Aedes albopictus aalClk gene and dsRNA and application thereof

Abstract

The invention discloses an aedes albopictus aalClk gene as well as dsRNA (double-stranded ribonucleic acid) and application thereof. The nucleotide sequence of the aedes albopictus Clock gene is shown as SEQ ID NO: 5. The sequence of the dsRNA is as shown in SEQ ID NO: 8. The invention also provides an application of the aedes albopictus specific dsRNA in regulation of aedes albopictus aalClk gene, and an application of the aedes albopictus specific dsRNA in preparation of a product for regulating diapause of aedes albopictus and a novel vector control product for regulating diapause of aedes albopictus so as to realize suppression of vector population.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an Aedes albopictus aalClk gene and a dsRNA and application thereof. Background Art

[0002] Aedes albopictus is one of the 100 most invasive species in the world. It is an important vector mosquito that can spread dengue fever, Zika virus disease, etc., seriously threatening people's lives and health and increasing the economic burden. In recent years, global warming and rapid globalization and urbanization have provided favorable conditions for the continuous invasion and expansion of Aedes albopictus. Diapause is a state of growth and development stagnation caused by insects to resist adverse environments. It is a programmed behavior of insects in response to environmental changes. It is regulated by a series of genes. Diapause behavior is used to avoid extreme environments and ensure population density and survival rate after environmental recovery. It is also the biological basis for the rapid expansion of Aedes albopictus. Aedes albopictus regulates the diapause rate of offspring eggs by responding to changes in the photoperiod. It enters diapause to overwinter under diapause-inducing short photoperiod (Short Day, SD) and hatches normally under non-diapause-inducing long photoperiod (Long Day, LD). At present, the means of controlling vector-borne diseases is mainly to control vector organisms, while the current strategy for controlling the Aedes albopictus population still tends to focus on environmental management and the use of chemical pesticides. There is still a lack of economical, accurate, efficient, safe and non-toxic prevention and control methods. Exploring new methods to regulate the photoperiodic diapause behavior of Aedes albopictus so that it cannot overwinter is of great significance in the prevention and control of Aedes albopictus.

[0003] RNA interference refers to the phenomenon induced by homologous double-stranded RNA (dsRNA), which leads to the specific and efficient degradation or translation inhibition of homologous mRNA, thereby silencing the expression of the target gene. The silencing of the target gene will lead to the weakening or even loss of its biological function. Silencing the target gene through RNA interference can weaken the biological function of the target gene, thereby achieving the effect of regulating the behavior and survival rate of insects according to needs.

[0004] The Clock gene of Aedes albopictus Circadian locomoter output cyclesprotein kaput (hereinafter referred to as aalClk, where aal is the abbreviation of the species name of Aedes albopictus) is the core regulatory factor of its circadian clock. The Clk gene encodes a member of the bHLH transcription factor family, which can form a heterodimer with the CYC protein expressed by the Cycle gene and bind to the cis-regulatory elements of the target gene, playing a key role in the regulation of biological rhythms. Summary of the invention

[0005] The purpose of the present invention is to provide an Aedes albopictus aalClk gene.

[0006] The present invention also aims to provide a dsRNA specifically targeting the aalClk gene of Aedes albopictus and its application in regulating the aalClk gene of Aedes albopictus, in preparing a product for regulating the diapause of Aedes albopictus, and in preparing a new vector control product for regulating the diapause of Aedes albopictus to achieve vector population suppression.

[0007] The last object of the present invention is to provide a method for regulating the diapause behavior of Aedes albopictus.

[0008] The first object of the present invention can be achieved by the following technical solution: an Aedes albopictus aalClk gene, the sequence of the Aedes albopictus aalClk gene is shown in SEQ ID NO:5.

[0009] The present invention relies on the insect diapause and molecular function research platform of our team. Through systematic studies such as multi-omics screening, gene identification and functional verification, we screened, identified and found that the aalClk gene plays a key regulatory role in the photoperiodic diapause behavior of Aedes albopictus. We further obtained the aalClk gene sequence of Aedes albopictus, whose open reading frame is 2634bp and whose nucleotide sequence is shown in SEQ ID NO: 5.

[0010] The above second object of the present invention can be achieved by the following technical solution: a dsRNA specifically targeting the aalClk gene of the Aedes albopictus, the sequence of the dsRNA is shown in SEQ ID NO:8.

