A Perilla PfDof29 gene for regulating fatty acid and oil synthesis in plants, a recombinant expression vector, recombinant bacteria, and their applications.

Abstract

This invention belongs to the field of plant molecular biology, specifically relating to the perilla PfDof29 gene, recombinant expression vector, recombinant bacteria, and applications for regulating fatty acid and oil synthesis in plants. This invention conducts a functional study on the mechanism by which the perilla PfDof29 transcription factor regulates oil biosynthesis. The results show that perilla PfDof29 can significantly increase the total oil content in tobacco leaves and can specifically bind to the PfFAD8 promoter, mediating the molecular regulatory mechanism of polyunsaturated fatty acids in perilla. This lays a theoretical foundation for further analysis of the function and regulatory mechanism of perilla Dof transcription factor-mediated oil biosynthesis, and provides excellent gene resources for increasing oil yield and improving the quality of oil crops such as perilla.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant molecular biology, and particularly relates to a Perilla PfDof29 gene for regulating synthesis of plant fatty acids and oil, a recombinant expression vector, a recombinant bacterium and application. BACKGROUND

[0002] Perilla frutescens L. belongs to the Labiatae Perilla annual herb, has high medicinal and edible value, and is also a characteristic oil crop. Perilla seed oil is rich in a large amount of unsaturated fatty acids, and the content of alpha-linolenic acid (English name: alpha-Linolenic Acid, abbreviation: alpha-LNA) is as high as more than 65%, which is one of the richest plant resources containing alpha-linolenic acid known at present, and the content is much higher than that of common oil crops such as soybean (Glycine max) and peanut (Arachis hypogaea). Alpha-linolenic acid is an essential fatty acid for human body, has the effects of promoting brain development and protecting cardiovascular system, and Perilla is a natural and sustainable functional oil resource, which has great development value in the field of medicinal and edible homology. The lipid metabolism and stress response of plants are regulated by multiple regulatory pathways. Transcription factors, i.e. TFs, are one of the important participants in this complex regulatory network, which coordinates and mediates multiple biological processes by regulating the expression of related target genes. Therefore, it is necessary to explore a coding gene from Perilla to encode a factor that can regulate the synthesis of plant fatty acids and oil. SUMMARY

[0003] To solve the above problems, the present application provides a Perilla PfDof29 gene for regulating synthesis of plant fatty acids and oil, a recombinant expression vector, a recombinant bacterium and application, which encodes a factor that can regulate the synthesis of plant fatty acids and oil.

[0004] The present application is realized by the following technical solutions:

[0005] A Perilla PfDof29 gene for regulating synthesis of plant fatty acids and oil, the nucleotide sequence of the Perilla PfDof29 gene is shown as SEQ ID NO. 1.

[0006] A recombinant expression vector, the recombinant expression vector comprises the coding gene and a backbone plasmid connected with the coding gene.

[0007] Preferably, the backbone plasmid is pCAMBIA1303.

[0008] Preferably, the construction method of the recombinant expression vector is to amplify the Perilla PfDof29 gene using specific primers, recover the PCR product, and connect the PCR product with the backbone plasmid pCAMBIA1303 to obtain the recombinant expression vector.

[0009] Preferably, the nucleotide sequence of the specific primer pair is shown in SEQ ID NO. 29 and SEQ ID NO. 30.

[0010] A recombinant bacterium, which is obtained by transforming the recombinant expression vector into an engineering bacterium.

[0011] Preferably, the engineering bacterium is Agrobacterium tumefaciens GV3101.

[0012] The perilla PfDof29 gene, the recombinant expression vector or the recombinant bacterium is applied to improving total oil content in plant leaves.

[0013] Preferably, the plant is tobacco.

[0014] Preferably, the total oil content in plant leaves is improved by mediating the regulation of the fatty acid key gene PfFAD8 on plant lipid biosynthesis.

[0015] Compared with the prior art, the application has the following beneficial effects:

[0016] The application provides a perilla PfDof29 gene, and the nucleotide sequence of the perilla PfDof29 gene is shown in SEQ ID NO. 1. The application first screens and identifies the gene PfDof29 with high seed expression of the perilla PfDof29 differential gene, constructs a plant overexpression vector by using a molecular biology method, analyzes the total oil content of overexpression tobacco by Agrobacterium-mediated tobacco genetic transformation, studies the regulation mechanism of the transcription factor, further screens and identifies the fatty acid key gene PfFAD8 which is significantly related to the expression of the PfDof29 gene, respectively constructs a prey vector and a decoy vector, and verifies whether the PfDof29 can directly combine with the PfFAD8 gene promoter AAAG element and whether the PfDof29 can regulate the biosynthesis of the perilla polyunsaturated fatty acid by a yeast one-hybrid test. The results show that the perilla PfDof29 gene can significantly improve the total oil content in tobacco plant leaves, can specifically combine with the PfFAD8 promoter, mediates the molecular regulation mechanism of the perilla polyunsaturated fatty acid, and lays a theoretical foundation for in-depth analysis of the oil biosynthesis function mediated by the perilla Dof transcription factor and the regulation mechanism thereof, and provides an excellent gene resource for improving the oil yield and quality of perilla and other oil crops.

