 8, characterized in that: The tumor cells are human colorectal cancer cells, human breast cancer cells or human gastric cancer cells.

Images