[0011] The aalClk gene sequence was analyzed, and upstream and downstream primers (SEQ ID NO: 6, SEQ ID NO: 7) were designed based on the obtained SEQ ID NO: 5. The product length was about 400 to 800 bp. The product was predicted, and further homology analysis was performed based on the gene database platform established by our team. The RNA interference sequence fragment of the aalClk gene of Aedes albopictus was designed and targeted, and its nucleotide sequence is shown in SEQ ID NO: 8.

[0012] A primer pair containing a T7 promoter sequence was further designed based on the RNA interference sequence fragment of the aalClk gene of Aedes albopictus, and the nucleic acid sequences thereof are shown in SEQ ID NO:9 and SEQ ID NO:10.

[0013] The RNA interference sequence fragment dsRNA synthetic template with T7 promoter is amplified and prepared, and dsRNA is synthesized by relevant kits. The sequence of the synthesized dsRNA after enzyme digestion is consistent with the RNA interference sequence fragment of aalClk gene of Aedes albopictus, and its single sequence is shown in SEQ ID NO: 8.

[0014] It should be pointed out that it is well known to those skilled in the art that t in the dsRNA sequence should be replaced by u. However, for the sake of simplicity, the complete sequence in which t is replaced by u is no longer separately indicated in the present invention.

[0015] The present invention also provides the use of the Aedes albopictus-specific dsRNA in regulating the aalClk gene of Aedes albopictus, in preparing a product for regulating the diapause of Aedes albopictus, and in preparing a novel vector control product for regulating the diapause of Aedes albopictus to achieve vector population suppression.

[0016] The present invention relies on the insect diapause and molecular function research platform of this team. Through systematic studies such as multi-omics screening, gene identification and functional verification, it is found that the aalClk gene plays a key regulatory role in the photoperiod diapause behavior of Aedes albopictus. Under the diapause-inducing short photoperiod (SD) conditions, the aalClk gene is specifically silenced by dsRNA, so that the diapause rate of the offspring eggs of Aedes albopictus is reduced, and the offspring eggs hatch into larvae, which are difficult to survive the cold and dry adversity, thereby achieving the purpose of prevention and control, and providing a new technology for the control of Aedes albopictus vectors.

[0017] Based on this, the present invention provides an aalClk gene of Aedes albopictus, an RNA interference sequence fragment of the gene, and a double-stranded RNA (dsRNA) synthesized using the RNA interference sequence fragment, which can be used to regulate the diapause behavior of Aedes albopictus, laying a foundation for the preparation of a new vector control product for regulating the diapause of Aedes albopictus to achieve vector population suppression, which is of great significance.

[0018] The last object of the present invention can be achieved by the following technical solution: a method for regulating the diapause behavior of Aedes albopictus, comprising introducing the dsRNA into the body of the Aedes albopictus.

[0019] Based on the gene interference and diapause behavior model platform of Aedes albopictus developed by our team, the dsRNA specifically targeting aalClk of Aedes albopictus was introduced into the body of Aedes albopictus to interfere with the aalClk gene of Aedes albopictus, causing the expression of the aalClk gene to decrease, and the diapause rate of the offspring eggs of Aedes albopictus to decrease significantly, and a large number of eggs were hatched in a short light period. This indicates that the aalClk gene of Aedes albopictus has the ability to regulate the diapause behavior of Aedes albopictus, and the expression of the aalClk gene can be interfered with by the aalClk-specific dsRNA of Aedes albopictus, thereby reducing the diapause rate of the offspring of Aedes albopictus.

[0020] The present invention has the following advantages:

[0021] (1) The present invention is based on the insect diapause and molecular function research platform constructed by the research team. Through systematic studies such as multi-omics screening, gene identification and functional verification, the aalClk gene is screened, identified and found to play a key regulatory role in the photoperiodic diapause behavior of Aedes albopictus, and the aalClk gene sequence of Aedes albopictus is further obtained; then, in-depth bioinformatics analysis is carried out, especially the analysis of multi-omics such as transcriptome related to diapause of Aedes albopictus and the gene structure and translation region of aalClk, and a highly specific dsRNA interference sequence fragment of aalClk is designed and targeted;

[0022] (2) The present invention obtains a dsRNA that specifically targets aalClk of Aedes albopictus and synthesizes it from an RNA interference sequence fragment of the aalClk gene of Aedes albopictus, and provides a method for using the dsRNA to control Aedes albopictus. The expression of the aalClk gene is specifically silenced by introducing the dsRNA. After the aalClk gene is silenced, under diapause-inducing conditions, the diapause rate of the offspring eggs of Aedes albopictus decreases, and a large number of eggs hatch, making it difficult for the mosquito to survive adversity.