[0017] The application discusses the regulation of PfDofs transcription factors on the synthesis and accumulation of perilla polyunsaturated fatty acid from the levels of genome, transcriptome and molecular biology, preliminarily elucidates the regulation mechanism of the oil synthesis mediated by the PfDof29, and provides a new idea for further improving the perilla seed oil content and quality improvement. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without any creative effort.

[0019] Figure 1 PfDof29 gene of the present application, M: 2000bp Marker; 1: PfDof29 gene;

[0020] Figure 1 In the figure, A is the relative expression amount of PfDof1; B is the relative expression amount of PfDof2; C is the relative expression amount of PfDof5; D is the relative expression amount of PfDof12; E is the relative expression amount of PfDof14; F is the relative expression amount of PfDof18; G is the relative expression amount of PfDof25; H is the relative expression amount of PfDof29; I is the relative expression amount of PfDof37; J is the relative expression amount of PfDof54; K is the relative expression amount of PfDof56;

[0021] Figure 2 PfDof29 gene of the present application, M: 2000bp Marker; 1: PfDof29 gene;

[0022] Figure 3 pCAMBIA1303-PfDof29 DH5α PCR bacteria detection of the present application, M: 2000II bp Marker; 1-5: positive monoclonal identification;

[0023] Figure 4 pCAMBIA1303-PfDof29 vector double enzyme digestion verification of the present application, in the figure, M: 15000bp Marker; 1: 1303 empty vector, 2: pCAMBIA1303-PfDof29 double enzyme digestion verification;

[0024] Figure 5 Agrobacterium-mediated tobacco genetic transformation process of the present application;

[0025] Figure 5 In the figure, A: tobacco leaf after infection; B: dedifferentiation induced callus; C: callus formed sprout; D: rooting culture; E: growth culture; F: seedling transplanting;

[0026] Figure 6 Genome level and transcription level detection of the tobacco genetic transformation of the present application;

[0027] Figure 6A: tobacco genetic transformation genome level detection; B: tobacco genetic transformation transcription level detection; M: 2000 II bp Marker; 1: empty plasmid, 2: wild tobacco, 3-7: PfDof29 transgenic tobacco lines;

[0028] Figure 7 Figure is total oil content of transgenic tobacco leaves of the application; WT: wild tobacco; OE1, OE2 and OE3: PfDof29 transgenic lines; difference is extremely significant, P<0.05;

[0029] Figure 8 Figure is correlation analysis of fatty acid related genes and perilla PfDofs transcription factor of the application;

[0030] Figure 9 Figure is PfFAD8 promoter PCR amplification of the application; M: 2000 bp Marker; 1: PfFAD8 promoter;

[0031] Figure 10 Figure is self-activation verification of perilla PfFAD8 decoy vector of the application; Figure is growth of positive control group pHIS2-p53+pGAD53m and negative control group pHIS2-proPfFAD8+pGADT7 on 0 mmol / L, 10 mmol / L, 30 mmol / L, 40 mmol / L, 50 mmol / L and 70 mmol / L 3-AT medium; yeast cells are diluted to OD value of 0.2, and are diluted by 10 times, 100 times and 1000 times in turn, i.e. 10 600 , 10 0 , 10 -1 , 10 -2 , 10 -3 gradient points are spotted on defective medium;

[0032] Figure 11 Figure is yeast one-hybrid of recombinant plasmid of the application; Figure is growth of negative control group pHIS2-proPfFAD8+pGADT7, experimental group pHIS2-proPfFAD8+pGADT7-PfDof29 and pHIS2-p53+pGAD53m positive control strain on 50 mmol / L 3-AT medium;

[0033] Figure 12 Figure is PfFAD8 gene PCR amplification of the application; M: 2000 bp Marker; 1: PfFAD8;

[0034] Figure 13 Figure is pYES2.0 vector map of the application;

[0035] Figure 14Figure for pYES2.0-PfFAD8 double enzyme digestion verification of the application, in which M: 8000bp Marker; 1: pYES2.0 empty plasmid, 2: pYES2.0-PfFAD8 double enzyme digestion verification;

[0036] Figure 15 PCR bacteria detection of pYES2.0-PfFAD8 transformed wild yeast INVSc1 of the application, M: 2000II bp Marker; 1-5: positive monoclonal identification;

[0037] Figure 16 Total oil content of the transgenic yeast of the application; wherein WT: wild Saccharomyces cerevisiae INVSc1; EV: pYES2.0 empty vector transformed; OE1-OE3: three technical replicates of transgenic yeast;

[0038] Figure 17 PfFAD8 transgenic yeast pYES2.0-PfFAD8 and wild yeast INVSc1 oil droplet observation of the application; DIC, Biodipy and Merge are three different observation channels for oil droplet staining, DIC is bright field, Biodipy is dark field, and Merge is superposition. DETAILED DESCRIPTION

[0039] In order to facilitate the understanding of the present application, the present application will be described more fully below, and preferred embodiments of the present application will be given. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the disclosure of the present application more thorough and comprehensive.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the specification of the present application herein is only for the purpose of describing specific embodiments and is not intended to limit the present application.

[0041] The inventive concept of the present application is as follows:

[0042] Transcription factors, i.e. TFs, are one of the important participants in this complex regulatory network, which coordinates and mediates multiple biological processes by regulating the expression of related target genes. Therefore, it is necessary to explore a gene encoding a factor that can regulate plant fatty acid and oil synthesis from Perilla.

[0043] Based on this, the first aspect of the present application provides a Perilla PfDof29 gene, the nucleotide sequence of the Perilla PfDof29 gene is shown as SEQ ID NO. 1.

[0044] The second aspect of the present application provides a recombinant expression vector, wherein the recombinant expression vector comprises the coding gene and a backbone plasmid connected to the coding gene.

[0045] The third aspect of the present application provides a recombinant bacterium, wherein the recombinant bacterium is obtained by transforming the recombinant expression vector of claim 2 into an engineering bacterium.

[0046] The perilla PfDof29 gene, the recombinant expression vector and the recombinant bacterium can improve the total oil content of plant leaves.

[0047] The present application first screens and identifies the seed high-expression gene PfDof29 of the perilla PfDof differential gene, uses a molecular biology method to construct a plant overexpression vector, analyzes the total oil content of the overexpression tobacco through the agrobacterium-mediated tobacco genetic transformation, studies the transcription factor regulation mechanism, further screens and identifies the fatty acid key gene PfFAD8 which is significantly related to the PfDof29 gene expression, respectively constructs a prey vector and a decoy vector, verifies whether the PfDof29 can directly combine with the PfFAD8 gene promoter AAAG element through a yeast one-hybrid test, and whether the PfDof29 can regulate the biosynthesis of the perilla seed polyunsaturated fatty acid. The results show that the perilla PfDof29 gene can significantly improve the total oil content of the tobacco plant leaves, and can specifically combine with the PfFAD8 promoter to mediate the molecular regulation mechanism of the perilla polyunsaturated fatty acid. The present application lays a theoretical foundation for in-depth analysis of the Dof transcription factor-mediated oil biosynthesis function and its regulation mechanism, and provides an excellent gene resource for improving the oil yield and quality of the perilla and other oil crops.

[0048] The nucleotide sequence of the perilla PfDof29 gene is shown in SEQ ID NO. 1, which is as follows:

[0049]

[0050] The nucleotide sequence of the PfFAD8 gene is shown in SEQ ID NO. 2, which is:

[0051]

[0052] The technical solutions of the present application will be further described below in combination with specific embodiments.

[0053] Example 1, spatiotemporal expression characteristics analysis of Perilla Pfdofs differential genes and cloning of Perilla Pfdof29 gene

[0054] 1. Extraction of total RNA: total RNA of Perilla seeds at 10d, 20d, 30d and 40d after flowering was extracted by using EASYspin plant RNA rapid extraction kit, the concentration and purity of the RNA were detected by using ultramicro nucleic acid analyzer, and the integrity of the RNA was detected by using 1% agarose gel electrophoresis.

[0055] 2. Synthesis of cDNA: the obtained RNA of Perilla seeds at each period was used as a template, 5x All-In-One MasterMix reverse transcription kit was used to complete the reverse transcription, and cDNA was obtained according to the instructions of the kit.

[0056] 3. Design of primers: the primer information is shown in Table 1.

[0057] Table 1 Quantitative primer information of PfDofs differential genes

[0058]

[0059]

[0060] 4. Spatiotemporal expression characteristics analysis of 11 differential genes

[0061] PCR reaction: the amplification system is shown in Table 2.

[0062] Table 2 PCR amplification system

[0063]

[0064] The reaction program is 94℃ 30s; 94℃ 5s, 60℃ 15s, 72℃ 10s, 2-4 steps 45 cycles. 2 -ΔΔCT The relative expression amount of PfDofs gene in different tissues of Perilla and at different periods of seeds was calculated by using 2

[0065] 5. Cloning of Perilla Pfdof29 gene

[0066] The full-length primer sequence is shown in Table 3.

[0067] Table 3 Full-length primer information

[0068] Primer name Primer sequence, 5'-3' SEQ ID NO. 27: ORF-PfDof29-F ATGAAGGAAGCCAAGGAGCC SEQ ID NO. 28: ORF-PfDof29-R CTAGGCACCCTCTTGAAAGGTAAT

[0069] PCR reaction: the amplification system is shown in Table 4.

[0070] Table 4 PCR amplification system

[0071]

[0072] PCR program: 98℃, 1 min; 98℃, 10 s; 60℃, 5 s; 72℃, 8 s; 2-4 steps, 30 cycles; 72℃, 1 min.

[0073] 6, Recovery and purification of target fragments

[0074] After the PCR reaction, the PfDof29 amplification product was detected by gel electrophoresis, and the correct target band was cut and recovered, and stored at -20℃ for subsequent experiments.

[0075] 7, Vector construction

[0076] 7.1 Double enzyme digestion

[0077] BamHI and Kpnl restriction enzymes were selected for double enzyme digestion of pCAMBIA1303 empty plasmid, and the reaction program was: 37℃ for 30 min, 4 cycles; 85℃ for 20 min. Primer information is shown in Table 5.