[0023] (3) The present invention lays a foundation for studying the molecular mechanism of Aedes albopictus entering diapause under diapause-inducing conditions, and provides a theoretical basis for the development of new biological pesticides;

[0024] (4) The application of the present invention has broad application prospects in the fields of insect diapause regulation, vector control, public health and infectious disease prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The interference efficiency of the aalClk gene of Aedes albopictus compared with the control group (labeled as dsegfp) after injection of dsRNA specifically targeting aalClk of Aedes albopictus under long photoperiod conditions and short photoperiod conditions in Example 3;

[0026] Figure 2 The statistical results of the diapause rate of Aedes albopictus injected with dsRNA specifically targeting aalClk of Aedes albopictus under long photoperiod and short photoperiod conditions in Example 3 (labeled as dsaalClk), compared with no injection (labeled as blank control), injection of solvent (labeled as solvent control) and negative control (labeled as dsegfp). The scattered points in the figure are the diapause rate of each female Aedes albopictus individual laying eggs. DETAILED DESCRIPTION

[0027] The following embodiments are provided to facilitate understanding of the present invention, but are not intended to limit the present invention. Unless otherwise specified, the following embodiments all adopt conventional experimental methods; unless otherwise specified, the reagents used are all conventional reagents that are readily available for purchase.

[0028] The present invention is described in detail with reference to the following experimental steps.

[0029] The test insects in the following embodiments: Foshan strain of Aedes albopictus, raised in an artificial climate box, the breeding conditions are as follows: temperature 21 ° C, humidity 60-80%, long photoperiod conditions (LD) light-dark ratio 16h:8h (non-diapause induction), short photoperiod conditions (SD) light-dark ratio 8h:16h (diapause induction).

[0030] Example 1

[0031] The aalClk gene of Aedes albopictus provided in this embodiment is obtained by the following method:

[0032] 1. Total RNA extraction from Aedes albopictus

[0033] (1) After taking the sample out from -80℃, quickly put it into an ice box and grind it thoroughly for 5 minutes using an electric grinder until there are no fragments. Add 900μL TRIzol to a total volume of 1mL and gently invert it upside down or use a pipette to blow and suck it to mix it thoroughly.

[0034] (2) Stand at room temperature for 5 min and centrifuge at 12000 g for 10 min (4°C);

[0035] (3) Transfer the supernatant obtained in (2) into a new 1.5 mL EP tube;

[0036] (4) Add 200 μL of chloroform per 1 mL of TRIzol, cap the tube tightly, shake vigorously for 15 seconds, and let stand at room temperature for 3-5 minutes to allow the phases to separate naturally;

[0037] (5) Centrifuge at 12,000 g for 15 min at 4 °C.

[0038] (6) Pipette the upper aqueous layer into a new 1.5 mL EP tube, about 500 μL;

[0039] (7) Add 500 μL of pre-cooled isopropanol solution, cover the tube tightly, shake vigorously for 15 seconds, centrifuge at 12000g for 15 minutes (4°C), discard the supernatant, and a gelatinous precipitate can be seen on the side and bottom of the tube after centrifugation;

[0040] (8) Add 1.0 mL of 75% ethanol to the RNA precipitate for washing. Vortex briefly to resuspend the gelatinous precipitate. Let stand for 3-5 minutes and centrifuge at 7500 g for 5 minutes at 4°C. Repeat twice.

[0041] (9) Discard the washing solution, place the sample in a clean bench with the lid open and air-dry for 15 minutes, and dissolve the RNA with 21 μL RNase-free water;

[0042] (10) The concentration and purity of total RNA were determined using NanoDrop-2000 UV spectrophotometer;

[0043] 2. Preparation of Aedes albopictus cDNA

[0044] cDNA was obtained by reverse transcription using the EvoM-MLV reverse transcription kit.

[0045] Here are the steps:

[0046] 1) Removal of genomic DNA: Prepare 10 μL system: 1 μL gDNA Clean Regent, 2 μL 5×gDNA Clean Buffer, 1 μg Total RNA, and 10 μL RNase Free Water. Reaction conditions: Incubate at 42°C for 2 minutes and cool quickly on ice.