[0078] The enzyme digestion system used for construction of pCAMBIA1303 expression vector is shown in Table 6:

[0079] Table 5 Primer information

[0080] Primer name Primer sequence, 5'-3' SEQ ID NO. 29: 1303-PfDof29-F CAGGTCGACTCTAGAGGATCCATGAAGGAAGCCAAGGAGCC SEQ ID NO. 30: 1303-PfDof29-R GGTTTAAACGAGCTCGGTACCCTAGGCACCCTCTTGAAAGGTAAT

[0081] Table 6 Enzyme digestion system

[0082] 10 x NEB Buffer 5 μL BamHI 1 μL KpnI 1 μL pCAMBIA1303 empty vector 10 μL ddH2O Supplemented to 50 μL

[0083] 7.2 Recombination

[0084] The enzyme digestion product was detected by agarose gel electrophoresis, and the band was purified and recovered, and prepared according to the system shown in Table 7 in a metal bath at 50℃ for 10 min.

[0085] Table 7 Preparation system

[0086] 10 x T4 ligase Buffer 5 μL Cleaved vector fragment 3 μL Cleaved target gene fragment 1 μL ddH2O Supplemented to 10 μL

[0087] 8 Escherichia coli transformation

[0088] 8.1 Preparation and transformation of E. coli competence

[0089] The activated E. coli DH5α bacterial solution was inoculated into 50 mL of LB liquid medium (without antibiotics), and cultured at 37℃ overnight to OD 600= 0.4, the bacteria liquid was poured into 50 ml centrifuge tube in the clean bench and quickly placed on ice bath for 30 min, then centrifuged at 5000 rpm for 8 min, the supernatant was discarded as much as possible, 10 mL pre-cooled 0.1M CaCl2 solution was added, mixed gently, then centrifuged to remove the supernatant, then 2 mL 0.1M CaCl2 solution containing 15% glycerol was added to resuspend the bacteria liquid, 100 μL competent cells were dispensed into 1.5 ml sterile centrifuge tube, and stored at -80°C for standby.

[0090] 10 μL recombinant was added to the melted E. coli competent cells on ice, mixed gently, and then quickly placed in a 42°C metal bath for heat shock for 90 s, and then placed in ice bath for 5 min. 800 μL LB medium (without antibiotics) was added to the treated competent cells, and cultured at 37°C, 200 rpm for 45 min. 20 μL bacterial liquid was taken with a pipette and uniformly coated on an LB solid screening plate containing 50 μg / mL kanamycin, and cultured at 37°C in the dark for 12 h until single colonies appeared.

[0091] 8.2 Positive single clone screening

[0092] A single colony was picked from the LB solid screening plate with a 1 μ sterile gun head and inoculated in 800 μL LB medium containing 50 μg / mL kanamycin, and shaken for about 6 h until the bacterial liquid was turbid. PCR detection was performed on the bacterial liquid, and the primers used are shown in Table 5, and the PCR program is 94°C, 3 min; 94°C, 30 s, 60°C, 30 s, 72°C, 90 s, 30 cycles; 72°C, 5 min.

[0093] Part of the positive bacterial liquid was sent to Xi'an Qikao Biological Co., Ltd. for sequencing, and part of the bacteria was stored for subsequent experiments.

[0094] 9. Results and analysis

[0095] The total cDNA of perilla seeds 10 d, 20 d, 30 d, and 40 d after flowering was mixed as a template, and the temporal and spatial expression characteristics of PfDofs differential genes of perilla were analyzed. The results showed that the expression of PfDof29 gene was the highest in the early and middle stages of seed development, and the expression of 11 differential genes was the highest in different stages of seed development, as shown in Table 6, which was speculated to regulate the biosynthesis of seed oil. The full-length primer amplified a band with a length of about 1338 bp, as shown in Table 7, which was preliminarily judged to be the target band. The recombinant product was transformed into E. coli, and single colonies were obtained by kanamycin screening, and positive clones were identified by PCR detection, as shown in Table 8. Figure 1 Figure 2 Figure 3 ​​The bacterial liquid was sent to the company for sequencing, and the results showed that the ORF sequence of the perilla PfDof29 gene was consistent, only 2 base mutations, and the protein sequence did not change, and the cloning was successful.

[0096] Example 2, construction of a perilla PfDof29 gene constitutive expression vector and tobacco genetic transformation

[0097] 1. Construction of a plant recombinant expression vector

[0098] The Agrobacterium tumefaciens GV3101 strain and the pCAMBIA1303 empty plasmid used in the application are stored in the Institute of Molecular Agriculture and Biological Energy of Shanxi Agricultural University.

[0099] 2. Preparation of Agrobacterium competence, Agrobacterium transformation and positive strain identification

[0100] 2.1 Preparation of Agrobacterium tumefaciens GV3101 competence

[0101] Agrobacterium tumefaciens GV3101 strain was inoculated in 50 mL LB medium containing 50 μg / mL rifampicin, and after activation, it was inoculated into a new 50 mL LB medium containing 50 μg / mL rifampicin, and cultured at 28°C in the dark on a shaking table until the OD 600 was 0.4. The bacterial cells were collected by centrifugation in a 50 mL sterile centrifuge tube, and the supernatant was discarded. The precipitate was resuspended in 10 mL of pre-cooled NaCl (0.15 mol / L) and centrifuged again. The supernatant was discarded, and the precipitate was resuspended in 10 mL of CaCl2 (20 mM) containing 15% glycerol by volume. The competent cells were aliquoted into 200 μL per tube and stored in a -80°C refrigerator.