[0047] 2) Reverse transcription reaction: Prepare 20 μL reverse transcription reaction solution:

[0048] Step 1) Reaction solution 10μL, Evo M-MLV RTase Enzyme Mix 1μL, Random 6mers Primer (400μM) 1μL, Oligo dT (18T) Primer (50μM) 1μL, 5×RTase Reaction Buffer Mix 4μL, RNase Free Water 3μL. Reaction conditions: 37℃ for 15min, then 85℃ for 5s, and quickly cooled on ice.

[0049] 3) PCR amplification of aalClk gene sequence

[0050] Primer premier5.0 software was used to design specific primers for aalClk amplification. After amplification, the primers were sent to Shanghai Bioengineering Co., Ltd. for sequencing and splicing. The primer sequences are shown in the following table:

[0051] Table 1 Specific primers for aalClk amplification

[0052] Gene Primer sequence (5'~3') aalClk_F1 TATCAAAGAACGTGGTTTAGCTTTT (SEQ ID NO: 1) aalClk_R1 AGGTGATCCTCCCGGAGTTG (SEQ ID NO: 2) aalClk_F2 TTTGGCTGCAAACTCGCTTC (SEQ ID NO: 3) aalClk_R2 GGAGTGGATGGACCAGAGTG (SEQ ID NO: 4)

[0053] Prepare the reaction solution: 5×Trans Start FastPfu Buffer 10.0μL, 2.5mM dNTPs 4.0μL, Forward Primer (10μM) 1.0μL, Reverse Primer (10μM) 1.0μL, TransStart FastPfu DNA Polymerse 1.0μL, Template 1.0μL, Nuclease-free Water Up to 50.0μL. Reaction program: 95℃2min; 95℃20s, 55℃20s, 72℃2.5min, 35 cycles; 72℃5min, 4℃ storage.

[0054] The gene sequence was obtained by PCR amplification and sequencing technology. The nucleotide sequence of the aalClk gene of Aedes albopictus is shown in SEQ ID NO: 5. The obtained open reading frame is 2634 bp and encodes 878 amino acids.

[0055] tag (Stop codon, SEQ ID NO: 5)

[0056] Example 2

[0057] The RNA interference sequence fragment of the aalClk gene of Aedes albopictus is obtained by the following method:

[0058] (1) According to the aalClk gene sequence of Aedes albopictus obtained in Example 1, a sequence of about 400 to 800 bp was selected as the aalClk gene RNA interference sequence fragment. Based on the gene database platform established by this team, the selected positive and antisense strands were subjected to homology analysis to determine that the region was not homologous to other non-target genes and to ensure the specificity of the interference sequence fragment. Primers were designed for the designed fragment using Primer premier5.0 software, and the nucleic acid sequence thereof is shown in Table 2:

[0059] Table 2 Primers for RNA interference sequence fragments of the aalClk gene of Aedes albopictus

[0060] Gene Primer sequence (5'~3') aalClk_RNAi_F TTTGGCTGCAAACTCGCTT(SEQ ID NO:6) aalClk_RNAi_R GTGTTGGAACGGACTCGTGA(SEQ ID NO:7)

[0061] (2) Preparation of RNA interference sequence fragment of aalClk gene of Aedes albopictus: Using Aedes albopictus cDNA as template and primers as shown in Table 2, the reaction solution was prepared using the TransStartFastPfuDNAPolymerase Kit: 5×Trans StartFastPfu Buffer 10μL, 2.5mM dNTPs 4μL, Forward Primer (10μM) 1μL, Reverse Primer (10μM) 1μL, TransStartFastPfu DNA Polymerse 1μL, Template (cDNA) 1μL, RNaseFree Water 32μL. The PCR reaction conditions were as follows: 95℃ 2min; 95℃ 20s, 55℃ 20s, 72℃ 10s, 35 cycles; 72℃ 5min, stored at 4℃.

[0062] (3) Product purification: The product was purified by using the Cycle Pure Kit-Omega Bio-Tek kit. The specific steps were as shown in the kit instructions to obtain an RNA interference sequence fragment of the aalClk gene of Aedes albopictus, which had a sequence length of 427 bp, as shown in SEQ ID NO: 8.

[0063] tttggctgcaaactcgcttctacatcacctaccatcagtggaattcgaaaccagagtttg

[0064] tggtgtgtacgcatcgagtcgtgagctacgccgatgtaatgaaacagatgcgcaaccagg

[0065] ccggtggcgagggcaagttctccgaagacacggatagcgttagtgtaggcgttgagcgga

[0066] agttccaaccgagttcgtctcaaagcctactggcaacatctccgtggagttcgaagagtt

[0067] ctcgcacttcgcggatcgcgccaactccgggaggatcacctacgggagcaccaccgagaa

[0068] ggcatcggtacaacacttatcagggtcctggatccgattcggcaacttcgatgtcagcgg

[0069] aatcacatgtcagtcggcaatcgatgatgacgcagcacagctcaaaatcacgagtccgtt

[0070] ccaacac (SEQ ID NO: 8).

[0071] Example 3

[0072] The invention discloses a dsRNA synthesized from an RNA interference sequence fragment of the aalClk gene of Aedes albopictus, and its application in regulating the expression of the aalClk gene of Aedes albopictus, regulating the diapause behavior of Aedes albopictus, preparing a product for regulating the diapause of Aedes albopictus, and preparing a product for controlling vector biological control, comprising the following steps:

[0073] (1) The RNA interference sequence fragment of the aalClk gene of Aedes albopictus obtained in Example 2 was used as a template, and a primer containing a T7 promoter was used to add the T7 promoter to the 5' end of the RNA interference sequence fragment of the aalClk gene of Aedes albopictus by PCR. The primer sequence for adding the T7 promoter is as follows:

[0074] Table 3 T7 promoter primers added to RNA interference sequence fragments of Aedes albopictus aalClk gene

[0075]

[0076] (2) Preparation of in vitro transcription template: Use ApexHF HSDNA Polymerase CL kit to connect T7 promoter, prepare reaction solution: ApexHF HSDNA Polymerase CL (1U / μL) 1μL, 2×ApexHF CL Buffer (Mg+and dNTPplus) 25μL, Forward Primer (10μM) 1μL, Reverse Primer (10μM) 1μL, Template (step 1) reaction solution diluted 10 times) 1uL, Nuclease-free Water 21μL. Reaction conditions: 98℃1min; 98℃10s, 55℃15s, 68℃30s, 10 cycles; 98℃10s, Tm+5℃15s, 68℃30s, 30 cycles; 4℃ storage.

[0077] (3) Product purification: The product was purified by Cycle Pure Kit-Omega Bio-Tek kit. The specific steps refer to the kit instructions to obtain the RNA interference sequence fragment of the aalClk gene of Aedes albopictus containing the T7 promoter.

[0078] (4) In vitro transcription: The prepared RNA interference sequence fragment of the Aedes albopictus aalClk gene of the T7 promoter was used as an in vitro transcription template:

[0079] ①Use Vazyme T7 RNAi Transcription Kit to synthesize dsRNA in vitro, and prepare the reaction solution: NTPMix 8μL, 10×Transcrition Buffer 2μL, T7 Enzyme Mix 2μL, 1μg of the template prepared in step ①, and Nuclease-free Water to make up to 20μL. Reaction conditions: 37℃8h; 72℃10min; naturally cool and anneal to room temperature.

[0080] ② DNaseI & RNaseT1 digestion, prepare the reaction solution: 20μL of step ① product, 17μL of RNase-free H2O, 1μL of DNaseⅠ, 2uL of RNase T1 (10U / μL). Reaction conditions: 37℃ for 30min.

[0081] ③ Use RNA Clean Beads to purify dsRNA. For specific steps, refer to the RNA Clean Beads instructions. After purification, use Thermo Scientific NanoDrop 2000 to measure the concentration and quality of dsRNA and dilute the concentration to 1μg / μL.