[0102] 2.2 Transformation of Agrobacterium by freeze-thaw method

[0103] 5 μL of pCAMBIA1303-PfDof29 recombinant plasmid was added to 200 μL of competent cells melted on ice, and then placed in an ice bath for 5 min, frozen in liquid nitrogen for 5 min, and then quickly transferred to a 37°C metal bath for heat shock for 5 min. After cooling to room temperature, 800 μL of LB liquid medium (without antibiotics) was added, and the mixture was incubated at 28°C and 175 rpm for 4 h. 30 μL was taken and plated on a solid LB selection plate (containing 50 μg / mL rifampicin and 50 μg / mL kanamycin), and incubated at 28°C for 48 h.

[0104] 2.3 Screening of positive transformants

[0105] The picked clones were inoculated into 1 mL (containing 50 μg / mL rifampicin and 50 μg / mL kanamycin) LB medium, and cultured at 28°C, 200 rpm overnight. The bacterial liquid was detected by PCR, and the detection primer was shown in Table 5. The PCR detection was performed according to the method of Example 1. The bacterial liquid was stored in 50% glycerol for subsequent experiments.

[0106] 3. Tobacco genetic transformation

[0107] 3.1 Agrobacterium-mediated genetic transformation of tobacco

[0108] The GV3101 Agrobacterium carrying the recombinant plasmid pCAMBIA1303-PfDof29 was inoculated into LB liquid medium (50 μg / mL rifampicin, 50 μg / mL kanamycin) and cultured at 28°C overnight. The bacterial liquid (OD 600 ≈0.6) was poured into a 50 mL sterile centrifuge tube, centrifuged at 5000 rpm for 8 min, and the supernatant was discarded. The bacterial pellet was resuspended in 50 mL MS liquid medium. The 6-week-old tobacco seedlings with good growth were selected, and the main leaf veins and leaf edges were removed in a sterile environment on a clean bench. The leaves were cut into about 0.5 cm 2 size and placed on the pre-culture medium (MS, 3% sucrose, 0.75% agar, 1 mg / L 6-BA, 0.1 mg / L NAA, pH=5.8) for 72 h. After the pre-culture was completed, the leaves were immersed in the Agrobacterium liquid for 8 min, washed with sterile water for 1 min, and the surface water of the leaves was absorbed with sterile filter paper. The leaves were placed on the MS pre-culture medium with the front side up, and cultured in the dark with tin foil paper for 48 h. The leaves were transferred to the selection medium (MS, 3% sucrose, 0.75% agar, 1 mg / L 6-BA, 0.1 mg / L NAA, pH=5.8, 500 mg / L Cef, 5 mg / L Hyg), and the selection medium was replaced every 2 weeks until callus differentiated and grew into young buds at the edge of the leaves. The young buds were transferred to the rooting medium (1 / 2MS, 3% sucrose, 0.75% agar, pH=5.8, 500 mg / L Cef), and the roots grew into developed root systems. The seedlings were transferred to the nutrient soil for cultivation.

[0109] 3.2 Identification of transgenic tobacco genome level and transcription level

[0110] Take transgenic tobacco leaves, quickly placed in liquid nitrogen, CTAB method for extracting tobacco leaf DNA, DNA as amplification template, full-length primer, as shown in Table 5, PCR amplification, mass fraction 1% agarose gel electrophoresis detection of the purpose of the band, detection of the purpose of the gene has been transferred into tobacco. DNA detection of successful plants again take leaf extraction of RNA, reverse transcription into cDNA, using RT-PCR to assess whether the purpose of the gene is effectively expressed at the transcriptional level. PCR system and procedure refer to Example 1.

[0111] 3.3 Transgenic tobacco total oil content determination

[0112] Take the identification of successful transgenic tobacco plants leaves, freeze-dried and ground into powder, take freeze-dried tobacco powder 50mg placed in 50mL centrifuge tube, add V methanol:V chloroform = 2:1 mixture 7.5mL, 37℃ 200rpm extraction 24h after centrifugation to collect the upper organic phase to a new centrifuge tube. Again to the precipitate again V methanol:V chloroform = 2:1 mixture 7.5mL, repeated extraction 12h after collection of the upper organic phase. The two collected upper organic phase mixture after adding 5mL chloroform solution and 9mL volume fraction 1% NaCl solution, fully mixed, so that V chloroform:V methanol:V water = 2:2:1.8, centrifugal collection of lower organic phase in clean has been weighed empty glass pipette (m0). Put into the oven to dry organic reagent, oil on the wall of the pipette, again weighing (m1). Yeast total fatty acid content = (m1-m0) / 0.05. Each sample set 3 times.

[0113] 4、Results and analysis

[0114] 4.1 As shown in Figure 4 BamHI and Kpn I double enzyme digestion of pCAMBIA1303-PfDof29 recombinant plasmid, according to the position of Marker to judge the double enzyme digestion of vector fragment length is about 12000bp above, the length of the target gene fragment is between 1338bp, consistent with the expected results, according to the purpose of the gene of plant expression vector construction success.

[0115] The double enzyme digestion of the successful plasmid was sent to the company for sequencing comparison, the result analysis sequence is correct, only 2 base mutations, no change of protein sequence, proving that the PfDof29 gene of perilla has been successfully connected to the pCAMBIA1303 vector, and the recombinant vector has been successfully constructed.

[0116] 4.2 The single clone cultured by the screening plate of transformed Agrobacterium was cultured, and the gel electrophoresis showed that the band position was consistent with the expected band position, indicating that the Agrobacterium transformation was successful.

[0117] 4.3 Tobacco genetic transformation was performed by Agrobacterium-mediated leaf disc method with hygromycin as a selection marker, and the PfDof29 gene was introduced into tobacco, and the expression of the target gene was detected by electrophoresis at the genome level and the transcription level, and the results are shown in Figure 5 Figure 6

[0118] 4.4 The transgenic tobacco leaves were vacuum freeze-dried and ground into powder, and the total oil content was extracted. The results are shown in Figure 7

[0119] Example 3, YIH discloses that the PfDof29 gene can specifically bind to the PfFAD8 gene promoter

[0120] 1. PfDof29 transcription factor and oil accumulation key gene correlation analysis

[0121] The fatty acid desaturase (FAD6 and FAD8) gene, the biotin carboxyl carrier protein (BCCP1) gene, and the stearoyl-ACP desaturase (FAB2 and SAD2) gene were selected as possible genes regulated by the PfDof29 transcription factor. The promoter sequences of the genes are shown in Table 8. The correlation between the expression of the downstream fatty acid genes of perilla and the expression of the PfDofs transcription factor with high expression in seeds was analyzed using the Genedio online software, as shown in Figure 8

[0122] Table 8 Downstream gene promoter sequences

[0123]

[0124]

[0125] 2. Construction of bait vector and prey vector

[0126] 2.1 Analysis of PfFAD8 promoter sequence of perilla

[0127] The PfFAD8 promoter sequence was obtained from the perilla whole genome database, and the promoter cis-acting element prediction was performed in Plant CARE.

[0128] 2.2 Construction of prey vector and bait vector​​​​

[0129] Design full-length primers pGADT7-PfDof29-F, pGADT7-PfDof29-R; PfFAD8 promoter primers pHIS2-proPfFAD8-F, pHIS2-proPfFAD8-R, see Table 9; double enzyme digestion of the prey vector pGADT7 with restriction endonuclease Xma I, BamHI, double enzyme digestion of the bait vector pHIS2 with EcoR I, Sac I. PfDof29 was ligated to the prey vector pGADT7 by homologous cloning, and the construction method of the recombinant vector is described in Example 1. The promoter sequence of the PfFAD8 gene containing the AAAG element was amplified from the Persea americana seed DNA as shown in Figure 9 The bait vector pHIS2-proPfFAD8 was constructed by ligating in the pHIS2 vector by recombination transformation.

[0130] Table 9 Primer sequences

[0131]

[0132] 2.3 Yeast one-hybrid

[0133] The pHIS2-P53 and pGAD53m plasmids were co-transformed into Y187 yeast competent cells as the positive group for the study, and the bait vector pHIS2-proPfFAD8 was co-transformed with the empty pGADT7 and the prey vector pGADT7-PfDof29 into Y187 yeast competent cells, respectively, and plated on SD / -Leu / -Trp double deficiency medium, 30°C, dark culture for 2d, single colonies were picked and expanded, and the successfully transformed negative control pHIS2-proPfFAD8+pGADT7 strain and the positive control pHIS2-p53+pGAD53m strain were resuspended to OD 600 = 0.2 with 0.9% NaCl solution, and then sequentially diluted by 10 0 , 10 -1 , 10 -2 , 10 -3The concentrations were respectively spotted on 0 mmol / L, 10 mmol / L, 30 mmol / L, 40 mmol / L, 50 mmol / L and 70 mmol / L 3-AT SD / -Trp / -Leu / -His triple-deficient medium, and the optimal self-activation concentration was screened after 3d dark culture at 30℃. Then, the negative control group pHIS2-proPfFAD8+pGADT7 and the experimental group pHIS2-proPfFAD8+pGADT7-PfDof29 and pHIS2-p53+pGAD53m positive control after successful transformation were diluted and spotted on the 3-AT SD / -His / -Leu / -Trp triple-deficient solid medium screened by self-activation, and 3d dark culture was carried out at 30℃.