[0082] (5) Introducing dsRNA specifically targeting aalClk of Aedes albopictus into the body of Aedes albopictus: dsRNA is introduced into the body of Aedes albopictus by intrathoracic injection, the steps are as follows:

[0083] ① Use a mosquito suction device to suck female Aedes albopictus into a paper cup and place it in an ice box for about 10 seconds for anesthesia; use tweezers to pick up the anesthetized female mosquitoes and place them on a clean, water-free low-temperature dish, so that they lie on their side and expose their chests, in groups of 10;

[0084] ② Under a stereo microscope, gently insert a needle into the female mosquito's chest near the foot, and slowly inject the dsRNA prepared in Example 3-(4) into the female mosquito to complete the injection operation. The injection volume is 1 μL;

[0085] ③ After injection, the female mosquitoes are slowly and carefully placed in a room at 25-28℃ to warm up for about 1-3 hours to reduce the risk of death caused by injection;

[0086] ④ The mosquitoes were placed under corresponding light cycle conditions and raised normally, and their biological functions were studied by normal single-cup egg induction after a blood meal.

[0087] ⑤ Detection of Clock gene interference efficiency in Aedes albopictus

[0088] Aedes albopictus were collected 48 h after injection, and the interference efficiency of aalClk gene was detected by qPCR. rps7 was used as the internal reference gene. The qPCR primers were shown in Table 4. The sample size was 15-20, and three biological replicates were set, each of which contained four technical replicates.

[0089] Table 3 qPCR primers for the aalClk gene and the internal reference gene rps7 of Aedes albopictus

[0090] Gene Primer sequence (5'~3') aalClk_qF GTCCCAATCCATCACCTGCA(SEQ ID NO:11) aalClk_qR TGTTTGCGCTTGTTCTTCGG(SEQ ID NO:12) rps7_qF ATGAACTCGGACCTGAAG(SEQ ID NO:13) rps7_ TTCTTGCTGTTGAACTCG(SEQ ID NO:14)

[0091] Detect mRNA using SYBR dye method and prepare the reaction solution:

[0092] Power Up SYBR Green Master Mix (2×) 5.00μL, upstream primer (F) 0.25μL, downstream primer (R) 0.25μL, RNase-free water 3.50μL, template cDNA 1.00μL. Reaction conditions: UDG activation 50℃ 2min1cycle, pre-denaturation 95℃ 2min1cycle, PCR reaction 95℃ 15s40cycle, 60℃ 60s.

[0093] Use 2 -ΔΔ The relative expression of aalClk mRNA was calculated by CT method, and the expression differences among the groups were compared by t-test, with p<0.05 as the significance level.

[0094] Figure 1 The results showed that the expression level of the aalClk gene of Aedes albopictus was significantly reduced after the injection of dsRNA specifically targeting aalClk of Aedes albopictus, regardless of long photoperiod or short photoperiod conditions. This indicates that the dsRNA specifically targeting aalClk of Aedes albopictus has the effect of reducing the expression level of aalClk and achieved successful silencing of the aalClk gene.

[0095] ⑥ Observe the diapause phenotype of Aedes albopictus after injection of dsRNA specifically targeting aalClk of Aedes albopictus, and evaluate the effect of injection of dsRNA specifically targeting aalClk of Aedes albopictus on the diapause rate of Aedes albopictus offspring.

[0096] Figure 2 The results showed that after the injection of dsRNA specifically targeting aalClk of Aedes albopictus, the diapause rate of Aedes albopictus was reduced under short light cycle conditions, indicating that dsRNA specifically targeting aalClk of Aedes albopictus has a significant effect on reducing the diapause rate of Aedes albopictus.

[0097] The above specific embodiments are intended to further illustrate the content of the present invention, but should not be regarded as limiting the protection scope of the present invention. Any non-substantial modification or adjustment made by anyone based on the present invention and according to the technical inspiration provided should be covered within the protection scope of the present invention.

Claims

1. A aalClk gene of Aedes albopictus, characterized in that The nucleotide sequence of the aalClk gene of Aedes albopictus is shown in SEQ ID NO:

5.

2. A dsRNA specifically targeting the aalClk gene of Aedes albopictus according to claim 1, characterized in that: The sequence of the dsRNA is shown in SEQ ID NO:

8.

3. Use of the Aedes albopictus-specific dsRNA according to claim 2 in regulating the aalClk gene of Aedes albopictus.

4. Use of the Aedes albopictus-specific dsRNA according to claim 2 in preparing a product for regulating diapause of Aedes albopictus.

5. Use of the Aedes albopictus-specific dsRNA according to claim 2 in the preparation of a novel vector control product for regulating the diapause of Aedes albopictus to achieve vector population suppression.

6. A method for regulating the diapause behavior of Aedes albopictus, characterized in that: The dsRNA according to claim 2 is introduced into the body of the Aedes albopictus.

Images