[0134] 3. Results and analysis

[0135] The downstream genes containing the AAAG element in the promoter were screened and identified from the Perilla frutescens genome. As shown in Table 8, the analysis of the promoters thereof found that they contained multiple AAAG elements. Further, whether they were regulated by the PfDof transcription factor was speculated. The correlation analysis of the five genes and the PfDof transcription factor highly expressed during the seed development period was analyzed, and the results are shown in Table 9. PfFAB2 was positively correlated with multiple transcription factors, and was significantly positively correlated with PfDof5 and PfDof12. PfFAD8 was significantly correlated with PfDof29, and PfFAD6 was significantly positively correlated with PfDof12. PfBCCP1 was significantly negatively correlated with PfDof2, and PfSAD2 was significantly positively correlated with PfDof12 and PfDof14. The transcription factor PfDof29 with the highest expression in the seed was selected as the research target, and it was speculated that the PfFAD8 gene was transcriptionally regulated by the PfDof29 transcription factor. The bait vector self-activation results are shown in Table 10. The strains could grow normally on the medium with 0 mmol / L, 10 mmol / L, 30 mmol / L and 40 mmol / L 3-AT, and the positive control could grow normally on the medium with 50 mmol / L 3-AT. The negative control pHIS2-proPfFAD8+pGADT7 was inhibited. 50 mmol / L 3-AT was used as the optimal concentration of the yeast bait vector self-activation. The negative control group pHIS2-proPfFAD8+pGADT7 and the experimental group pHIS2-proPfFAD8+pGADT7-PfDof29 and the pHIS2-p53+pGAD53m positive control after successful transformation were diluted and spotted on the 50 mmol / L 3-AT SD / -His / -Leu / -Trp triple-deficient solid medium. The results are shown in Table 11. Figure 8 Figure 10 Figure 11 ​​As shown, the positive strain can grow normally, the growth of the negative control pHIS2-proPfFAD8+pGADT7 is inhibited, and the experimental group pHIS2-proPfFAD8+pGADT7-PfDof29 can grow normally, indicating that PfDof29 can bind to the AAAG element of the promoter of PfFAD8, thereby interacting with the PfFAD8 gene to regulate the lipid biosynthesis of perilla seeds.

[0136] Example 4

[0137] 1. Construction of pYES2.0-PfFAD8 yeast heterologous expression vector

[0138] According to the coding sequence (CDS) of the PfFAD8 gene of perilla, the nucleotide sequence of the PfFAD8 gene of perilla is shown as SEQ ID NO. 2, the primer information is shown in Table 10, PCR amplification is performed using high-fidelity enzyme, the amplification procedure and system are referred to Example 1, and electrophoresis analysis is performed by 1% agarose gel with a mass fraction to verify the specificity of amplification and the size of the target fragment. The target DNA fragment is recovered by gel cutting after electrophoresis and is subjected to purification treatment. The EasyPure PCR Purification Kit is used in the purification process to ensure the purity and stability of the DNA fragment. The purified fragment is stored at -20°C for subsequent experimental use. The pYES2.0 is subjected to double enzyme digestion using restriction endonucleases Sac I and Xba I. The PfFAD8 fragment is connected to the corresponding linearized pYES2.0 vector, and the enzyme connection system and E. coli transformation (LB solid selection plate resistance: ampicillin) steps are referred to Example 1. The positive E. coli detected by PCR is sequenced and preserved for subsequent experiments.

[0139] Table 10 Primer information

[0140] Primer name Primer sequence, 5'-3' SEQ ID NO. 35: pYES2.0-PfFAD8-F attaagcttggtaccgagctcATGGCGAGTTGGGTGTTATCA SEQ ID NO. 36: pYES2.0-PfFAD8-R tacatgatgcggccctctagaTCAATTCAGCTCAGGATCGGTC

[0141] 2. Preparation and transformation of yeast competence

[0142] 2.1 Culture of yeast strains

[0143] INVSc1 Saccharomyces cerevisiae is an ideal protein expression strain, which has ampicillin and kanamycin resistance, and grows best at 30°C in YPD medium. INVSc1 Saccharomyces cerevisiae is a His, Leu, Trp and Ura auxotrophic strain, and therefore cannot grow in a medium lacking histidine, leucine, tryptophan and uracil. The pYES2.0 vector has ampicillin resistance and contains a URA3 site, and can grow in a medium lacking uracil. Therefore, the positive transformants can be screened using a uracil-deficient medium (SC-URA) supplemented with kanamycin.

[0144] 2.2 Yeast competence preparation and transformation

[0145] Yeast competence preparation was performed according to the Yeast Transformation Kit. The transformation was performed as follows: a premix solution was prepared (Y3350 μL; recombinant plasmid 1000 ng; ddH2O was added to 360 μL), the gun tip was thoroughly blown and sucked to mix, and then the competent cells were added. The competent cells were thoroughly suspended by repeated blowing and sucking. The cells were heat shocked in a metal bath at 30 °C for 1 h, and mixed every 10 min during the process. The cells were centrifuged at 13000 rpm for 1 min, and the supernatant was discarded. The competent cells were recovered in YPD plus medium and cultured at 30 °C for 1 h with shaking. The cells were centrifuged at 13000 rpm for 1 min, and the supernatant was discarded. The reaction solution was centrifuged to remove the supernatant. 200 μL of sterile deionized water was added to the precipitate, which was mixed and then 20 μL was taken and spread on SC-URA solid medium (containing 2% glucose) containing kanamycin (50 μg / mL), and cultured at 30 °C for 2 days.

[0146] 2.3 Positive identification of recombinant yeast

[0147] Single colonies grown on the SC-URA screening plate for 2 days were picked into 5 mL of SC-URA liquid medium (containing 2% glucose and 50 μg / mL of kanamycin) and cultured at 30 °C with shaking until the bacterial solution was turbid. PCR detection was performed using the homologous arm primers in Table 10 to identify positive recombinant bacterial solution.

[0148] The yeast was subjected to wall breaking treatment before detection. The bacterial solution was taken in a 1.5 mL tube, centrifuged at 13000 rpm for 1 min to remove the supernatant, 500 μL of ddH2O was added again to centrifuge the cells, the supernatant was discarded after centrifugation at 13000 rpm for 1 min, 200 μL of TE buffer was added to the precipitate, which was placed in a metal bath at 100 °C for 10 min, ice bath for 10 min, and centrifuged at 13000 rpm for 10 min to collect the supernatant for PCR detection.

[0149] 2.4 Induced expression of transgenic yeast

[0150] Positive monoclonal bacterial strains were taken 50 μL and inoculated into SC-URA medium containing 2% galactose and 50 μg / mL of kanamycin, and cultured at 30 °C, 200 rpm on a shaker for 48 h until the OD 600 was 1.0. After centrifugation (5000 rpm, 8 min), the supernatant was discarded, and the bacterial precipitate was washed twice with sterile deionized water. The yeast cells were collected. After vacuum drying and freezing treatment, they were ground into powder and stored in a centrifuge tube at room temperature for later use.

[0151] 2.5 Total oil content and oil droplet staining observation of transgenic yeast

[0152] The induced transgenic yeast cells were cultured at 30°C and 200 rpm in a shaker for 48 hours, then resuspended in sterile water to OD. 600 =0.2, take 200 μL of bacterial culture, add 200 μL of BODIPY 505 / 515 working solution, and stain in the dark for 30 min. Under dim light conditions, take 20 μL of the stained bacterial culture and prepare a slide. Observe the number and size of oil droplets in the yeast cells using a laser confocal microscope. Weigh 50 mg of freeze-dried transgenic yeast cell powder to extract its total lipid content, and determine the total lipid content of the transgenic yeast (Method Example 2).

[0153] 3. Results and Analysis

[0154] 3.1 The cloned target fragment PfFAD8, as shown... Figure 12 As shown, with the pYES2.0 carrier, as Figure 13 The phases shown were connected, screened with ampicillin, and tested positive by PCR. Figure 14 To verify the results of double digestion of the pYES2.0-PfFAD8 recombinant plasmid with Sac I and Xba I, the markers indicated that the vector fragment length was approximately 5000bp to 6000bp, and the target gene fragment length was approximately 1317bp, consistent with the expected results. Therefore, it was basically determined that the yeast recombinant vector containing the PfFAD8 gene was successfully constructed. The constructed vector was sent to a sequencing company for sequencing, and the results showed no base mutations, proving that the PfFAD8 gene was successfully cloned.

[0155] 3.2 The constructed pYES2.0-PfFAD8 recombinant plasmid was transformed into INVSC1 Saccharomyces cerevisiae. The PCR detection results are as follows: Figure 15 As shown, gel electrophoresis revealed that the yeast detection band of the pYES2.0-PfFAD8 recombinant vector was around 1317 bp. All the bands obtained by electrophoresis were consistent with the expected length, indicating that the pYES2.0-PfFAD8 recombinant plasmid had been successfully transformed into INVSC1 yeast.

[0156] 3.3 Weigh 50 mg of freeze-dried transgenic yeast cell powder and extract the total oil content. The results are as follows: Figure 16 As shown, compared to wild-type Saccharomyces cerevisiae, yeast transgenic with the PfFAD8 gene showed a significant increase in total lipid content, ranging from 1.94% to 2.12%, and a significant increase in the number of oil droplets, such as... Figure 17 As shown, the PfFAD8 gene of Perilla frutescens can significantly improve the ability of yeast to synthesize lipids.

[0157] Any combination of the technical features in the above-described embodiments can be made, and for the sake of brevity, not all possible combinations are described, however, as long as the combination of the technical features does not exist in contradiction, it shall be considered within the scope of the present disclosure.

[0158] The above-described embodiments only express several implementation manners of the present application, and the description is relatively specific and detailed, but it shall not be understood as a limitation on the patent scope of the present application. It shall be pointed out that, for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, and these shall be within the protection scope of the present application. Therefore, the protection scope of the present application patent shall be subject to the appended claims.

Claims

1. A perilla variety for regulating fatty acid and oil synthesis in plants. PfDof29 The application of genes in increasing the total oil content of plant leaves is characterized by, The perilla PfDof29 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The application refers to constructing PfDof29 The recombinant expression vector of the gene to improve the expression amount of the gene in plants PfDof29 The expression amount of the gene is further improved to increase the total oil content in plant leaves The plant is tobacco.

2. Use according to claim 1, wherein The recombinant expression vector comprises the perilla PfDof29 gene according to claim 1 and a backbone plasmid to which the perilla PfDof29 gene is ligated.

3. Use according to claim 2, wherein the compound is ###0002### The backbone plasmid is pCAMBIA1303.

4. The use according to claim 2, wherein The method for constructing the recombinant expression vector is to amplify the perilla PfDof29 gene using specific primers, recover the PCR product, and link the recovered PCR product with a backbone plasmid pCAMBIA1303 to obtain a recombinant expression vector.

5. The use according to claim 4, wherein the compound is ###0002### The nucleotide sequences of the specific primer pair are shown as SEQ ID NO. 29 and SEQ ID NO.

30.

6. The use according to claim 1, wherein By mediating fatty acid key genes PfFAD8 Modulating plant lipid biosynthesis to increase total oil content in plant leaves.

Images